Starting /dee2/code/volunteer_pipeline.sh SRR12161428 current disk space = 3088639307776 free memory = 1581592376 SRR12161428 SRAfilesize 382120c3a00e702b26c0c6028bddcfce SRR12161428.sra SRR12161428.sra file validated SRR12161428 is paired end SRR12161428 is conventional basespace SRR12161428 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57425 37.0 37.0 37.0 37.0 37.0 2 36.5545 37.0 37.0 37.0 37.0 37.0 3 36.5515 37.0 37.0 37.0 37.0 37.0 4 36.506 37.0 37.0 37.0 37.0 37.0 5 36.5665 37.0 37.0 37.0 37.0 37.0 6 36.488 37.0 37.0 37.0 37.0 37.0 7 36.451 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.4635 37.0 37.0 37.0 37.0 37.0 10-14 36.572 37.0 37.0 37.0 37.0 37.0 15-19 36.4862 37.0 37.0 37.0 37.0 37.0 20-24 36.5127 37.0 37.0 37.0 37.0 37.0 25-29 36.463100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.456900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.458000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4049 37.0 37.0 37.0 37.0 37.0 45-49 36.428700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.422 37.0 37.0 37.0 37.0 37.0 55-59 36.3378 37.0 37.0 37.0 37.0 37.0 60-64 36.3657 37.0 37.0 37.0 37.0 37.0 65-69 36.373099999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.314800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2752 37.0 37.0 37.0 37.0 37.0 80-84 36.316199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2411 37.0 37.0 37.0 37.0 37.0 90-94 36.2567 37.0 37.0 37.0 37.0 37.0 95-99 36.261700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.249 37.0 37.0 37.0 37.0 37.0 105-109 36.163199999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1291 37.0 37.0 37.0 37.0 37.0 115-119 36.1757 37.0 37.0 37.0 37.0 37.0 120-124 36.1682 37.0 37.0 37.0 37.0 37.0 125-129 36.10080000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.047900000000006 37.0 37.0 37.0 37.0 37.0 135-139 36.079 37.0 37.0 37.0 37.0 37.0 140-144 35.936899999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.956100000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.80575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 1.0 26 7.0 27 5.0 28 15.0 29 21.0 30 25.0 31 43.0 32 43.0 33 57.0 34 109.0 35 269.0 36 2961.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.7586896724181 11.252813203300825 7.226806701675419 46.76169042260565 2 18.85 13.575000000000001 35.15 32.425 3 16.675 14.774999999999999 26.924999999999997 41.625 4 21.125 23.674999999999997 23.3 31.900000000000002 5 22.525000000000002 29.375 25.174999999999997 22.925 6 21.5 32.800000000000004 24.525 21.175 7 16.5 27.150000000000002 38.9 17.45 8 17.0 26.825 32.675 23.5 9 17.675 23.1 36.0 23.225 10-14 19.545 30.19 27.175 23.09 15-19 19.28 28.155 28.084999999999997 24.48 20-24 19.259999999999998 28.935 27.365000000000002 24.44 25-29 19.665 28.544999999999998 27.634999999999998 24.154999999999998 30-34 19.96 28.615000000000002 27.43 23.995 35-39 19.634999999999998 28.37 27.955000000000002 24.04 40-44 20.005 29.035 27.1 23.86 45-49 19.86 28.63 27.235 24.275 50-54 19.905 28.244999999999997 27.650000000000002 24.2 55-59 19.925 28.37 27.415 24.29 60-64 20.135 27.975 27.650000000000002 24.240000000000002 65-69 19.605 29.425 27.22 23.75 70-74 20.02 28.515 27.455000000000002 24.01 75-79 19.68 27.605 28.425 24.29 80-84 20.105 28.23 27.474999999999998 24.19 85-89 19.7 28.294999999999998 27.855 24.15 90-94 20.01 28.87 27.389999999999997 23.73 95-99 20.705000000000002 27.884999999999998 28.255000000000003 23.155 100-104 19.900000000000002 28.715000000000003 27.384999999999998 24.0 105-109 19.835 28.365000000000002 27.639999999999997 24.16 110-114 20.455000000000002 28.095 27.46 23.990000000000002 115-119 