Starting /dee2/code/volunteer_pipeline.sh SRR12161432 current disk space = 3088665001984 free memory = 1449855988 SRR12161432 SRAfilesize df03a522149aeed4e764722a639378a1 SRR12161432.sra SRR12161432.sra file validated SRR12161432 is paired end SRR12161432 is conventional basespace SRR12161432 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55225 37.0 37.0 37.0 37.0 37.0 2 36.4715 37.0 37.0 37.0 37.0 37.0 3 36.5435 37.0 37.0 37.0 37.0 37.0 4 36.668 37.0 37.0 37.0 37.0 37.0 5 36.703 37.0 37.0 37.0 37.0 37.0 6 36.641 37.0 37.0 37.0 37.0 37.0 7 36.602 37.0 37.0 37.0 37.0 37.0 8 36.5185 37.0 37.0 37.0 37.0 37.0 9 36.568 37.0 37.0 37.0 37.0 37.0 10-14 36.6251 37.0 37.0 37.0 37.0 37.0 15-19 36.577600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.53170000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4805 37.0 37.0 37.0 37.0 37.0 30-34 36.471 37.0 37.0 37.0 37.0 37.0 35-39 36.4491 37.0 37.0 37.0 37.0 37.0 40-44 36.433499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.45119999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.408 37.0 37.0 37.0 37.0 37.0 55-59 36.392100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.352 37.0 37.0 37.0 37.0 37.0 65-69 36.3621 37.0 37.0 37.0 37.0 37.0 70-74 36.378299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3 37.0 37.0 37.0 37.0 37.0 80-84 36.3623 37.0 37.0 37.0 37.0 37.0 85-89 36.29729999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.3125 37.0 37.0 37.0 37.0 37.0 95-99 36.257 37.0 37.0 37.0 37.0 37.0 100-104 36.2072 37.0 37.0 37.0 37.0 37.0 105-109 36.1577 37.0 37.0 37.0 37.0 37.0 110-114 36.1477 37.0 37.0 37.0 37.0 37.0 115-119 36.1914 37.0 37.0 37.0 37.0 37.0 120-124 36.174899999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.1322 37.0 37.0 37.0 37.0 37.0 130-134 36.1101 37.0 37.0 37.0 37.0 37.0 135-139 36.0717 37.0 37.0 37.0 37.0 37.0 140-144 35.93730000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.98909999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.8655 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.0 27 4.0 28 12.0 29 17.0 30 19.0 31 28.0 32 49.0 33 69.0 34 120.0 35 272.0 36 2988.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.73568392098024 12.203050762690673 6.0765191297824455 38.98474618654664 2 19.0 12.6 35.225 33.175 3 17.525 15.425 28.549999999999997 38.5 4 19.6 25.474999999999998 24.224999999999998 30.7 5 23.575 31.4 23.45 21.575 6 20.349999999999998 33.95 23.5 22.2 7 16.025 26.35 39.800000000000004 17.825 8 17.974999999999998 25.900000000000002 31.55 24.575 9 16.475 25.275 35.3 22.95 10-14 20.09 29.59 27.189999999999998 23.13 15-19 20.195 28.12 27.37 24.315 20-24 19.759999999999998 28.105000000000004 28.23 23.905 25-29 19.955000000000002 28.189999999999998 27.650000000000002 24.205 30-34 19.685 28.384999999999998 27.544999999999998 24.385 35-39 19.575 29.54 27.025 23.86 40-44 20.18 28.09 27.68 24.05 45-49 20.895 28.52 27.08 23.505000000000003 50-54 20.630000000000003 27.72 27.675 23.974999999999998 55-59 20.14 27.800000000000004 27.63 24.43 60-64 20.09 28.48 27.18 24.25 65-69 20.09 28.595 27.195000000000004 24.12 70-74 20.515 28.005000000000003 27.255000000000003 24.224999999999998 75-79 20.54 27.42 27.615000000000002 24.425 80-84 20.474999999999998 27.815 27.875 23.835 85-89 20.330000000000002 27.935 27.694999999999997 24.04 90-94 20.544999999999998 27.495000000000005 27.74 24.22 95-99 20.44 27.505000000000003 27.935 24.12 100-104 20.995 28.54 27.195000000000004 23.27 105-109 20.555 28.084999999999997 27.54 23.82 110-114 20.65 27.565 27.765 24.02 115-119 21.37 28.360000000000003 26.805 23.465 120-124 20.875 27.875 27.650000000000002 23.599999999999998 125-129 21.029999999999998 28.565 26.88 23.525 130-134 20.925 27.365000000000002 27.805000000000003 23.905 135-139 21.085 27.49 27.534999999999997 23.89 140-144 21.17 28.04 27.08 23.71 145-149 20.745 27.76 27.175 24.32 150-151 21.7875 28.025 27.187499999999996 23.