Starting /dee2/code/volunteer_pipeline.sh SRR12161430 current disk space = 3088584630272 free memory = 1468870884 SRR12161430 SRAfilesize a00d47cc9228b934cea9340761d50755 SRR12161430.sra SRR12161430.sra file validated SRR12161430 is paired end SRR12161430 is conventional basespace SRR12161430 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5465 37.0 37.0 37.0 37.0 37.0 2 36.431 37.0 37.0 37.0 37.0 37.0 3 36.4955 37.0 37.0 37.0 37.0 37.0 4 36.6295 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.693 37.0 37.0 37.0 37.0 37.0 7 36.548 37.0 37.0 37.0 37.0 37.0 8 36.4685 37.0 37.0 37.0 37.0 37.0 9 36.4925 37.0 37.0 37.0 37.0 37.0 10-14 36.562 37.0 37.0 37.0 37.0 37.0 15-19 36.5313 37.0 37.0 37.0 37.0 37.0 20-24 36.4908 37.0 37.0 37.0 37.0 37.0 25-29 36.4928 37.0 37.0 37.0 37.0 37.0 30-34 36.439499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4249 37.0 37.0 37.0 37.0 37.0 40-44 36.3927 37.0 37.0 37.0 37.0 37.0 45-49 36.4204 37.0 37.0 37.0 37.0 37.0 50-54 36.3601 37.0 37.0 37.0 37.0 37.0 55-59 36.336 37.0 37.0 37.0 37.0 37.0 60-64 36.3698 37.0 37.0 37.0 37.0 37.0 65-69 36.3286 37.0 37.0 37.0 37.0 37.0 70-74 36.32869999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.29750000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2875 37.0 37.0 37.0 37.0 37.0 85-89 36.302200000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2769 37.0 37.0 37.0 37.0 37.0 95-99 36.2427 37.0 37.0 37.0 37.0 37.0 100-104 36.1804 37.0 37.0 37.0 37.0 37.0 105-109 36.0685 37.0 37.0 37.0 37.0 37.0 110-114 36.176 37.0 37.0 37.0 37.0 37.0 115-119 36.1777 37.0 37.0 37.0 37.0 37.0 120-124 36.0724 37.0 37.0 37.0 37.0 37.0 125-129 36.119 37.0 37.0 37.0 37.0 37.0 130-134 36.087 37.0 37.0 37.0 37.0 37.0 135-139 36.0167 37.0 37.0 37.0 37.0 37.0 140-144 35.968900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.9123 37.0 37.0 37.0 37.0 37.0 150-151 35.783500000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 4.0 26 7.0 27 9.0 28 7.0 29 18.0 30 27.0 31 30.0 32 44.0 33 66.0 34 107.0 35 313.0 36 2964.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1695847923962 12.656328164082039 6.4282141070535275 41.74587293646824 2 18.475 12.625 36.95 31.95 3 16.2 15.675 29.075 39.050000000000004 4 20.8 23.799999999999997 24.125 31.275 5 23.25 30.175 24.875 21.7 6 20.775 32.775 24.0 22.45 7 15.5 28.175 39.975 16.35 8 17.45 24.85 32.95 24.75 9 17.075000000000003 24.4 35.125 23.400000000000002 10-14 19.365 30.605 27.175 22.855 15-19 19.43 27.965 27.83 24.775 20-24 19.79 29.2 27.375 23.635 25-29 19.43 28.43 27.915 24.224999999999998 30-34 19.78 28.475 27.67 24.075 35-39 19.685 28.439999999999998 27.445000000000004 24.43 40-44 19.830000000000002 28.78 27.500000000000004 23.89 45-49 19.74 28.475 27.544999999999998 24.240000000000002 50-54 19.865 28.65 27.625 23.86 55-59 20.044999999999998 28.804999999999996 27.61 23.54 60-64 19.945 28.37 27.125 24.560000000000002 65-69 19.33 28.435 28.185 24.05 70-74 20.04 28.199999999999996 27.79 23.97 75-79 19.785 28.535 27.57 24.11 80-84 20.14 28.485 27.839999999999996 23.535 85-89 19.945 28.115000000000002 27.515 24.425 90-94 19.965 28.15 27.915 23.97 95-99 20.22 27.77 27.685 24.325 100-104 19.8 27.925 28.28 23.995 105-109 20.32 27.875 27.375 24.43 110-114 20.465 27.485 27.855 24.195 115-119 20.1 27.900000000000002 27.83 24.169999999999998 120-124 20.205000000000002 28.625 27.279999999999998 23.89 125-129 20.794999999999998 27.815 27.765 23.625 130-134 20.22 28.32 27.145000000000003 24.315 135-139 20.74 27.750000000000004 27.810000000000002 23.7 140-144 20.365 