20.86 28.315 27.01 23.815 120-124 20.674999999999997 28.34 26.950000000000003 24.035 125-129 20.45 29.115000000000002 27.125 23.31 130-134 20.544999999999998 28.244999999999997 27.389999999999997 23.82 135-139 20.73 27.165 27.66 24.445 140-144 20.125 28.335 27.779999999999998 23.76 145-149 20.75 27.675 27.58 23.995 150-151 20.05 27.925 27.487499999999997 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 4.5 26 4.0 27 5.0 28 9.0 29 13.5 30 21.0 31 26.0 32 27.0 33 39.0 34 50.0 35 66.0 36 88.5 37 103.5 38 129.5 39 164.0 40 189.5 41 212.0 42 235.0 43 250.0 44 258.0 45 266.5 46 247.5 47 234.0 48 236.5 49 210.5 50 170.5 51 150.5 52 126.5 53 106.0 54 92.0 55 65.5 56 47.0 57 37.0 58 33.0 59 26.0 60 17.5 61 9.5 62 8.5 63 4.5 64 1.0 65 1.5 66 2.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.89339299815741 90.125 2 4.948670702816531 9.4 3 0.13161358252171623 0.375 4 0.026322716504343247 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4500000000000002 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 1.8624999999999998 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161428 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41 37.0 37.0 37.0 37.0 37.0 2 36.049 37.0 37.0 37.0 37.0 37.0 3 36.2045 37.0 37.0 37.0 37.0 37.0 4 36.1425 37.0 37.0 37.0 37.0 37.0 5 36.3695 37.0 37.0 37.0 37.0 37.0 6 36.2985 37.0 37.0 37.0 37.0 37.0 7 36.2305 37.0 37.0 37.0 37.0 37.0 8 36.309 37.0 37.0 37.0 37.0 37.0 9 36.331 37.0 37.0 37.0 37.0 37.0 10-14 36.302099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2639 37.0 37.0 37.0 37.0 37.0 20-24 36.2036 37.0 37.0 37.0 37.0 37.0 25-29 36.127300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1148 37.0 37.0 37.0 37.0 37.0 35-39 36.095400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.098400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.040600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.1062 37.0 37.0 37.0 37.0 37.0 55-59 36.0051 37.0 37.0 37.0 37.0 37.0 60-64 35.971 37.0 37.0 37.0 37.0 37.0 65-69 35.9969 37.0 37.0 37.0 37.0 37.0 70-74 35.9233 37.0 37.0 37.0 37.0 37.0 75-79 35.93150000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.9566 37.0 37.0 37.0 37.0 37.0 85-89 35.8793 37.0 37.0 37.0 37.0 37.0 90-94 35.8249 37.0 37.0 37.0 37.0 37.0 95-99 35.9175 37.0 37.0 37.0 37.0 37.0 100-104 35.837599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.820100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7843 37.0 37.0 37.0 37.0 37.0 115-119 35.7747 37.0 37.0 37.0 37.0 37.0 120-124 35.79299999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.6887 37.0 37.0 37.0 37.0 37.0 130-134 35.63770000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.6771 37.0 37.0 37.0 37.0 37.0 140-144 35.519000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6075 37.0 37.0 37.0 37.0 37.0 150-151 35.207499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 4.0 16 1.0 17 1.0 18 2.0 19 1.0 20 0.0 21 5.0 22 5.0 23 6.0 24 5.0 25 4.0 26 11.0 27 10.0 28 13.0 29 23.0 30 20.0 31 35.0 32 42.0 33 79.0 34 178.0 35 506.0 36 2743.0 37 297.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.525 22.925 10.5 30.049999999999997 2 25.275 26.450000000000003 31.974999999999998 16.3 3 19.7 29.875 29.875 20.549999999999997 4 23.5 33.7 23.65 19.15 5 24.224999999999998 36.325 22.900000000000002 16.55 6 18.775 41.05 23.7 16.475 7 20.95 22.525000000000002 36.425000000000004 20.1 8 21.25 25.124999999999996 29.175 24.45 9 21.3 24.775 31.674999999999997 22.25 10-14 23.315 29.060000000000002 26.135 21.490000000000002 15-19 22.955000000000002 28.720000000000002 27.485 20.84 20-24 23.29 28.49 27.615000000000002 20.605 25-29 23.195 28.449999999999996 