Starting /dee2/code/volunteer_pipeline.sh SRR12161427 current disk space = 3088821817344 free memory = 1425174892 SRR12161427 SRAfilesize 7695d3bc37ccc3959c7fed15bab7a8f3 SRR12161427.sra SRR12161427.sra file validated SRR12161427 is paired end SRR12161427 is conventional basespace SRR12161427 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.60375 37.0 37.0 37.0 37.0 37.0 2 36.449 37.0 37.0 37.0 37.0 37.0 3 36.5255 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.6045 37.0 37.0 37.0 37.0 37.0 6 36.581 37.0 37.0 37.0 37.0 37.0 7 36.4775 37.0 37.0 37.0 37.0 37.0 8 36.5585 37.0 37.0 37.0 37.0 37.0 9 36.54 37.0 37.0 37.0 37.0 37.0 10-14 36.5911 37.0 37.0 37.0 37.0 37.0 15-19 36.5457 37.0 37.0 37.0 37.0 37.0 20-24 36.5084 37.0 37.0 37.0 37.0 37.0 25-29 36.490899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4809 37.0 37.0 37.0 37.0 37.0 35-39 36.4209 37.0 37.0 37.0 37.0 37.0 40-44 36.428 37.0 37.0 37.0 37.0 37.0 45-49 36.41740000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3594 37.0 37.0 37.0 37.0 37.0 55-59 36.358000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.311299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.314600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3233 37.0 37.0 37.0 37.0 37.0 75-79 36.285000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.273199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2682 37.0 37.0 37.0 37.0 37.0 90-94 36.3206 37.0 37.0 37.0 37.0 37.0 95-99 36.1923 37.0 37.0 37.0 37.0 37.0 100-104 36.2106 37.0 37.0 37.0 37.0 37.0 105-109 36.1389 37.0 37.0 37.0 37.0 37.0 110-114 36.1657 37.0 37.0 37.0 37.0 37.0 115-119 36.1562 37.0 37.0 37.0 37.0 37.0 120-124 36.088300000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.038199999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0361 37.0 37.0 37.0 37.0 37.0 135-139 35.9166 37.0 37.0 37.0 37.0 37.0 140-144 35.92139999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.8729 37.0 37.0 37.0 37.0 37.0 150-151 35.768 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 1.0 27 7.0 28 10.0 29 22.0 30 23.0 31 28.0 32 52.0 33 82.0 34 111.0 35 306.0 36 2960.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.71092773193298 11.127781945486372 6.026506626656665 39.13478369592398 2 20.025000000000002 12.45 34.375 33.15 3 15.5 18.125 28.775000000000002 37.6 4 21.5 24.099999999999998 23.575 30.825000000000003 5 24.625 31.974999999999998 22.5 20.9 6 21.275 33.6 23.9 21.224999999999998 7 15.1 25.3 43.225 16.375 8 16.825000000000003 24.975 32.574999999999996 25.624999999999996 9 16.425 24.3 35.475 23.799999999999997 10-14 19.375 29.630000000000003 27.62 23.375 15-19 20.125 28.025 28.13 23.72 20-24 19.3 28.26 28.27 24.169999999999998 25-29 19.625 27.825 27.98 24.57 30-34 19.86 27.62 28.265 24.255 35-39 19.900000000000002 28.38 27.525 24.195 40-44 20.5 28.49 27.450000000000003 23.56 45-49 20.075000000000003 27.52 28.285 24.12 50-54 20.435 28.115000000000002 27.565 23.885 55-59 19.994999999999997 28.694999999999997 26.69 24.62 60-64 20.244999999999997 28.54 27.215 24.0 65-69 20.405 28.389999999999997 26.935 24.27 70-74 19.794999999999998 28.544999999999998 27.455000000000002 24.205 75-79 19.85 28.43 27.42 24.3 80-84 20.16 27.905 27.405 24.529999999999998 85-89 20.185 28.189999999999998 27.644999999999996 23.98 90-94 20.69 28.01 27.515 23.785 95-99 20.785 27.779999999999998 27.195000000000004 24.240000000000002 100-104 20.43 27.860000000000003 28.285 23.425 105-109 20.599999999999998 28.794999999999998 27.195000000000004 23.41 110-114 20.580000000000002 28.68 27.084999999999997 23.655 115-119 21.335 27.900000000000002 27.245 23.52 120-124 20.875 27.77 27.27 24.085 125-129 20.73 28.415000000000003 27.11 23.745 130-134 20.695 28.060000000000002 27.584999999999997 23.66 135-139 20.86 27.185 