Starting /dee2/code/volunteer_pipeline.sh SRR12161433 current disk space = 3089304682496 free memory = 1582306704 SRR12161433 SRAfilesize 8146a739b2a3e4c87b7e47e359b1b060 SRR12161433.sra SRR12161433.sra file validated SRR12161433 is paired end SRR12161433 is conventional basespace SRR12161433 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6315 37.0 37.0 37.0 37.0 37.0 2 36.3715 37.0 37.0 37.0 37.0 37.0 3 36.5015 37.0 37.0 37.0 37.0 37.0 4 36.5595 37.0 37.0 37.0 37.0 37.0 5 36.5865 37.0 37.0 37.0 37.0 37.0 6 36.539 37.0 37.0 37.0 37.0 37.0 7 36.526 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.488 37.0 37.0 37.0 37.0 37.0 10-14 36.5769 37.0 37.0 37.0 37.0 37.0 15-19 36.5277 37.0 37.0 37.0 37.0 37.0 20-24 36.494299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.431400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.401599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.425599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.388400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3601 37.0 37.0 37.0 37.0 37.0 50-54 36.3261 37.0 37.0 37.0 37.0 37.0 55-59 36.3192 37.0 37.0 37.0 37.0 37.0 60-64 36.3252 37.0 37.0 37.0 37.0 37.0 65-69 36.277100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2729 37.0 37.0 37.0 37.0 37.0 75-79 36.2693 37.0 37.0 37.0 37.0 37.0 80-84 36.2555 37.0 37.0 37.0 37.0 37.0 85-89 36.2036 37.0 37.0 37.0 37.0 37.0 90-94 36.2337 37.0 37.0 37.0 37.0 37.0 95-99 36.152699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0816 37.0 37.0 37.0 37.0 37.0 105-109 36.112100000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.117399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.055099999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.072 37.0 37.0 37.0 37.0 37.0 125-129 36.0823 37.0 37.0 37.0 37.0 37.0 130-134 36.037499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.9668 37.0 37.0 37.0 37.0 37.0 140-144 35.8969 37.0 37.0 37.0 37.0 37.0 145-149 35.9149 37.0 37.0 37.0 37.0 37.0 150-151 35.7495 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 2.0 25 4.0 26 5.0 27 8.0 28 12.0 29 20.0 30 32.0 31 46.0 32 38.0 33 74.0 34 104.0 35 263.0 36 2953.0 37 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.84892446223112 13.531765882941471 6.253126563281642 32.36618309154578 2 20.075000000000003 12.875 34.1 32.95 3 17.575 17.5 28.475 36.449999999999996 4 20.474999999999998 25.525 24.325 29.675 5 22.400000000000002 31.1 24.325 22.175 6 21.525 34.775 22.3 21.4 7 14.75 28.675 41.125 15.45 8 18.375 25.374999999999996 30.85 25.4 9 18.925 24.349999999999998 34.150000000000006 22.575 10-14 19.919999999999998 29.995 26.490000000000002 23.595 15-19 19.885 28.62 27.615000000000002 23.880000000000003 20-24 20.205000000000002 28.444999999999997 26.889999999999997 24.46 25-29 20.375 28.12 27.925 23.580000000000002 30-34 20.294999999999998 28.465 26.72 24.52 35-39 20.525 28.26 26.740000000000002 24.474999999999998 40-44 19.63 29.080000000000002 27.029999999999998 24.26 45-49 20.044999999999998 28.675 27.105 24.175 50-54 20.64 28.28 26.790000000000003 24.29 55-59 20.395 28.79 27.015 23.799999999999997 60-64 20.745 27.925 27.205000000000002 24.125 65-69 20.990000000000002 27.815 27.055 24.14 70-74 20.785 28.904999999999998 26.405 23.905 75-79 20.185 27.845 27.915 24.055 80-84 20.505000000000003 28.32 27.24 23.935000000000002 85-89 20.875 28.544999999999998 26.99 23.59 90-94 20.349999999999998 28.335 26.8 24.515 95-99 21.099999999999998 27.955000000000002 26.834999999999997 24.11 100-104 21.395 28.355000000000004 26.46 23.79 105-109 21.295 28.64 26.595000000000002 23.47 110-114 20.419999999999998 28.794999999999998 26.775 24.01 115-119 20.945 28.165000000000003 27.105 23.785 120-124 20.855 28.285 26.965 23.895 125-129 20.96 28.410000000000004 26.700000000000003 23.93 130-134 21.035 27.955000000000002 26.895000000000003 24.115000000000002 135-139 