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 3.5 23 3.0 24 3.0 25 4.5 26 5.0 27 6.0 28 9.5 29 10.5 30 11.0 31 24.0 32 32.5 33 35.0 34 44.5 35 62.0 36 77.0 37 100.5 38 129.0 39 149.0 40 172.5 41 191.0 42 204.5 43 235.0 44 257.0 45 263.5 46 256.5 47 239.5 48 253.5 49 241.5 50 193.5 51 161.0 52 129.5 53 116.5 54 96.5 55 60.0 56 53.5 57 46.0 58 26.0 59 18.5 60 22.5 61 19.0 62 10.0 63 6.0 64 4.5 65 2.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.62955032119913 87.45 2 5.781584582441114 10.8 3 0.5085653104925054 1.425 4 0.05353319057815846 0.2 5 0.02676659528907923 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAAACATGGAGGAGGGGGTGGTGGTGGAGGAGAGGGTGGTGGCAGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.425 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGAT 10 0.006830828 145.0 2 >>END_MODULE SRR12161432 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4255 37.0 37.0 37.0 37.0 37.0 2 36.144 37.0 37.0 37.0 37.0 37.0 3 36.2645 37.0 37.0 37.0 37.0 37.0 4 36.1725 37.0 37.0 37.0 37.0 37.0 5 36.2465 37.0 37.0 37.0 37.0 37.0 6 36.2425 37.0 37.0 37.0 37.0 37.0 7 36.2285 37.0 37.0 37.0 37.0 37.0 8 36.2815 37.0 37.0 37.0 37.0 37.0 9 36.3215 37.0 37.0 37.0 37.0 37.0 10-14 36.339 37.0 37.0 37.0 37.0 37.0 15-19 36.3243 37.0 37.0 37.0 37.0 37.0 20-24 36.2998 37.0 37.0 37.0 37.0 37.0 25-29 36.23030000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.238099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2072 37.0 37.0 37.0 37.0 37.0 40-44 36.17380000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.178000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.172700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1327 37.0 37.0 37.0 37.0 37.0 60-64 36.1306 37.0 37.0 37.0 37.0 37.0 65-69 36.1026 37.0 37.0 37.0 37.0 37.0 70-74 36.018699999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9884 37.0 37.0 37.0 37.0 37.0 80-84 36.04209999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.0096 37.0 37.0 37.0 37.0 37.0 90-94 35.965599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9505 37.0 37.0 37.0 37.0 37.0 100-104 35.933299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0137 37.0 37.0 37.0 37.0 37.0 110-114 35.899699999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.887800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.8445 37.0 37.0 37.0 37.0 37.0 125-129 35.7946 37.0 37.0 37.0 37.0 37.0 130-134 35.647 37.0 37.0 37.0 37.0 37.0 135-139 35.7331 37.0 37.0 37.0 37.0 37.0 140-144 35.652699999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7167 37.0 37.0 37.0 37.0 37.0 150-151 35.144499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 0.0 16 2.0 17 1.0 18 0.0 19 0.0 20 3.0 21 1.0 22 3.0 23 5.0 24 7.0 25 5.0 26 5.0 27 6.0 28 11.0 29 18.0 30 18.0 31 37.0 32 61.0 33 64.0 34 192.0 35 508.0 36 2772.0 37 278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 24.875 8.85 24.9 2 28.449999999999996 27.05 27.85 16.650000000000002 3 20.225 29.575000000000003 30.525000000000002 19.675 4 23.674999999999997 34.975 23.25 18.099999999999998 5 24.75 37.025000000000006 19.55 18.675 6 21.15 38.95 22.2 17.7 7 19.825 23.125 36.725 20.325 8 20.95 26.6 27.625 24.825 9 22.475 24.5 29.725 23.3 10-14 23.895 29.485 25.650000000000002 20.97 15-19 23.115 28.444999999999997 26.950000000000003 21.490000000000002 20-24 22.71 28.765 26.815 21.709999999999997 25-29 22.735 28.849999999999998 26.93 21.485000000000003 30-34 22.62 28.165000000000003 27.889999999999997 21.325 35-39 22.56 28.110000000000003 27.295 22.035 