27.825 24.13 140-144 20.905 27.834999999999997 27.37 23.89 145-149 20.9 27.935 27.435 23.73 150-151 20.625 27.8375 27.500000000000004 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 3.5 25 6.0 26 5.0 27 5.0 28 6.5 29 11.0 30 16.0 31 27.5 32 36.5 33 31.5 34 41.0 35 55.5 36 72.5 37 86.0 38 113.5 39 150.5 40 172.0 41 199.5 42 241.0 43 262.5 44 260.0 45 253.0 46 260.0 47 265.0 48 234.5 49 210.5 50 197.0 51 155.0 52 125.5 53 122.5 54 102.5 55 73.5 56 54.0 57 42.0 58 29.0 59 18.0 60 14.5 61 11.5 62 5.5 63 4.5 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.30645161290323 86.775 2 5.994623655913978 11.15 3 0.6451612903225806 1.7999999999999998 4 0.026881720430107527 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026881720430107527 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6499999999999999 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAAT 15 1.1411342E-4 145.0 145 CAAATGT 10 0.006830828 145.0 9 >>END_MODULE SRR12161427 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161427_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.337 37.0 37.0 37.0 37.0 37.0 2 35.9125 37.0 37.0 37.0 37.0 37.0 3 36.0295 37.0 37.0 37.0 37.0 37.0 4 36.0855 37.0 37.0 37.0 37.0 37.0 5 36.122 37.0 37.0 37.0 37.0 37.0 6 36.129 37.0 37.0 37.0 37.0 37.0 7 36.0775 37.0 37.0 37.0 37.0 37.0 8 36.2825 37.0 37.0 37.0 37.0 37.0 9 36.304 37.0 37.0 37.0 37.0 37.0 10-14 36.1873 37.0 37.0 37.0 37.0 37.0 15-19 36.198699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.168099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.106899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.034000000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.9613 37.0 37.0 37.0 37.0 37.0 40-44 35.9992 37.0 37.0 37.0 37.0 37.0 45-49 35.9541 37.0 37.0 37.0 37.0 37.0 50-54 35.966899999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.949 37.0 37.0 37.0 37.0 37.0 60-64 35.9489 37.0 37.0 37.0 37.0 37.0 65-69 35.8549 37.0 37.0 37.0 37.0 37.0 70-74 35.8272 37.0 37.0 37.0 37.0 37.0 75-79 35.7906 37.0 37.0 37.0 37.0 37.0 80-84 35.8504 37.0 37.0 37.0 37.0 37.0 85-89 35.753899999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.7184 37.0 37.0 37.0 37.0 37.0 95-99 35.7529 37.0 37.0 37.0 37.0 37.0 100-104 35.7779 37.0 37.0 37.0 37.0 37.0 105-109 35.650099999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6609 37.0 37.0 37.0 37.0 37.0 115-119 35.6506 37.0 37.0 37.0 37.0 37.0 120-124 35.663 37.0 37.0 37.0 37.0 37.0 125-129 35.584999999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.477599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.468300000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.4442 37.0 37.0 37.0 37.0 37.0 145-149 35.4914 37.0 37.0 37.0 37.0 37.0 150-151 34.8965 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 3.0 15 1.0 16 3.0 17 2.0 18 3.0 19 1.0 20 0.0 21 5.0 22 4.0 23 3.0 24 4.0 25 10.0 26 8.0 27 15.0 28 25.0 29 32.0 30 35.0 31 31.0 32 61.0 33 94.0 34 194.0 35 504.0 36 2678.0 37 278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.325 24.3 8.674999999999999 24.7 2 27.875 26.224999999999998 29.075 16.825000000000003 3 21.075 28.525 31.125000000000004 19.275000000000002 4 23.125 35.3 22.975 18.6 5 24.825 37.525 21.025 16.625 6 20.3 39.5 22.45 17.75 7 22.175 21.8 37.175000000000004 18.85 8 21.425 26.55 27.025 25.0 9 21.925 24.025 30.0 24.05 10-14 23.119999999999997 28.98 26.41 21.490000000000002 15-19 23.59 27.925 27.224999999999998 21.26 20-24 23.02 28.244999999999997 27.72 21.015 25-29 22.345000000000002 28.144999999999996 27.805000000000003 21.705 30-34 23.244999999999997 28.249999999999996 27.565 20.94 35-39 22.965 28.345 28.12 20.57 40-44 22.865 27.435 28.575 21.125 45-49 22.605 27.615000000000002 28.1 21.68 50-54 22.56 27.27 28.005000000000003 22.165000000000003 55-59 