Starting /dee2/code/volunteer_pipeline.sh SRR12161429 current disk space = 3088565821440 free memory = 1449842432 SRR12161429 SRAfilesize dbd5bef338788580568f50209c478059 SRR12161429.sra SRR12161429.sra file validated SRR12161429 is paired end SRR12161429 is conventional basespace SRR12161429 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5615 37.0 37.0 37.0 37.0 37.0 2 36.4275 37.0 37.0 37.0 37.0 37.0 3 36.451 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.5295 37.0 37.0 37.0 37.0 37.0 6 36.5265 37.0 37.0 37.0 37.0 37.0 7 36.429 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.476 37.0 37.0 37.0 37.0 37.0 10-14 36.5376 37.0 37.0 37.0 37.0 37.0 15-19 36.549 37.0 37.0 37.0 37.0 37.0 20-24 36.4469 37.0 37.0 37.0 37.0 37.0 25-29 36.455400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.41459999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4161 37.0 37.0 37.0 37.0 37.0 40-44 36.366200000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3358 37.0 37.0 37.0 37.0 37.0 50-54 36.2909 37.0 37.0 37.0 37.0 37.0 55-59 36.2907 37.0 37.0 37.0 37.0 37.0 60-64 36.26950000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.264799999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2687 37.0 37.0 37.0 37.0 37.0 75-79 36.240300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2551 37.0 37.0 37.0 37.0 37.0 85-89 36.2009 37.0 37.0 37.0 37.0 37.0 90-94 36.2331 37.0 37.0 37.0 37.0 37.0 95-99 36.2207 37.0 37.0 37.0 37.0 37.0 100-104 36.1403 37.0 37.0 37.0 37.0 37.0 105-109 36.1267 37.0 37.0 37.0 37.0 37.0 110-114 36.0718 37.0 37.0 37.0 37.0 37.0 115-119 36.1283 37.0 37.0 37.0 37.0 37.0 120-124 36.0945 37.0 37.0 37.0 37.0 37.0 125-129 36.063100000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.064800000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.9469 37.0 37.0 37.0 37.0 37.0 140-144 35.8849 37.0 37.0 37.0 37.0 37.0 145-149 35.81750000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.694 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 1.0 27 11.0 28 12.0 29 14.0 30 29.0 31 41.0 32 61.0 33 85.0 34 110.0 35 313.0 36 2910.0 37 408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 12.35 6.35 38.95 2 19.85 11.600000000000001 34.599999999999994 33.95 3 16.975 15.049999999999999 27.425 40.550000000000004 4 20.599999999999998 24.5 24.4 30.5 5 23.150000000000002 29.475 23.974999999999998 23.400000000000002 6 19.275000000000002 33.775 24.625 22.325 7 14.975 26.200000000000003 41.449999999999996 17.375 8 16.975 26.5 31.275 25.25 9 16.650000000000002 24.5 35.425000000000004 23.425 10-14 19.515 28.910000000000004 28.585 22.99 15-19 19.525000000000002 27.800000000000004 28.449999999999996 24.224999999999998 20-24 19.46 28.59 27.685 24.265 25-29 20.225 29.025000000000002 26.775 23.974999999999998 30-34 19.384999999999998 28.28 28.015 24.32 35-39 19.72 28.09 27.88 24.310000000000002 40-44 19.45 28.645 27.685 24.22 45-49 20.415 27.889999999999997 27.485 24.21 50-54 19.634999999999998 28.59 27.644999999999996 24.13 55-59 19.975 28.199999999999996 27.685 24.14 60-64 20.375 28.315 27.445000000000004 23.865 65-69 20.150000000000002 28.389999999999997 27.51 23.95 70-74 20.345 27.51 27.83 24.315 75-79 20.244999999999997 28.275 27.375 24.104999999999997 80-84 20.06 28.255000000000003 27.500000000000004 24.185000000000002 85-89 19.985 27.255000000000003 28.09 24.67 90-94 19.900000000000002 28.549999999999997 27.860000000000003 23.69 95-99 19.685 27.97 27.615000000000002 24.73 100-104 19.775000000000002 29.13 27.284999999999997 23.810000000000002 105-109 20.895 28.49 27.450000000000003 23.165 110-114 20.595 28.555000000000003 27.24 23.61 115-119 20.43 28.265 27.32 23.985 120-124 20.755000000000003 27.939999999999998 27.22 24.085 125-129 20.775 28.015 27.229999999999997 23.98 130-134 20.215 28.89 27.084999999999997 23.810000000000002 135-139 20.785 28.134999999999998 27.560000000000002 23.52 140-144 20.685000000000002 28.27 27.02 24.025 145-149 21.044999999999998 28.194999999999997 26.919999999999998 23.84 150-151 21.925 28.462500000000002 27.175 22.