40-44 23.07 28.455000000000002 27.255000000000003 21.22 45-49 22.869999999999997 28.139999999999997 27.565 21.425 50-54 22.994999999999997 27.975 27.675 21.355 55-59 23.330000000000002 27.785 26.895000000000003 21.990000000000002 60-64 23.175 27.655 27.015 22.155 65-69 23.235 27.450000000000003 27.029999999999998 22.285 70-74 23.14 27.644999999999996 27.35 21.865000000000002 75-79 22.895 27.775 27.63 21.7 80-84 22.96 27.900000000000002 27.075 22.065 85-89 23.56 27.725 27.095000000000002 21.62 90-94 22.84 28.345 27.435 21.38 95-99 23.09 28.065 27.29 21.555 100-104 23.22 27.689999999999998 27.405 21.685 105-109 23.615 27.105 27.384999999999998 21.895 110-114 23.325000000000003 28.1 27.275 21.3 115-119 23.62 27.485 27.37 21.525 120-124 23.95 28.405 27.529999999999998 20.115 125-129 24.315 27.875 26.905 20.905 130-134 24.15 28.155 26.979999999999997 20.715 135-139 23.965 27.935 27.415 20.685000000000002 140-144 24.495 27.13 27.275 21.099999999999998 145-149 23.655 27.725 27.63 20.990000000000002 150-151 23.849999999999998 28.9375 26.85 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.5 20 2.0 21 1.5 22 1.5 23 3.0 24 3.5 25 4.5 26 6.0 27 6.5 28 5.5 29 8.0 30 16.0 31 17.0 32 20.5 33 27.5 34 38.5 35 56.0 36 79.0 37 99.0 38 117.5 39 150.0 40 180.0 41 203.0 42 237.5 43 267.5 44 265.0 45 253.5 46 272.0 47 263.5 48 224.0 49 215.5 50 188.5 51 146.0 52 125.5 53 97.5 54 89.5 55 77.5 56 47.5 57 44.0 58 37.0 59 29.0 60 22.0 61 14.0 62 9.0 63 4.5 64 5.0 65 2.5 66 1.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58044587698093 87.1 2 5.640612409347301 10.5 3 0.6177813591189901 1.725 4 0.10744023636852001 0.4 5 0.026860059092130004 0.125 6 0.026860059092130004 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GCTTACCCTCCACCAGATGGAAACATTCTGACCAACATTGTAAATGCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016487 spots for SRR12161432.sra Written 1016487 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra Read 1016481 spots for SRR12161432.sra Written 1016481 spots for SRR12161432.sra SRR ids: ['SRR12161432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fotjhgc_ SRR12161432.sra spots: 20329626 blocks: [[1, 1016481], [1016482, 2032962], [2032963, 3049443], [3049444, 4065924], [4065925, 5082405], [5082406, 6098886], [6098887, 7115367], [7115368, 8131848], [8131849, 9148329], [9148330, 10164810], [10164811, 11181291], [11181292, 12197772], [12197773, 13214253], [13214254, 14230734], [14230735, 15247215], [15247216, 16263696], [16263697, 17280177], [17280178, 18296658], [18296659, 19313139], [19313140, 20329626]] SRR12161432 file size 6887195 SRR12161432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161432 SRR12161432_1.fastq SRR12161432_2.fastq Input file: SRR12161432_1.fastq Paired file: SRR12161432_2.fastq trimmed: SRR12161432-trimmed-pair1.fastq, SRR12161432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:24:16 2025 >> started Thu Feb 13 22:24:37 2025 >> done (21.457s) 20329626 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2119 ( 0.01%) empty read pairs filtered out after trimming by size control 20327490 (99.99%) read pairs available; of these: 720181 ( 3.54%) trimmed read pairs available after processing 19607309 (96.