Starting /dee2/code/volunteer_pipeline.sh SRR12161431 current disk space = 3089323200512 free memory = 1580041472 SRR12161431 SRAfilesize 4656d4df6e4496ec664a5790bf4e34e5 SRR12161431.sra SRR12161431.sra file validated SRR12161431 is paired end SRR12161431 is conventional basespace SRR12161431 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4665 37.0 37.0 37.0 37.0 37.0 2 36.3785 37.0 37.0 37.0 37.0 37.0 3 36.4835 37.0 37.0 37.0 37.0 37.0 4 36.469 37.0 37.0 37.0 37.0 37.0 5 36.63 37.0 37.0 37.0 37.0 37.0 6 36.5355 37.0 37.0 37.0 37.0 37.0 7 36.48 37.0 37.0 37.0 37.0 37.0 8 36.5175 37.0 37.0 37.0 37.0 37.0 9 36.548 37.0 37.0 37.0 37.0 37.0 10-14 36.562599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4988 37.0 37.0 37.0 37.0 37.0 20-24 36.500699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.44840000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.42979999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.407399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4137 37.0 37.0 37.0 37.0 37.0 45-49 36.3888 37.0 37.0 37.0 37.0 37.0 50-54 36.3115 37.0 37.0 37.0 37.0 37.0 55-59 36.31270000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.268699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.292500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2293 37.0 37.0 37.0 37.0 37.0 75-79 36.258799999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.282399999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.22619999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.23180000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1393 37.0 37.0 37.0 37.0 37.0 100-104 36.148999999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1188 37.0 37.0 37.0 37.0 37.0 110-114 36.1004 37.0 37.0 37.0 37.0 37.0 115-119 36.0483 37.0 37.0 37.0 37.0 37.0 120-124 36.101299999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0515 37.0 37.0 37.0 37.0 37.0 130-134 35.968399999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0047 37.0 37.0 37.0 37.0 37.0 140-144 35.915 37.0 37.0 37.0 37.0 37.0 145-149 35.889599999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.74825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 1.0 24 3.0 25 4.0 26 8.0 27 5.0 28 9.0 29 19.0 30 19.0 31 32.0 32 54.0 33 74.0 34 138.0 35 298.0 36 2902.0 37 430.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.82491245622811 12.131065532766383 6.053026513256628 31.990995497748877 2 21.475 13.125 32.800000000000004 32.6 3 18.05 18.65 30.475 32.824999999999996 4 22.3 26.825 24.474999999999998 26.400000000000002 5 22.8 32.225 24.224999999999998 20.75 6 21.2 34.9 22.85 21.05 7 15.2 25.124999999999996 42.35 17.325 8 16.875 25.45 31.624999999999996 26.05 9 16.400000000000002 23.45 35.15 25.0 10-14 20.095 29.375 27.284999999999997 23.244999999999997 15-19 19.695 28.63 27.845 23.830000000000002 20-24 19.545 28.235 28.720000000000002 23.5 25-29 20.52 28.235 27.465 23.78 30-34 19.830000000000002 28.035 27.905 24.23 35-39 20.745 28.044999999999998 27.6 23.61 40-44 20.54 28.999999999999996 27.525 22.935 45-49 21.02 28.634999999999998 26.645000000000003 23.7 50-54 20.05 28.449999999999996 27.58 23.919999999999998 55-59 19.919999999999998 28.485 27.944999999999997 23.65 60-64 20.735 28.439999999999998 27.13 23.695 65-69 20.29 27.455000000000002 28.03 24.224999999999998 70-74 20.73 28.325 26.945000000000004 24.0 75-79 20.330000000000002 27.57 27.62 24.48 80-84 20.78 28.065 27.255000000000003 23.9 85-89 20.71 28.68 26.77 23.84 90-94 20.724999999999998 28.67 27.165 23.44 95-99 20.755000000000003 27.6 27.235 24.41 100-104 21.25 28.904999999999998 26.955000000000002 22.89 105-109 21.115000000000002 27.415 27.905 23.565 110-114 20.97 28.54 27.384999999999998 23.105 115-119 21.16 27.41 27.525 23.905 120-124 20.395 27.88 27.665 24.060000000000002 125-129 21.11 27.939999999999998 