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.0 25 3.5 26 5.5 27 6.5 28 9.0 29 12.5 30 14.5 31 24.5 32 32.0 33 36.5 34 46.0 35 61.5 36 85.5 37 99.0 38 128.5 39 152.5 40 166.0 41 198.0 42 226.5 43 250.5 44 255.5 45 261.5 46 265.0 47 258.5 48 235.5 49 221.5 50 209.5 51 171.0 52 133.0 53 101.5 54 80.0 55 61.0 56 49.5 57 40.5 58 29.5 59 19.5 60 13.5 61 9.0 62 4.5 63 2.0 64 1.0 65 2.5 66 4.0 67 1.5 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.98296059637913 88.25 2 5.564430244941427 10.45 3 0.42598509052183176 1.2 4 0.026624068157614485 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.0625 0.0 0.0 0.025 0.0 92-93 0.1 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.15 0.0 0.0 0.025 0.0 98-99 0.1875 0.0 0.0 0.025 0.0 100-101 0.2375 0.0 0.0 0.025 0.0 102-103 0.3375 0.0 0.0 0.025 0.0 104-105 0.3625 0.0 0.0 0.025 0.0 106-107 0.4 0.0 0.0 0.025 0.0 108-109 0.44999999999999996 0.0 0.0 0.025 0.0 110-111 0.525 0.0 0.0 0.025 0.0 112-113 0.6125 0.0 0.0 0.025 0.0 114-115 0.8500000000000001 0.0 0.0 0.025 0.0 116-117 1.125 0.0 0.0 0.025 0.0 118-119 1.2999999999999998 0.0 0.0 0.025 0.0 120-121 1.4625 0.0 0.0 0.025 0.0 122-123 1.725 0.0 0.0 0.025 0.0 124-125 1.8375 0.0 0.0 0.025 0.0 126-127 1.95 0.0 0.0 0.025 0.0 128-129 2.2625 0.0 0.0 0.025 0.0 130-131 2.4875 0.0 0.0 0.025 0.0 132-133 2.7750000000000004 0.0 0.0 0.025 0.0 134-135 3.125 0.0 0.0 0.025 0.0 136-137 3.2750000000000004 0.0 0.0 0.025 0.0 138-139 3.6375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATCA 10 0.006830828 145.0 7 GACTATT 10 0.006830828 145.0 145 >>END_MODULE SRR12161429 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3345 37.0 37.0 37.0 37.0 37.0 2 35.9985 37.0 37.0 37.0 37.0 37.0 3 35.948 37.0 37.0 37.0 37.0 37.0 4 36.063 37.0 37.0 37.0 37.0 37.0 5 36.1405 37.0 37.0 37.0 37.0 37.0 6 36.1805 37.0 37.0 37.0 37.0 37.0 7 36.1015 37.0 37.0 37.0 37.0 37.0 8 36.145 37.0 37.0 37.0 37.0 37.0 9 36.1235 37.0 37.0 37.0 37.0 37.0 10-14 36.160000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1377 37.0 37.0 37.0 37.0 37.0 20-24 36.1186 37.0 37.0 37.0 37.0 37.0 25-29 36.0409 37.0 37.0 37.0 37.0 37.0 30-34 36.0659 37.0 37.0 37.0 37.0 37.0 35-39 36.0447 37.0 37.0 37.0 37.0 37.0 40-44 36.0349 37.0 37.0 37.0 37.0 37.0 45-49 35.9659 37.0 37.0 37.0 37.0 37.0 50-54 35.994899999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9857 37.0 37.0 37.0 37.0 37.0 60-64 35.92399999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.9452 37.0 37.0 37.0 37.0 37.0 70-74 35.787600000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.843900000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9474 37.0 37.0 37.0 37.0 37.0 85-89 35.809 37.0 37.0 37.0 37.0 37.0 90-94 35.8387 37.0 37.0 37.0 37.0 37.0 95-99 35.8001 37.0 37.0 37.0 37.0 37.0 100-104 35.85379999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.780899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.7751 37.0 37.0 37.0 37.0 37.0 115-119 35.7062 37.0 37.0 37.0 37.0 37.0 120-124 35.7442 37.0 37.0 37.0 37.0 37.0 125-129 35.56699999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5092 37.0 37.0 37.0 37.0 37.0 135-139 35.614200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.484899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4697 37.0 37.0 37.0 37.0 37.0 150-151 34.93175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 7.0 23 9.0 24 9.0 25 6.0 26 13.0 27 15.0 28 11.0 29 18.0 30 29.0 31 38.0 32 67.0 33 106.0 34 175.0 35 554.0 36 2679.0 37 250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.725 25.95 8.799999999999999 24.525 2 26.8 26.825 30.349999999999998 16.025 3 20.200000000000003 28.525 32.4 18.875 4 23.150000000000002 33.25 24.675 18.925 5 25.5 36.875 21.05 16.575 6 20.974999999999998 40.675 