28.18 27.339999999999996 24.115000000000002 145-149 21.01 28.199999999999996 27.295 23.494999999999997 150-151 20.5375 28.1125 26.937499999999996 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 2.0 24 2.5 25 2.0 26 4.5 27 6.5 28 11.0 29 15.0 30 15.0 31 25.5 32 33.5 33 33.0 34 53.5 35 73.0 36 82.5 37 106.0 38 127.5 39 147.5 40 184.5 41 216.0 42 242.0 43 252.5 44 256.5 45 278.5 46 268.5 47 244.0 48 228.0 49 205.0 50 189.0 51 154.5 52 117.0 53 99.5 54 77.5 55 56.5 56 49.0 57 43.0 58 30.5 59 21.0 60 14.5 61 10.0 62 6.5 63 5.0 64 2.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4664570230608 91.07499999999999 2 4.245283018867925 8.1 3 0.2882599580712788 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.25 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTAAT 10 0.006830828 145.0 5 CCGTTCT 10 0.006830828 145.0 1 CCTTCCT 10 0.006830828 145.0 7 CGTTCTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161430 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2475 37.0 37.0 37.0 37.0 37.0 2 35.987 37.0 37.0 37.0 37.0 37.0 3 35.8735 37.0 37.0 37.0 37.0 37.0 4 36.0395 37.0 37.0 37.0 37.0 37.0 5 36.115 37.0 37.0 37.0 37.0 37.0 6 36.182 37.0 37.0 37.0 37.0 37.0 7 36.0795 37.0 37.0 37.0 37.0 37.0 8 36.2845 37.0 37.0 37.0 37.0 37.0 9 36.223 37.0 37.0 37.0 37.0 37.0 10-14 36.2128 37.0 37.0 37.0 37.0 37.0 15-19 36.194900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0956 37.0 37.0 37.0 37.0 37.0 25-29 36.0833 37.0 37.0 37.0 37.0 37.0 30-34 36.0148 37.0 37.0 37.0 37.0 37.0 35-39 36.065 37.0 37.0 37.0 37.0 37.0 40-44 35.99249999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.971399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.040000000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.9309 37.0 37.0 37.0 37.0 37.0 60-64 35.892399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9174 37.0 37.0 37.0 37.0 37.0 70-74 35.8027 37.0 37.0 37.0 37.0 37.0 75-79 35.7911 37.0 37.0 37.0 37.0 37.0 80-84 35.9003 37.0 37.0 37.0 37.0 37.0 85-89 35.8147 37.0 37.0 37.0 37.0 37.0 90-94 35.7738 37.0 37.0 37.0 37.0 37.0 95-99 35.7787 37.0 37.0 37.0 37.0 37.0 100-104 35.740899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7827 37.0 37.0 37.0 37.0 37.0 110-114 35.681200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6497 37.0 37.0 37.0 37.0 37.0 120-124 35.665499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.576800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.467499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5779 37.0 37.0 37.0 37.0 37.0 140-144 35.465199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.5604 37.0 37.0 37.0 37.0 37.0 150-151 34.982749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 1.0 16 0.0 17 2.0 18 1.0 19 1.0 20 2.0 21 0.0 22 4.0 23 7.0 24 3.0 25 9.0 26 8.0 27 11.0 28 17.0 29 31.0 30 32.0 31 37.0 32 62.0 33 106.0 34 194.0 35 633.0 36 2619.0 37 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 25.575 8.9 26.450000000000003 2 27.425 27.250000000000004 30.2 15.125 3 19.925 27.525 32.574999999999996 19.975 4 22.325 34.875 24.099999999999998 18.7 5 23.05 36.9 22.75 17.299999999999997 6 19.8 39.4 23.575 17.224999999999998 7 19.900000000000002 22.900000000000002 37.724999999999994 19.475 8 21.224999999999998 25.825 28.9 24.05 9 22.95 24.375 29.799999999999997 22.875 10-14 23.325000000000003 29.99 25.81 20.875 15-19 22.27 28.694999999999997 27.750000000000004 21.285 20-24 22.770000000000003 28.115000000000002 27.71 21.404999999999998 25-29 22.264999999999997 28.110000000000003 28.144999999999996 21.48 30-34 