27.12 23.830000000000002 130-134 20.77 27.595 27.73 23.905 135-139 21.25 27.21 27.97 23.57 140-144 21.495 27.435 27.0 24.07 145-149 21.785 27.37 27.115000000000002 23.73 150-151 20.962500000000002 27.625 27.200000000000003 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 0.5 22 0.5 23 3.0 24 5.5 25 3.5 26 4.0 27 8.5 28 11.5 29 12.5 30 14.0 31 24.5 32 28.0 33 34.5 34 48.5 35 62.5 36 80.5 37 101.5 38 119.5 39 141.0 40 170.5 41 200.0 42 211.0 43 230.5 44 274.0 45 277.5 46 253.5 47 259.0 48 250.0 49 221.0 50 203.0 51 167.0 52 129.0 53 104.0 54 83.0 55 65.5 56 52.5 57 36.0 58 23.0 59 18.0 60 16.0 61 17.0 62 13.5 63 4.5 64 2.0 65 2.5 66 3.0 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.63466167424444 87.52499999999999 2 5.883926183471516 11.0 3 0.4279219042524739 1.2 4 0.0 0.0 5 0.02674511901577962 0.125 6 0.02674511901577962 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 6 0.15 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCCCT 10 0.006830828 145.0 9 >>END_MODULE SRR12161431 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 35.837 37.0 37.0 37.0 37.0 37.0 3 35.996 37.0 37.0 37.0 37.0 37.0 4 35.8515 37.0 37.0 37.0 37.0 37.0 5 36.0515 37.0 37.0 37.0 37.0 37.0 6 36.022 37.0 37.0 37.0 37.0 37.0 7 36.086 37.0 37.0 37.0 37.0 37.0 8 35.9965 37.0 37.0 37.0 37.0 37.0 9 36.056 37.0 37.0 37.0 37.0 37.0 10-14 36.025999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.06139999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.9736 37.0 37.0 37.0 37.0 37.0 25-29 35.927800000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9593 37.0 37.0 37.0 37.0 37.0 35-39 35.879 37.0 37.0 37.0 37.0 37.0 40-44 35.84009999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.9037 37.0 37.0 37.0 37.0 37.0 50-54 35.805699999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.7927 37.0 37.0 37.0 37.0 37.0 60-64 35.8131 37.0 37.0 37.0 37.0 37.0 65-69 35.7739 37.0 37.0 37.0 37.0 37.0 70-74 35.6764 37.0 37.0 37.0 37.0 37.0 75-79 35.673700000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.738 37.0 37.0 37.0 37.0 37.0 85-89 35.624 37.0 37.0 37.0 37.0 37.0 90-94 35.5702 37.0 37.0 37.0 37.0 37.0 95-99 35.6435 37.0 37.0 37.0 37.0 37.0 100-104 35.628 37.0 37.0 37.0 37.0 37.0 105-109 35.5521 37.0 37.0 37.0 37.0 37.0 110-114 35.557 37.0 37.0 37.0 37.0 37.0 115-119 35.4798 37.0 37.0 37.0 37.0 37.0 120-124 35.469500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.389700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.2495 37.0 37.0 37.0 32.2 37.0 135-139 35.327799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3434 37.0 37.0 37.0 34.6 37.0 145-149 35.331300000000006 37.0 37.0 37.0 34.6 37.0 150-151 34.81975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 4.0 15 3.0 16 4.0 17 5.0 18 3.0 19 2.0 20 1.0 21 5.0 22 1.0 23 10.0 24 10.0 25 11.0 26 8.0 27 15.0 28 24.0 29 27.0 30 28.0 31 52.0 32 79.0 33 117.0 34 194.0 35 500.0 36 2616.0 37 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.75 25.8 7.2749999999999995 19.175 2 30.525000000000002 25.424999999999997 26.924999999999997 17.125 3 22.6 26.8 33.074999999999996 17.525 4 25.224999999999998 33.875 22.15 18.75 5 25.324999999999996 37.525 20.275000000000002 16.875 6 23.400000000000002 38.2 20.525 17.875 7 21.4 23.724999999999998 36.95 17.925 8 23.05 25.974999999999998 24.95 26.025 9 21.025 23.849999999999998 29.225 25.900000000000002 10-14 24.22 28.375 26.150000000000002 21.255 15-19 23.76 28.275 27.084999999999997 20.880000000000003 20-24 23.474999999999998 27.994999999999997 27.13 21.4 25-29 23.26 28.735 27.395000000000003 20.61 30-34 23.69 27.685 27.305 21.32 35-39 22.945 27.82 27.400000000000002 21.834999999999997 40-44 23.075000000000003 28.000000000000004 27.389999999999997 21.535 45-49 23.044999999999998 28.22 27.325 21.41 50-54 23.66 27.66 27.6 21.08 55-59 23.405 27.655 27.565 