21.175 17.175 7 21.099999999999998 23.225 37.325 18.35 8 22.2 26.55 27.575 23.674999999999997 9 22.25 25.074999999999996 30.4 22.275 10-14 23.515 29.955 25.979999999999997 20.549999999999997 15-19 23.625 28.95 27.37 20.055 20-24 23.185 29.189999999999998 27.595 20.03 25-29 22.915 28.410000000000004 27.939999999999998 20.735 30-34 22.74 28.360000000000003 27.725 21.175 35-39 22.82 28.675 27.625 20.880000000000003 40-44 23.375 28.299999999999997 27.265 21.060000000000002 45-49 23.150000000000002 28.249999999999996 27.794999999999998 20.805 50-54 23.48 28.18 27.77 20.57 55-59 22.915 28.485 27.794999999999998 20.805 60-64 23.205000000000002 27.715 28.055000000000003 21.025 65-69 23.48 27.605 27.63 21.285 70-74 23.565 27.865000000000002 27.529999999999998 21.04 75-79 22.55 28.16 27.26 22.03 80-84 22.805 28.444999999999997 27.67 21.08 85-89 23.23 28.825 26.825 21.12 90-94 23.175 28.375 26.915 21.535 95-99 23.305 28.155 27.37 21.17 100-104 23.89 28.015 27.279999999999998 20.815 105-109 23.525 28.535 27.6 20.34 110-114 23.94 27.715 27.11 21.235 115-119 23.544999999999998 28.425 27.11 20.919999999999998 120-124 23.97 28.345 26.845000000000002 20.84 125-129 24.490000000000002 27.200000000000003 27.700000000000003 20.61 130-134 24.29 27.265 27.955000000000002 20.49 135-139 24.560000000000002 27.37 27.605 20.465 140-144 23.945 28.355000000000004 27.71 19.99 145-149 24.64 28.17 26.75 20.44 150-151 25.124999999999996 27.05 27.725 20.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.5 9 1.5 10 1.5 11 1.0 12 0.5 13 1.5 14 1.5 15 1.0 16 0.5 17 1.0 18 3.0 19 2.5 20 1.0 21 0.5 22 2.0 23 2.0 24 2.0 25 3.5 26 3.0 27 4.5 28 8.0 29 9.0 30 17.0 31 24.0 32 21.0 33 28.5 34 41.0 35 56.5 36 90.5 37 122.0 38 133.5 39 162.5 40 194.5 41 227.5 42 264.0 43 264.5 44 266.5 45 273.5 46 270.0 47 244.0 48 218.5 49 200.5 50 175.0 51 147.5 52 115.0 53 91.0 54 70.5 55 50.5 56 39.0 57 35.5 58 27.0 59 20.0 60 16.0 61 12.0 62 7.5 63 4.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15532425940752 88.2 2 5.15078729650387 9.65 3 0.5337603416066187 1.5 4 0.10675206832132372 0.4 5 0.05337603416066186 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.2875 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTATG 10 0.006830828 145.0 145 AAGACTC 10 0.006830828 145.0 5 AATGGCT 10 0.006830828 145.0 9 >>END_MODULE Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra Read 1028763 spots for SRR12161429.sra Written 1028763 spots for SRR12161429.sra Read 1028758 spots for SRR12161429.sra Written 1028758 spots for SRR12161429.sra SRR ids: ['SRR12161429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_47_jqytd SRR12161429.sra spots: 20575165 blocks: [[1, 1028758], [1028759, 2057516], [2057517, 3086274], [3086275, 4115032], [4115033, 5143790], [5143791, 6172548], [6172549, 7201306], [7201307, 8230064], [8230065, 9258822], [9258823, 10287580], [10287581, 11316338], [11316339, 12345096], [12345097, 13373854], [13373855, 14402612], [14402613, 15431370], [15431371, 16460128], [16460129, 17488886], [17488887, 18517644], [18517645, 19546402], [19546403, 20575165]] SRR12161429 file size 6970640 SRR12161429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161429 SRR12161429_1.fastq SRR12161429_2.fastq Input file: SRR12161429_1.fastq Paired file: SRR12161429_2.fastq trimmed: SRR12161429-trimmed-pair1.fastq, SRR12161429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:11:07 2025 >> started Thu Feb 13 22:11:40 2025 >> done (33.241s) 20575165 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 2060 ( 0.01%) empty read pairs filtered out after trimming by size control 20573075 (99.99%) read pairs available; of these: 1059786 ( 5.15%) trimmed read pairs available after processing 19513289 (94.