22.325 28.265 27.810000000000002 21.6 35-39 22.455 27.77 28.345 21.43 40-44 22.89 27.87 28.125 21.115000000000002 45-49 22.66 28.34 27.92 21.08 50-54 23.080000000000002 28.065 28.21 20.645 55-59 23.189999999999998 28.335 27.115000000000002 21.36 60-64 23.09 28.199999999999996 27.37 21.34 65-69 23.32 27.889999999999997 28.165000000000003 20.625 70-74 23.82 27.57 27.71 20.9 75-79 23.48 28.050000000000004 27.395000000000003 21.075 80-84 23.06 27.905 27.66 21.375 85-89 23.244999999999997 27.99 27.589999999999996 21.175 90-94 23.150000000000002 27.62 27.93 21.3 95-99 23.51 27.639999999999997 27.68 21.17 100-104 23.24 28.275 27.325 21.16 105-109 23.595 27.089999999999996 28.21 21.105 110-114 23.294999999999998 27.98 28.249999999999996 20.474999999999998 115-119 24.015 27.82 27.794999999999998 20.369999999999997 120-124 23.375 28.1 27.565 20.96 125-129 23.294999999999998 28.565 26.995 21.145 130-134 24.02 27.975 27.474999999999998 20.53 135-139 23.494999999999997 28.08 27.465 20.96 140-144 23.715 28.46 26.865 20.96 145-149 24.505 27.605 26.889999999999997 21.0 150-151 24.0125 28.8875 27.0 20.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.5 25 5.0 26 5.0 27 6.0 28 8.5 29 10.5 30 17.5 31 23.5 32 32.0 33 44.0 34 47.0 35 60.5 36 83.0 37 100.5 38 134.0 39 171.5 40 196.5 41 218.0 42 250.0 43 264.5 44 253.5 45 265.0 46 286.5 47 262.5 48 232.0 49 199.5 50 158.0 51 139.0 52 112.5 53 86.0 54 75.0 55 62.5 56 45.0 57 37.5 58 28.0 59 18.5 60 17.5 61 13.0 62 7.0 63 2.0 64 1.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.65558754252812 91.375 2 4.056529704265898 7.75 3 0.26171159382360637 0.75 4 0.0 0.0 5 0.026171159382360636 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652033 spots for SRR12161430.sra Written 652033 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra Read 652026 spots for SRR12161430.sra Written 652026 spots for SRR12161430.sra SRR ids: ['SRR12161430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2o3ugwd0 SRR12161430.sra spots: 13040527 blocks: [[1, 652026], [652027, 1304052], [1304053, 1956078], [1956079, 2608104], [2608105, 3260130], [3260131, 3912156], [3912157, 4564182], [4564183, 5216208], [5216209, 5868234], [5868235, 6520260], [6520261, 7172286], [7172287, 7824312], [7824313, 8476338], [8476339, 9128364], [9128365, 9780390], [9780391, 10432416], [10432417, 11084442], [11084443, 11736468], [11736469, 12388494], [12388495, 13040527]] SRR12161430 file size 4410041 SRR12161430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161430 SRR12161430_1.fastq SRR12161430_2.fastq Input file: SRR12161430_1.fastq Paired file: SRR12161430_2.fastq trimmed: SRR12161430-trimmed-pair1.fastq, SRR12161430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:14:29 2025 >> started Thu Feb 13 22:14:43 2025 >> done (14.487s) 13040527 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 664 ( 0.01%) empty read pairs filtered out after trimming by size control 13039852 (99.99%) read pairs available; of these: 351899 ( 2.70%) trimmed read pairs available after processing 12687953 (97.