27.155 21.2 30-34 22.75 28.044999999999998 27.6 21.605 35-39 21.94 28.93 27.615000000000002 21.515 40-44 22.97 28.535 27.450000000000003 21.044999999999998 45-49 22.830000000000002 28.355000000000004 27.544999999999998 21.27 50-54 22.515 27.860000000000003 28.18 21.445 55-59 23.119999999999997 27.985 27.685 21.21 60-64 23.255 28.384999999999998 27.52 20.84 65-69 23.345 27.275 28.155 21.224999999999998 70-74 23.335 28.005000000000003 27.884999999999998 20.775 75-79 23.175 28.075 27.415 21.335 80-84 23.82 28.07 27.21 20.9 85-89 23.195 28.255000000000003 27.339999999999996 21.21 90-94 23.625 27.939999999999998 27.54 20.895 95-99 23.31 27.694999999999997 28.335 20.66 100-104 23.56 27.975 27.310000000000002 21.154999999999998 105-109 23.119999999999997 28.065 27.950000000000003 20.865000000000002 110-114 23.365 28.065 27.750000000000004 20.82 115-119 23.605 28.134999999999998 27.584999999999997 20.674999999999997 120-124 23.7 28.64 27.665 19.994999999999997 125-129 24.18 27.275 27.245 21.3 130-134 24.05 27.235 28.384999999999998 20.330000000000002 135-139 23.62 27.744999999999997 27.765 20.87 140-144 24.18 28.375 27.04 20.405 145-149 24.69 27.915 26.88 20.515 150-151 24.712500000000002 27.737499999999997 28.349999999999998 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 2.0 19 2.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 2.5 26 5.0 27 7.5 28 8.0 29 13.5 30 13.5 31 22.5 32 37.0 33 45.0 34 54.0 35 69.0 36 92.5 37 111.0 38 133.0 39 162.0 40 193.0 41 212.5 42 232.0 43 270.0 44 274.5 45 266.5 46 266.5 47 237.0 48 211.5 49 192.5 50 156.0 51 132.0 52 121.0 53 95.5 54 81.0 55 72.5 56 54.0 57 38.5 58 29.5 59 20.5 60 11.5 61 7.5 62 7.0 63 5.0 64 2.0 65 3.0 66 3.0 67 1.5 68 2.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.93403693931398 89.95 2 4.722955145118733 8.95 3 0.23746701846965698 0.675 4 0.07915567282321899 0.3 5 0.02638522427440633 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701372 spots for SRR12161428.sra Written 701372 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra Read 701364 spots for SRR12161428.sra Written 701364 spots for SRR12161428.sra SRR ids: ['SRR12161428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uuj5wcyd SRR12161428.sra spots: 14027288 blocks: [[1, 701364], [701365, 1402728], [1402729, 2104092], [2104093, 2805456], [2805457, 3506820], [3506821, 4208184], [4208185, 4909548], [4909549, 5610912], [5610913, 6312276], [6312277, 7013640], [7013641, 7715004], [7715005, 8416368], [8416369, 9117732], [9117733, 9819096], [9819097, 10520460], [10520461, 11221824], [11221825, 11923188], [11923189, 12624552], [12624553, 13325916], [13325917, 14027288]] SRR12161428 file size 4745385 SRR12161428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161428 SRR12161428_1.fastq SRR12161428_2.fastq Input file: SRR12161428_1.fastq Paired file: SRR12161428_2.fastq trimmed: SRR12161428-trimmed-pair1.fastq, SRR12161428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:28:14 2025 >> started Thu Feb 13 17:28:29 2025 >> done (14.437s) 14027288 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1073 ( 0.01%) empty read pairs filtered out after trimming by size control 14026195 (99.99%) read pairs available; of these: 626201 ( 4.46%) trimmed read pairs available after processing 13399994 (95.