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 8 0.00% 27 11 0.00% 28 13 0.00% 29 13 0.00% 30 6 0.00% 31 10 0.00% 32 6 0.00% 33 9 0.00% 34 12 0.00% 35 9 0.00% 36 14 0.00% 37 7 0.00% 38 9 0.00% 39 11 0.00% 40 20 0.00% 41 15 0.00% 42 8 0.00% 43 10 0.00% 44 11 0.00% 45 16 0.00% 46 8 0.00% 47 23 0.00% 48 17 0.00% 49 18 0.00% 50 24 0.00% 51 21 0.00% 52 29 0.00% 53 26 0.00% 54 26 0.00% 55 33 0.00% 56 29 0.00% 57 43 0.00% 58 40 0.00% 59 33 0.00% 60 58 0.00% 61 55 0.00% 62 85 0.00% 63 70 0.00% 64 77 0.00% 65 91 0.00% 66 77 0.00% 67 78 0.00% 68 101 0.00% 69 113 0.00% 70 127 0.00% 71 149 0.00% 72 141 0.00% 73 192 0.00% 74 216 0.00% 75 228 0.00% 76 247 0.00% 77 277 0.00% 78 326 0.00% 79 339 0.00% 80 396 0.00% 81 496 0.00% 82 550 0.00% 83 560 0.00% 84 629 0.00% 85 757 0.00% 86 813 0.00% 87 885 0.00% 88 947 0.00% 89 1077 0.01% 90 1188 0.01% 91 1352 0.01% 92 1414 0.01% 93 1653 0.01% 94 1727 0.01% 95 2036 0.01% 96 2035 0.01% 97 2289 0.01% 98 2503 0.01% 99 2578 0.01% 100 2773 0.01% 101 3139 0.02% 102 3385 0.02% 103 3617 0.02% 104 3963 0.02% 105 4220 0.02% 106 4398 0.02% 107 4763 0.02% 108 5115 0.03% 109 5259 0.03% 110 5608 0.03% 111 6003 0.03% 112 6576 0.03% 113 6814 0.03% 114 7328 0.04% 115 7552 0.04% 116 8041 0.04% 117 8135 0.04% 118 8642 0.04% 119 9036 0.04% 120 9700 0.05% 121 10257 0.05% 122 10555 0.05% 123 11046 0.05% 124 11601 0.06% 125 12091 0.06% 126 12900 0.06% 127 13378 0.07% 128 13836 0.07% 129 14228 0.07% 130 14638 0.07% 131 15355 0.08% 132 16077 0.08% 133 16745 0.08% 134 17126 0.08% 135 17854 0.09% 136 19116 0.09% 137 19208 0.09% 138 19725 0.10% 139 20950 0.10% 140 21191 0.10% 141 22117 0.11% 142 22834 0.11% 143 23507 0.12% 144 24998 0.12% 145 25149 0.12% 146 26131 0.13% 147 27232 0.13% 148 28101 0.14% 149 28581 0.14% 150 30042 0.15% 151 19607309 96.46% 20327490 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.90 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.29 sequence-density-rank=16 fanout-score=7.91 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=3.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=21 prefix-density=1.06 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=101.75 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.6 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12161432 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:25:23 Started mapping on | Feb 13 22:25:23 Finished on | Feb 13 22:27:22 Mapping speed, Million of reads per hour | 614.95 Number of input reads | 20327490 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19287992 Uniquely mapped reads % | 94.89% Average mapped length | 299.51 Number of splices: Total | 20098044 Number of splices: Annotated (sjdb) | 19685592 Number of splices: GT/AG | 19705065 Number of splices: GC/AG | 330828 Number of splices: AT/AC | 14799 Number of splices: Non-canonical | 47352 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430747 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 108913 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 608751 608751 608751 N_multimapping 430747 430747 430747 N_noFeature 600528 19019527 671252 N_ambiguous 321028 1121 122592 UnstrandedReadsAssigned:18366436 PositiveStrandReadsAssigned:267344 NegativeStrandReadsAssigned:18494148 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161432-trimmed-pair1.fastq SRR12161432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,327,490 reads, 18,480,899 reads pseudoaligned [quant] estimated average fragment length: 283.185 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR12161432.ke.tsv 34699 SRR12161432.se.tsv 87100 total ==> SRR12161432.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.82 496 12.1968 Potri.005G024800.1.v4.1 1035 752.815 204 11.5667 Potri.004G059700.1.v4.1 961 678.992 77 4.84052 Potri.007G009000.2.v4.1 1416 1133.82 0 0 Potri.003G141000.2.v4.1 2943 2660.82 864 13.8601 Potri.016G087400.1.v4.1 270 64.9059 826 543.203 Potri.015G069301.1.v4.1 564 295.446 0 0 Potri.010G195200.1.v4.1 1773 1490.82 6 0.171788 Potri.012G127500.1.v4.1 977 694.929 109 6.69502 ==> SRR12161432.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 252 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR12161432 completed mapping pipeline successfully