21.485000000000003 28.249999999999996 26.365 23.9 140-144 21.2 28.27 26.275 24.255 145-149 21.785 27.74 26.455000000000002 24.02 150-151 21.762500000000003 28.212500000000002 26.424999999999997 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 4.5 27 10.0 28 11.5 29 13.0 30 16.5 31 23.0 32 30.5 33 35.5 34 43.0 35 62.0 36 74.5 37 90.0 38 116.5 39 145.0 40 181.0 41 181.5 42 201.0 43 251.0 44 258.5 45 239.0 46 234.5 47 251.0 48 250.5 49 229.0 50 197.5 51 163.5 52 147.5 53 134.5 54 100.5 55 69.5 56 50.5 57 41.5 58 29.5 59 21.5 60 24.5 61 17.0 62 7.0 63 5.5 64 6.5 65 3.0 66 3.0 67 3.5 68 1.5 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.32981530343008 90.325 2 4.036939313984169 7.6499999999999995 3 0.5013192612137204 1.425 4 0.10554089709762532 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02638522427440633 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.5625 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCGT 10 0.006830828 145.0 4 AACTTGT 10 0.006830828 145.0 9 CAGGCAT 10 0.006830828 145.0 4 >>END_MODULE SRR12161433 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4235 37.0 37.0 37.0 37.0 37.0 2 36.0155 37.0 37.0 37.0 37.0 37.0 3 36.1125 37.0 37.0 37.0 37.0 37.0 4 36.1255 37.0 37.0 37.0 37.0 37.0 5 36.151 37.0 37.0 37.0 37.0 37.0 6 36.1905 37.0 37.0 37.0 37.0 37.0 7 36.1405 37.0 37.0 37.0 37.0 37.0 8 36.186 37.0 37.0 37.0 37.0 37.0 9 36.1595 37.0 37.0 37.0 37.0 37.0 10-14 36.2185 37.0 37.0 37.0 37.0 37.0 15-19 36.2327 37.0 37.0 37.0 37.0 37.0 20-24 36.14149999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.113200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.1299 37.0 37.0 37.0 37.0 37.0 35-39 36.0918 37.0 37.0 37.0 37.0 37.0 40-44 36.050200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0235 37.0 37.0 37.0 37.0 37.0 50-54 36.0687 37.0 37.0 37.0 37.0 37.0 55-59 36.007400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9379 37.0 37.0 37.0 37.0 37.0 65-69 35.894099999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8642 37.0 37.0 37.0 37.0 37.0 75-79 35.8458 37.0 37.0 37.0 37.0 37.0 80-84 35.90840000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8885 37.0 37.0 37.0 37.0 37.0 90-94 35.8295 37.0 37.0 37.0 37.0 37.0 95-99 35.8613 37.0 37.0 37.0 37.0 37.0 100-104 35.7976 37.0 37.0 37.0 37.0 37.0 105-109 35.81869999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.77 37.0 37.0 37.0 37.0 37.0 115-119 35.7461 37.0 37.0 37.0 37.0 37.0 120-124 35.74589999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.6375 37.0 37.0 37.0 37.0 37.0 130-134 35.6096 37.0 37.0 37.0 37.0 37.0 135-139 35.6282 37.0 37.0 37.0 37.0 37.0 140-144 35.553399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.581399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.1165 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 1.0 16 0.0 17 1.0 18 7.0 19 1.0 20 6.0 21 6.0 22 5.0 23 10.0 24 7.0 25 11.0 26 9.0 27 14.0 28 16.0 29 16.0 30 26.0 31 35.0 32 56.0 33 71.0 34 158.0 35 450.0 36 2761.0 37 326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.225 24.875 9.0 20.9 2 29.325000000000003 25.35 27.650000000000002 17.675 3 23.125 27.900000000000002 30.9 18.075 4 24.325 33.925 24.075 17.675 5 25.1 36.225 21.55 17.125 6 21.5 38.775 21.6 18.125 7 20.525 23.625 36.199999999999996 19.650000000000002 8 23.150000000000002 26.174999999999997 25.424999999999997 25.25 9 22.3 25.474999999999998 27.400000000000002 24.825 10-14 23.59 30.11 25.245 21.055 15-19 23.51 28.255000000000003 26.619999999999997 21.615000000000002 20-24 22.56 29.24 27.11 21.09 25-29 23.56 27.72 27.36 21.36 30-34 22.665 28.1 27.48 21.755 35-39 22.919999999999998 28.360000000000003 27.495000000000005 21.224999999999998 40-44 22.795 28.384999999999998 27.425 21.395 45-49 23.73 28.110000000000003 26.939999999999998 21.22 50-54 23.485 28.060000000000002 27.33 21.125 55-59 23.365 27.465 27.794999999999998 