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 4 0.00% 27 10 0.00% 28 8 0.00% 29 6 0.00% 30 13 0.00% 31 7 0.00% 32 3 0.00% 33 14 0.00% 34 11 0.00% 35 14 0.00% 36 6 0.00% 37 8 0.00% 38 23 0.00% 39 13 0.00% 40 11 0.00% 41 8 0.00% 42 9 0.00% 43 9 0.00% 44 10 0.00% 45 19 0.00% 46 21 0.00% 47 22 0.00% 48 27 0.00% 49 14 0.00% 50 14 0.00% 51 28 0.00% 52 35 0.00% 53 38 0.00% 54 29 0.00% 55 30 0.00% 56 38 0.00% 57 38 0.00% 58 47 0.00% 59 47 0.00% 60 64 0.00% 61 76 0.00% 62 76 0.00% 63 77 0.00% 64 82 0.00% 65 99 0.00% 66 95 0.00% 67 104 0.00% 68 124 0.00% 69 154 0.00% 70 182 0.00% 71 174 0.00% 72 212 0.00% 73 236 0.00% 74 293 0.00% 75 325 0.00% 76 356 0.00% 77 381 0.00% 78 434 0.00% 79 497 0.00% 80 531 0.00% 81 596 0.00% 82 756 0.00% 83 829 0.00% 84 983 0.00% 85 1033 0.01% 86 1129 0.01% 87 1241 0.01% 88 1423 0.01% 89 1527 0.01% 90 1695 0.01% 91 1934 0.01% 92 2046 0.01% 93 2502 0.01% 94 2612 0.01% 95 2931 0.01% 96 3191 0.02% 97 3478 0.02% 98 3711 0.02% 99 4032 0.02% 100 4439 0.02% 101 4871 0.02% 102 5263 0.03% 103 5763 0.03% 104 6329 0.03% 105 6532 0.03% 106 6983 0.03% 107 7287 0.04% 108 7792 0.04% 109 8387 0.04% 110 8732 0.04% 111 9367 0.05% 112 10243 0.05% 113 10764 0.05% 114 11355 0.06% 115 12429 0.06% 116 12629 0.06% 117 12992 0.06% 118 13886 0.07% 119 14336 0.07% 120 15113 0.07% 121 16021 0.08% 122 16434 0.08% 123 17508 0.09% 124 18281 0.09% 125 18647 0.09% 126 19630 0.10% 127 20324 0.10% 128 20927 0.10% 129 21698 0.11% 130 22380 0.11% 131 23136 0.11% 132 23975 0.12% 133 25122 0.12% 134 25785 0.13% 135 26780 0.13% 136 27347 0.13% 137 28263 0.14% 138 29149 0.14% 139 30024 0.15% 140 30291 0.15% 141 31722 0.15% 142 32618 0.16% 143 33091 0.16% 144 34800 0.17% 145 35447 0.17% 146 36613 0.18% 147 37615 0.18% 148 38931 0.19% 149 38882 0.19% 150 39968 0.19% 151 19513289 94.85% 20573075 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=15.94 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.3 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.95 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=26.01 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=5.3 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12161429 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:12:23 Started mapping on | Feb 13 22:12:23 Finished on | Feb 13 22:14:31 Mapping speed, Million of reads per hour | 578.62 Number of input reads | 20573075 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19332447 Uniquely mapped reads % | 93.97% Average mapped length | 298.74 Number of splices: Total | 20573242 Number of splices: Annotated (sjdb) | 20163614 Number of splices: GT/AG | 20182825 Number of splices: GC/AG | 319732 Number of splices: AT/AC | 12985 Number of splices: Non-canonical | 57700 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485172 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 163108 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 755456 755456 755456 N_multimapping 485172 485172 485172 N_noFeature 602304 19033956 669564 N_ambiguous 363004 1118 131204 UnstrandedReadsAssigned:18367139 PositiveStrandReadsAssigned:297373 NegativeStrandReadsAssigned:18531679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161429-trimmed-pair1.fastq SRR12161429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,573,075 reads, 18,578,959 reads pseudoaligned [quant] estimated average fragment length: 283.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR12161429.ke.tsv 34699 SRR12161429.se.tsv 87100 total ==> SRR12161429.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.42 732 17.1215 Potri.005G024800.1.v4.1 1035 752.42 479 25.8411 Potri.004G059700.1.v4.1 961 678.58 0 0 Potri.007G009000.2.v4.1 1416 1133.42 0 0 Potri.003G141000.2.v4.1 2943 2660.42 914.489 13.9529 Potri.016G087400.1.v4.1 270 71.4483 1016 577.213 Potri.015G069301.1.v4.1 564 298.03 0 0 Potri.010G195200.1.v4.1 1773 1490.42 172.802 4.70624 Potri.012G127500.1.v4.1 977 694.511 106 6.19529 ==> SRR12161429.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR12161429 completed mapping pipeline successfully