22.625 27.63 28.000000000000004 21.745 60-64 23.044999999999998 27.544999999999998 27.875 21.535 65-69 23.544999999999998 27.334999999999997 27.575 21.545 70-74 22.765 27.355 27.500000000000004 22.38 75-79 22.81 27.825 27.76 21.605 80-84 22.905 27.834999999999997 27.839999999999996 21.42 85-89 23.71 28.215 26.97 21.105 90-94 23.919999999999998 27.889999999999997 26.919999999999998 21.27 95-99 24.01 27.92 27.155 20.915 100-104 23.549999999999997 27.395000000000003 27.495000000000005 21.560000000000002 105-109 23.415 27.279999999999998 27.744999999999997 21.560000000000002 110-114 23.465 27.515 28.025 20.995 115-119 24.125 27.400000000000002 27.235 21.240000000000002 120-124 23.735 28.54 26.905 20.82 125-129 23.695 27.88 27.33 21.095 130-134 24.765 27.650000000000002 27.139999999999997 20.445 135-139 24.16 27.58 27.439999999999998 20.82 140-144 23.75 27.834999999999997 27.42 20.995 145-149 23.525 28.185 27.6 20.69 150-151 25.224999999999998 27.3375 27.537499999999998 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 0.5 21 0.0 22 2.0 23 3.5 24 2.0 25 3.5 26 5.5 27 6.5 28 6.5 29 12.0 30 16.0 31 16.0 32 23.5 33 28.0 34 38.5 35 63.5 36 82.5 37 113.5 38 149.5 39 158.0 40 177.5 41 204.0 42 230.0 43 264.5 44 276.5 45 268.0 46 256.0 47 236.5 48 219.5 49 203.5 50 174.5 51 149.5 52 127.5 53 106.0 54 85.5 55 65.0 56 52.5 57 40.0 58 29.5 59 23.5 60 14.0 61 11.5 62 12.5 63 9.0 64 4.5 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 1.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.17139001349528 86.3 2 6.180836707152497 11.450000000000001 3 0.5398110661268556 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.08097165991902834 0.525 8 0.0 0.0 9 0.026990553306342778 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 7 0.17500000000000002 No Hit CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.2 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748100 spots for SRR12161427.sra Written 748100 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra Read 748099 spots for SRR12161427.sra Written 748099 spots for SRR12161427.sra SRR ids: ['SRR12161427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ehxg8dm SRR12161427.sra spots: 14961981 blocks: [[1, 748099], [748100, 1496198], [1496199, 2244297], [2244298, 2992396], [2992397, 3740495], [3740496, 4488594], [4488595, 5236693], [5236694, 5984792], [5984793, 6732891], [6732892, 7480990], [7480991, 8229089], [8229090, 8977188], [8977189, 9725287], [9725288, 10473386], [10473387, 11221485], [11221486, 11969584], [11969585, 12717683], [12717684, 13465782], [13465783, 14213881], [14213882, 14961981]] SRR12161427 file size 5063035 SRR12161427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161427 SRR12161427_1.fastq SRR12161427_2.fastq Input file: SRR12161427_1.fastq Paired file: SRR12161427_2.fastq trimmed: SRR12161427-trimmed-pair1.fastq, SRR12161427-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:39:58 2025 >> started Thu Feb 13 16:40:13 2025 >> done (15.513s) 14961981 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 985 ( 0.01%) empty read pairs filtered out after trimming by size control 14960975 (99.99%) read pairs available; of these: 439424 ( 2.94%) trimmed read pairs available after processing 14521551 (97.