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 3 0.00% 29 5 0.00% 30 1 0.00% 31 4 0.00% 32 4 0.00% 33 8 0.00% 34 11 0.00% 35 9 0.00% 36 8 0.00% 37 11 0.00% 38 7 0.00% 39 9 0.00% 40 11 0.00% 41 7 0.00% 42 10 0.00% 43 10 0.00% 44 4 0.00% 45 14 0.00% 46 9 0.00% 47 10 0.00% 48 5 0.00% 49 8 0.00% 50 15 0.00% 51 15 0.00% 52 19 0.00% 53 16 0.00% 54 14 0.00% 55 23 0.00% 56 17 0.00% 57 15 0.00% 58 21 0.00% 59 23 0.00% 60 32 0.00% 61 37 0.00% 62 34 0.00% 63 51 0.00% 64 46 0.00% 65 57 0.00% 66 55 0.00% 67 74 0.00% 68 68 0.00% 69 94 0.00% 70 85 0.00% 71 97 0.00% 72 134 0.00% 73 146 0.00% 74 164 0.00% 75 178 0.00% 76 190 0.00% 77 198 0.00% 78 280 0.00% 79 285 0.00% 80 299 0.00% 81 341 0.00% 82 416 0.00% 83 451 0.00% 84 491 0.00% 85 571 0.00% 86 635 0.00% 87 651 0.00% 88 773 0.01% 89 901 0.01% 90 1039 0.01% 91 1080 0.01% 92 1229 0.01% 93 1360 0.01% 94 1446 0.01% 95 1653 0.01% 96 1841 0.01% 97 2054 0.01% 98 2161 0.02% 99 2303 0.02% 100 2439 0.02% 101 2715 0.02% 102 2907 0.02% 103 3087 0.02% 104 3460 0.02% 105 3777 0.03% 106 3929 0.03% 107 4088 0.03% 108 4333 0.03% 109 4864 0.03% 110 5072 0.04% 111 5189 0.04% 112 5772 0.04% 113 5977 0.04% 114 6499 0.05% 115 6762 0.05% 116 7219 0.05% 117 7555 0.05% 118 7882 0.06% 119 8203 0.06% 120 8540 0.06% 121 9169 0.07% 122 9399 0.07% 123 9945 0.07% 124 10169 0.07% 125 10745 0.08% 126 11273 0.08% 127 11687 0.08% 128 12436 0.09% 129 12599 0.09% 130 13313 0.09% 131 13915 0.10% 132 14281 0.10% 133 14636 0.10% 134 15032 0.11% 135 15738 0.11% 136 16373 0.12% 137 16713 0.12% 138 17539 0.13% 139 18318 0.13% 140 18854 0.13% 141 19215 0.14% 142 19674 0.14% 143 20108 0.14% 144 21016 0.15% 145 21472 0.15% 146 22279 0.16% 147 22842 0.16% 148 23582 0.17% 149 24164 0.17% 150 25081 0.18% 151 13399994 95.54% 14026195 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=13.95 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.87 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=88.51 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.4 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG SRR12161428 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:29:11 Started mapping on | Feb 13 17:29:11 Finished on | Feb 13 17:30:42 Mapping speed, Million of reads per hour | 554.88 Number of input reads | 14026195 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13342016 Uniquely mapped reads % | 95.12% Average mapped length | 299.15 Number of splices: Total | 13536138 Number of splices: Annotated (sjdb) | 13234246 Number of splices: GT/AG | 13278239 Number of splices: GC/AG | 211865 Number of splices: AT/AC | 9778 Number of splices: Non-canonical | 36256 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295625 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 70252 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388554 388554 388554 N_multimapping 295625 295625 295625 N_noFeature 464560 13189782 510307 N_ambiguous 191078 885 84046 UnstrandedReadsAssigned:12686378 PositiveStrandReadsAssigned:151349 NegativeStrandReadsAssigned:12747663 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161428-trimmed-pair1.fastq SRR12161428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,026,195 reads, 12,707,499 reads pseudoaligned [quant] estimated average fragment length: 280.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12161428.ke.tsv 34699 SRR12161428.se.tsv 87100 total ==> SRR12161428.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.71 289 11.2222 Potri.005G024800.1.v4.1 1035 755.715 177 15.8134 Potri.004G059700.1.v4.1 961 681.878 6 0.594091 Potri.007G009000.2.v4.1 1416 1136.71 0 0 Potri.003G141000.2.v4.1 2943 2663.71 623.936 15.8147 Potri.016G087400.1.v4.1 270 68.5081 709 698.736 Potri.015G069301.1.v4.1 564 298.996 0 0 Potri.010G195200.1.v4.1 1773 1493.71 7 0.316402 Potri.012G127500.1.v4.1 977 697.798 216 20.8994 ==> SRR12161428.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 285 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12161428 completed mapping pipeline successfully