21.375 60-64 23.665 27.515 27.474999999999998 21.345 65-69 22.915 27.529999999999998 27.6 21.955 70-74 23.32 27.560000000000002 27.465 21.654999999999998 75-79 23.265 27.74 26.88 22.115000000000002 80-84 23.36 28.275 27.1 21.265 85-89 23.44 27.815 26.995 21.75 90-94 23.425 27.845 27.35 21.38 95-99 24.055 28.46 26.290000000000003 21.195 100-104 23.875 28.199999999999996 27.295 20.630000000000003 105-109 23.615 28.194999999999997 27.279999999999998 20.91 110-114 23.549999999999997 28.360000000000003 27.474999999999998 20.615 115-119 23.585 27.839999999999996 27.395000000000003 21.18 120-124 24.240000000000002 27.6 27.485 20.674999999999997 125-129 24.055 27.62 27.015 21.310000000000002 130-134 24.240000000000002 28.075 26.75 20.935000000000002 135-139 24.05 28.33 26.590000000000003 21.029999999999998 140-144 24.315 28.08 27.015 20.59 145-149 24.83 28.065 26.384999999999998 20.72 150-151 25.1875 27.775 27.075 19.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 2.0 8 1.5 9 0.5 10 1.0 11 2.0 12 2.0 13 1.0 14 1.5 15 2.5 16 3.0 17 3.0 18 2.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.5 25 2.5 26 5.5 27 6.0 28 6.0 29 10.0 30 12.0 31 17.5 32 24.0 33 33.5 34 46.5 35 64.0 36 82.0 37 95.0 38 104.0 39 133.0 40 177.0 41 213.0 42 221.5 43 231.0 44 250.0 45 248.0 46 258.5 47 278.0 48 249.5 49 203.0 50 179.5 51 156.0 52 131.0 53 111.5 54 94.0 55 76.0 56 67.0 57 50.5 58 30.0 59 21.5 60 17.0 61 11.5 62 8.5 63 5.5 64 4.0 65 2.0 66 2.0 67 2.5 68 2.5 69 2.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 1.0 99 2.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67429340511441 87.0 2 5.5720053835800805 10.35 3 0.5114401076716016 1.425 4 0.18842530282637954 0.7000000000000001 5 0.026917900403768503 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026917900403768503 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.9625 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAATCT 10 0.006830828 145.0 6 >>END_MODULE Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911733 spots for SRR12161431.sra Written 911733 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra Read 911730 spots for SRR12161431.sra Written 911730 spots for SRR12161431.sra SRR ids: ['SRR12161431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s4dn44xj SRR12161431.sra spots: 18234603 blocks: [[1, 911730], [911731, 1823460], [1823461, 2735190], [2735191, 3646920], [3646921, 4558650], [4558651, 5470380], [5470381, 6382110], [6382111, 7293840], [7293841, 8205570], [8205571, 9117300], [9117301, 10029030], [10029031, 10940760], [10940761, 11852490], [11852491, 12764220], [12764221, 13675950], [13675951, 14587680], [14587681, 15499410], [15499411, 16411140], [16411141, 17322870], [17322871, 18234603]] SRR12161431 file size 6175215 SRR12161431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161431 SRR12161431_1.fastq SRR12161431_2.fastq Input file: SRR12161431_1.fastq Paired file: SRR12161431_2.fastq trimmed: SRR12161431-trimmed-pair1.fastq, SRR12161431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:12:57 2025 >> started Thu Feb 13 23:13:17 2025 >> done (19.665s) 18234603 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 3462 ( 0.02%) empty read pairs filtered out after trimming by size control 18231112 (99.98%) read pairs available; of these: 769408 ( 4.22%) trimmed read pairs available after processing 17461704 (95.