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 12 0.00% 25 4 0.00% 26 8 0.00% 27 9 0.00% 28 9 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 15 0.00% 33 7 0.00% 34 6 0.00% 35 14 0.00% 36 13 0.00% 37 8 0.00% 38 11 0.00% 39 16 0.00% 40 13 0.00% 41 9 0.00% 42 19 0.00% 43 13 0.00% 44 12 0.00% 45 18 0.00% 46 14 0.00% 47 14 0.00% 48 19 0.00% 49 23 0.00% 50 25 0.00% 51 17 0.00% 52 30 0.00% 53 22 0.00% 54 29 0.00% 55 24 0.00% 56 31 0.00% 57 37 0.00% 58 37 0.00% 59 39 0.00% 60 51 0.00% 61 45 0.00% 62 44 0.00% 63 41 0.00% 64 83 0.00% 65 52 0.00% 66 74 0.00% 67 87 0.00% 68 82 0.00% 69 85 0.00% 70 107 0.00% 71 126 0.00% 72 122 0.00% 73 151 0.00% 74 143 0.00% 75 163 0.00% 76 197 0.00% 77 193 0.00% 78 233 0.00% 79 243 0.00% 80 288 0.00% 81 312 0.00% 82 364 0.00% 83 364 0.00% 84 406 0.00% 85 510 0.00% 86 527 0.00% 87 645 0.00% 88 643 0.00% 89 708 0.00% 90 828 0.01% 91 892 0.01% 92 958 0.01% 93 1062 0.01% 94 1144 0.01% 95 1259 0.01% 96 1323 0.01% 97 1391 0.01% 98 1587 0.01% 99 1680 0.01% 100 1888 0.01% 101 1897 0.01% 102 2068 0.01% 103 2291 0.02% 104 2424 0.02% 105 2584 0.02% 106 2718 0.02% 107 2833 0.02% 108 3095 0.02% 109 3237 0.02% 110 3520 0.02% 111 3628 0.02% 112 3876 0.03% 113 4086 0.03% 114 4392 0.03% 115 4701 0.03% 116 4700 0.03% 117 5030 0.03% 118 5249 0.04% 119 5460 0.04% 120 5894 0.04% 121 6128 0.04% 122 6204 0.04% 123 6599 0.04% 124 7108 0.05% 125 7179 0.05% 126 7629 0.05% 127 7839 0.05% 128 8134 0.05% 129 8403 0.06% 130 8821 0.06% 131 9395 0.06% 132 9594 0.06% 133 10174 0.07% 134 10402 0.07% 135 10790 0.07% 136 10945 0.07% 137 11747 0.08% 138 11843 0.08% 139 12461 0.08% 140 12775 0.09% 141 13480 0.09% 142 14128 0.09% 143 14434 0.10% 144 15411 0.10% 145 15958 0.11% 146 16101 0.11% 147 16457 0.11% 148 17288 0.12% 149 17857 0.12% 150 18746 0.13% 151 14521551 97.06% 14960975 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.94 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=54.01 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.5 sequence=AGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCC criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=1.41 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=41.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.6 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAG SRR12161427 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:40:55 Started mapping on | Feb 13 16:40:55 Finished on | Feb 13 16:42:36 Mapping speed, Million of reads per hour | 533.26 Number of input reads | 14960975 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13957981 Uniquely mapped reads % | 93.30% Average mapped length | 299.61 Number of splices: Total | 14191520 Number of splices: Annotated (sjdb) | 13927653 Number of splices: GT/AG | 13912570 Number of splices: GC/AG | 236902 Number of splices: AT/AC | 8793 Number of splices: Non-canonical | 33255 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365528 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 120469 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637466 637466 637466 N_multimapping 365528 365528 365528 N_noFeature 445735 13792423 488898 N_ambiguous 222274 770 99459 UnstrandedReadsAssigned:13289972 PositiveStrandReadsAssigned:164788 NegativeStrandReadsAssigned:13369624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161427 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161427-trimmed-pair1.fastq SRR12161427-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,960,975 reads, 13,430,347 reads pseudoaligned [quant] estimated average fragment length: 286.34 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR12161427.ke.tsv 34699 SRR12161427.se.tsv 87100 total ==> SRR12161427.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.66 382 13.7026 Potri.005G024800.1.v4.1 1035 749.66 192 15.918 Potri.004G059700.1.v4.1 961 675.939 35 3.2182 Potri.007G009000.2.v4.1 1416 1130.66 0 0 Potri.003G141000.2.v4.1 2943 2657.66 481.676 11.2644 Potri.016G087400.1.v4.1 270 62.1602 666 665.909 Potri.015G069301.1.v4.1 564 293.584 0 0 Potri.010G195200.1.v4.1 1773 1487.66 4 0.167112 Potri.012G127500.1.v4.1 977 691.781 282 25.3357 ==> SRR12161427.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 215 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR12161427 completed mapping pipeline successfully