21.375 60-64 23.799999999999997 27.18 27.685 21.335 65-69 23.745 27.224999999999998 27.245 21.785 70-74 23.205000000000002 27.735 27.505000000000003 21.555 75-79 23.465 27.48 27.525 21.529999999999998 80-84 23.22 27.884999999999998 27.375 21.52 85-89 23.91 26.865 27.16 22.065 90-94 24.02 27.534999999999997 26.900000000000002 21.545 95-99 23.78 27.339999999999996 27.400000000000002 21.48 100-104 23.715 27.515 26.965 21.805 105-109 23.61 27.79 27.694999999999997 20.905 110-114 23.974999999999998 27.894999999999996 27.73 20.4 115-119 23.485 27.889999999999997 27.79 20.835 120-124 24.29 27.935 27.315 20.46 125-129 24.38 27.155 27.229999999999997 21.235 130-134 24.47 27.694999999999997 26.805 21.029999999999998 135-139 24.47 27.66 27.35 20.52 140-144 24.915000000000003 27.405 26.76 20.919999999999998 145-149 25.285000000000004 27.485 26.47 20.76 150-151 25.912499999999998 26.450000000000003 26.737499999999997 20.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 1.5 14 1.5 15 1.5 16 2.0 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 3.0 24 3.0 25 4.5 26 7.5 27 6.0 28 5.0 29 10.5 30 15.0 31 15.5 32 17.5 33 25.0 34 38.0 35 57.5 36 71.5 37 97.0 38 122.0 39 133.0 40 166.0 41 195.5 42 223.0 43 237.5 44 250.5 45 286.5 46 279.0 47 253.0 48 251.0 49 226.5 50 179.5 51 148.5 52 134.5 53 116.5 54 97.0 55 80.5 56 54.0 57 34.5 58 32.5 59 30.0 60 19.0 61 11.5 62 12.5 63 8.5 64 2.5 65 1.5 66 1.0 67 1.5 68 2.0 69 1.5 70 0.5 71 1.0 72 1.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.19788918205805 90.2 2 4.221635883905013 8.0 3 0.4221635883905013 1.2 4 0.15831134564643798 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 1.9875 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.5999999999999996 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.5625 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTCA 10 0.006830828 145.0 3 ACATTGA 10 0.006830828 145.0 4 GACATTG 10 0.006830828 145.0 3 >>END_MODULE Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501116 spots for SRR12161433.sra Written 1501116 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra Read 1501110 spots for SRR12161433.sra Written 1501110 spots for SRR12161433.sra SRR ids: ['SRR12161433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mzsbvtnn SRR12161433.sra spots: 30022206 blocks: [[1, 1501110], [1501111, 3002220], [3002221, 4503330], [4503331, 6004440], [6004441, 7505550], [7505551, 9006660], [9006661, 10507770], [10507771, 12008880], [12008881, 13509990], [13509991, 15011100], [15011101, 16512210], [16512211, 18013320], [18013321, 19514430], [19514431, 21015540], [21015541, 22516650], [22516651, 24017760], [24017761, 25518870], [25518871, 27019980], [27019981, 28521090], [28521091, 30022206]] SRR12161433 file size 10181158 SRR12161433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161433 SRR12161433_1.fastq SRR12161433_2.fastq Input file: SRR12161433_1.fastq Paired file: SRR12161433_2.fastq trimmed: SRR12161433-trimmed-pair1.fastq, SRR12161433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:28:58 2025 >> started Thu Feb 13 23:29:32 2025 >> done (33.600s) 30022206 read pairs processed; of these: 620 ( 0.00%) short read pairs filtered out after trimming by size control 62536 ( 0.21%) empty read pairs filtered out after trimming by size control 29959050 (99.79%) read pairs available; of these: 1833337 ( 6.12%) trimmed read pairs available after processing 28125713 (93.