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 5 0.00% 23 0 0.00% 24 1 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 4 0.00% 29 3 0.00% 30 2 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 9 0.00% 35 5 0.00% 36 8 0.00% 37 11 0.00% 38 5 0.00% 39 8 0.00% 40 11 0.00% 41 5 0.00% 42 12 0.00% 43 14 0.00% 44 11 0.00% 45 6 0.00% 46 7 0.00% 47 13 0.00% 48 9 0.00% 49 9 0.00% 50 7 0.00% 51 23 0.00% 52 15 0.00% 53 17 0.00% 54 17 0.00% 55 20 0.00% 56 16 0.00% 57 17 0.00% 58 19 0.00% 59 23 0.00% 60 21 0.00% 61 29 0.00% 62 28 0.00% 63 31 0.00% 64 28 0.00% 65 38 0.00% 66 41 0.00% 67 48 0.00% 68 54 0.00% 69 56 0.00% 70 62 0.00% 71 73 0.00% 72 75 0.00% 73 88 0.00% 74 81 0.00% 75 127 0.00% 76 130 0.00% 77 123 0.00% 78 148 0.00% 79 148 0.00% 80 161 0.00% 81 200 0.00% 82 241 0.00% 83 255 0.00% 84 260 0.00% 85 306 0.00% 86 375 0.00% 87 435 0.00% 88 432 0.00% 89 453 0.00% 90 522 0.00% 91 610 0.00% 92 610 0.00% 93 687 0.01% 94 879 0.01% 95 948 0.01% 96 980 0.01% 97 1052 0.01% 98 1173 0.01% 99 1259 0.01% 100 1325 0.01% 101 1401 0.01% 102 1637 0.01% 103 1670 0.01% 104 1839 0.01% 105 1999 0.02% 106 2189 0.02% 107 2192 0.02% 108 2332 0.02% 109 2596 0.02% 110 2652 0.02% 111 2851 0.02% 112 3075 0.02% 113 3200 0.02% 114 3418 0.03% 115 3594 0.03% 116 3845 0.03% 117 4063 0.03% 118 4485 0.03% 119 4359 0.03% 120 4715 0.04% 121 4877 0.04% 122 5020 0.04% 123 5342 0.04% 124 5640 0.04% 125 5842 0.04% 126 6216 0.05% 127 6450 0.05% 128 6780 0.05% 129 6895 0.05% 130 7283 0.06% 131 7497 0.06% 132 7836 0.06% 133 7990 0.06% 134 8483 0.07% 135 8756 0.07% 136 9182 0.07% 137 9431 0.07% 138 9930 0.08% 139 10464 0.08% 140 10540 0.08% 141 10859 0.08% 142 11355 0.09% 143 11666 0.09% 144 12225 0.09% 145 12296 0.09% 146 13075 0.10% 147 13615 0.10% 148 14016 0.11% 149 14238 0.11% 150 15032 0.12% 151 12687953 97.30% 13039852 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=65.02 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.19 sequence-density-rank=22 fanout-score=20.85 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=4.8 sequence=AATGGCAGCCTCAGT SRR12161430 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:15:27 Started mapping on | Feb 13 22:15:27 Finished on | Feb 13 22:16:56 Mapping speed, Million of reads per hour | 527.45 Number of input reads | 13039852 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12319874 Uniquely mapped reads % | 94.48% Average mapped length | 299.76 Number of splices: Total | 12554071 Number of splices: Annotated (sjdb) | 12270707 Number of splices: GT/AG | 12298963 Number of splices: GC/AG | 209408 Number of splices: AT/AC | 9472 Number of splices: Non-canonical | 36228 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290248 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 51516 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429730 429730 429730 N_multimapping 290248 290248 290248 N_noFeature 438492 12156252 479678 N_ambiguous 202979 740 80177 UnstrandedReadsAssigned:11678403 PositiveStrandReadsAssigned:162882 NegativeStrandReadsAssigned:11760019 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161430-trimmed-pair1.fastq SRR12161430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,039,852 reads, 11,721,996 reads pseudoaligned [quant] estimated average fragment length: 300.713 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR12161430.ke.tsv 34699 SRR12161430.se.tsv 87100 total ==> SRR12161430.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.29 436 17.5317 Potri.005G024800.1.v4.1 1035 735.287 184 17.2899 Potri.004G059700.1.v4.1 961 661.593 63 6.57934 Potri.007G009000.2.v4.1 1416 1116.29 0 0 Potri.003G141000.2.v4.1 2943 2643.29 506 13.2263 Potri.016G087400.1.v4.1 270 62.0019 660.558 736.103 Potri.015G069301.1.v4.1 564 283.375 0 0 Potri.010G195200.1.v4.1 1773 1473.29 8 0.375176 Potri.012G127500.1.v4.1 977 677.434 247 25.192 ==> SRR12161430.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 156 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12161430 completed mapping pipeline successfully