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 9 0.00% 22 14 0.00% 23 9 0.00% 24 14 0.00% 25 17 0.00% 26 25 0.00% 27 15 0.00% 28 22 0.00% 29 20 0.00% 30 12 0.00% 31 19 0.00% 32 17 0.00% 33 17 0.00% 34 27 0.00% 35 14 0.00% 36 14 0.00% 37 17 0.00% 38 21 0.00% 39 14 0.00% 40 19 0.00% 41 15 0.00% 42 15 0.00% 43 29 0.00% 44 13 0.00% 45 22 0.00% 46 15 0.00% 47 24 0.00% 48 26 0.00% 49 22 0.00% 50 33 0.00% 51 37 0.00% 52 29 0.00% 53 24 0.00% 54 33 0.00% 55 41 0.00% 56 36 0.00% 57 54 0.00% 58 45 0.00% 59 48 0.00% 60 51 0.00% 61 66 0.00% 62 66 0.00% 63 92 0.00% 64 88 0.00% 65 79 0.00% 66 82 0.00% 67 137 0.00% 68 108 0.00% 69 126 0.00% 70 140 0.00% 71 153 0.00% 72 191 0.00% 73 206 0.00% 74 229 0.00% 75 264 0.00% 76 269 0.00% 77 336 0.00% 78 310 0.00% 79 371 0.00% 80 445 0.00% 81 578 0.00% 82 591 0.00% 83 645 0.00% 84 741 0.00% 85 766 0.00% 86 831 0.00% 87 889 0.00% 88 1003 0.01% 89 1120 0.01% 90 1334 0.01% 91 1437 0.01% 92 1580 0.01% 93 1790 0.01% 94 2036 0.01% 95 2147 0.01% 96 2285 0.01% 97 2365 0.01% 98 2580 0.01% 99 2667 0.01% 100 2983 0.02% 101 3374 0.02% 102 3775 0.02% 103 4033 0.02% 104 4293 0.02% 105 4535 0.02% 106 4789 0.03% 107 5103 0.03% 108 5076 0.03% 109 5686 0.03% 110 6042 0.03% 111 6433 0.04% 112 6900 0.04% 113 7522 0.04% 114 7763 0.04% 115 8372 0.05% 116 8786 0.05% 117 8913 0.05% 118 9056 0.05% 119 9601 0.05% 120 10127 0.06% 121 10706 0.06% 122 11429 0.06% 123 12135 0.07% 124 13079 0.07% 125 13406 0.07% 126 13867 0.08% 127 14257 0.08% 128 14546 0.08% 129 15217 0.08% 130 15781 0.09% 131 16313 0.09% 132 16999 0.09% 133 17771 0.10% 134 18987 0.10% 135 20046 0.11% 136 20400 0.11% 137 20348 0.11% 138 21445 0.12% 139 21627 0.12% 140 22099 0.12% 141 22706 0.12% 142 24091 0.13% 143 25123 0.14% 144 26705 0.15% 145 27777 0.15% 146 28335 0.16% 147 28849 0.16% 148 29678 0.16% 149 29559 0.16% 150 30860 0.17% 151 17461704 95.78% 18231112 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=1.05 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=10.11 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.4 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=16 prefix-density=1.24 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=11.81 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.9 sequence=CAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTCAC SRR12161431 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:14:11 Started mapping on | Feb 13 23:14:11 Finished on | Feb 13 23:16:26 Mapping speed, Million of reads per hour | 486.16 Number of input reads | 18231112 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16670569 Uniquely mapped reads % | 91.44% Average mapped length | 299.01 Number of splices: Total | 17557787 Number of splices: Annotated (sjdb) | 17217220 Number of splices: GT/AG | 17180988 Number of splices: GC/AG | 316511 Number of splices: AT/AC | 10981 Number of splices: Non-canonical | 49307 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427210 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 107609 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1133333 1133333 1133333 N_multimapping 427210 427210 427210 N_noFeature 525854 16450595 587584 N_ambiguous 267959 975 109145 UnstrandedReadsAssigned:15876756 PositiveStrandReadsAssigned:218999 NegativeStrandReadsAssigned:15973840 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161431-trimmed-pair1.fastq SRR12161431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,231,112 reads, 16,157,121 reads pseudoaligned [quant] estimated average fragment length: 281.78 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12161431.ke.tsv 34699 SRR12161431.se.tsv 87100 total ==> SRR12161431.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.22 373 11.188 Potri.005G024800.1.v4.1 1035 754.22 411 28.3951 Potri.004G059700.1.v4.1 961 680.445 13 0.995522 Potri.007G009000.2.v4.1 1416 1135.22 0 0 Potri.003G141000.2.v4.1 2943 2662.22 634.997 12.4288 Potri.016G087400.1.v4.1 270 68.8425 672.646 509.132 Potri.015G069301.1.v4.1 564 299.166 0 0 Potri.010G195200.1.v4.1 1773 1492.22 5 0.174597 Potri.012G127500.1.v4.1 977 696.353 203 15.1903 ==> SRR12161431.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 150 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 23 SRR12161431 completed mapping pipeline successfully