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 34 0.00% 19 190 0.00% 20 14 0.00% 21 23 0.00% 22 16 0.00% 23 23 0.00% 24 27 0.00% 25 29 0.00% 26 36 0.00% 27 32 0.00% 28 29 0.00% 29 27 0.00% 30 35 0.00% 31 32 0.00% 32 32 0.00% 33 35 0.00% 34 47 0.00% 35 41 0.00% 36 37 0.00% 37 28 0.00% 38 43 0.00% 39 44 0.00% 40 53 0.00% 41 59 0.00% 42 37 0.00% 43 40 0.00% 44 47 0.00% 45 42 0.00% 46 55 0.00% 47 51 0.00% 48 52 0.00% 49 75 0.00% 50 86 0.00% 51 84 0.00% 52 78 0.00% 53 90 0.00% 54 86 0.00% 55 102 0.00% 56 106 0.00% 57 99 0.00% 58 147 0.00% 59 141 0.00% 60 199 0.00% 61 171 0.00% 62 219 0.00% 63 212 0.00% 64 197 0.00% 65 220 0.00% 66 265 0.00% 67 297 0.00% 68 283 0.00% 69 361 0.00% 70 457 0.00% 71 485 0.00% 72 524 0.00% 73 594 0.00% 74 696 0.00% 75 726 0.00% 76 816 0.00% 77 920 0.00% 78 1007 0.00% 79 1183 0.00% 80 1275 0.00% 81 1441 0.00% 82 1686 0.01% 83 1965 0.01% 84 2087 0.01% 85 2258 0.01% 86 2514 0.01% 87 2737 0.01% 88 2935 0.01% 89 3173 0.01% 90 3538 0.01% 91 3938 0.01% 92 4514 0.02% 93 5015 0.02% 94 5381 0.02% 95 6027 0.02% 96 6353 0.02% 97 6711 0.02% 98 7305 0.02% 99 7672 0.03% 100 8537 0.03% 101 9037 0.03% 102 9964 0.03% 103 10838 0.04% 104 11461 0.04% 105 12229 0.04% 106 12743 0.04% 107 13614 0.05% 108 13985 0.05% 109 14916 0.05% 110 15468 0.05% 111 16556 0.06% 112 17736 0.06% 113 18576 0.06% 114 19857 0.07% 115 21095 0.07% 116 21939 0.07% 117 22855 0.08% 118 23584 0.08% 119 24208 0.08% 120 25249 0.08% 121 26539 0.09% 122 27746 0.09% 123 29439 0.10% 124 30996 0.10% 125 32145 0.11% 126 33511 0.11% 127 34379 0.11% 128 35711 0.12% 129 36692 0.12% 130 37664 0.13% 131 38363 0.13% 132 40683 0.14% 133 42555 0.14% 134 44280 0.15% 135 45719 0.15% 136 47159 0.16% 137 48614 0.16% 138 49563 0.17% 139 51033 0.17% 140 51620 0.17% 141 52744 0.18% 142 55033 0.18% 143 57028 0.19% 144 59301 0.20% 145 61627 0.21% 146 63220 0.21% 147 64006 0.21% 148 65513 0.22% 149 66442 0.22% 150 68824 0.23% 151 28125713 93.88% 29959050 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=19 prefix-density=1.27 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=46.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.98 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=24 prefix-density=1.98 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=20.05 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTACAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161433 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:30:17 Started mapping on | Feb 13 23:30:17 Finished on | Feb 13 23:33:31 Mapping speed, Million of reads per hour | 555.94 Number of input reads | 29959050 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27113951 Uniquely mapped reads % | 90.50% Average mapped length | 298.18 Number of splices: Total | 26742095 Number of splices: Annotated (sjdb) | 26248552 Number of splices: GT/AG | 26216332 Number of splices: GC/AG | 440958 Number of splices: AT/AC | 20426 Number of splices: Non-canonical | 64379 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 842979 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 405142 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2002120 2002120 2002120 N_multimapping 842979 842979 842979 N_noFeature 758569 26811082 846639 N_ambiguous 396362 1464 180684 UnstrandedReadsAssigned:25959020 PositiveStrandReadsAssigned:301405 NegativeStrandReadsAssigned:26086628 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161433-trimmed-pair1.fastq SRR12161433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,959,050 reads, 26,532,168 reads pseudoaligned [quant] estimated average fragment length: 270.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR12161433.ke.tsv 34699 SRR12161433.se.tsv 87100 total ==> SRR12161433.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.53 606 10.0993 Potri.005G024800.1.v4.1 1035 765.526 223 8.48861 Potri.004G059700.1.v4.1 961 691.67 162 6.82509 Potri.007G009000.2.v4.1 1416 1146.53 0 0 Potri.003G141000.2.v4.1 2943 2673.53 608.228 6.6294 Potri.016G087400.1.v4.1 270 75.1033 2019 783.375 Potri.015G069301.1.v4.1 564 309.508 0 0 Potri.010G195200.1.v4.1 1773 1503.53 5 0.0969061 Potri.012G127500.1.v4.1 977 707.582 4107 169.138 ==> SRR12161433.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 14 SRR12161433 completed mapping pipeline successfully