Starting /dee2/code/volunteer_pipeline.sh SRR12161434 current disk space = 3089267531776 free memory = 1449892156 SRR12161434 SRAfilesize a9bcb9d484e38d084d1bafaaaff92c47 SRR12161434.sra SRR12161434.sra file validated SRR12161434 is paired end SRR12161434 is conventional basespace SRR12161434 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5725 37.0 37.0 37.0 37.0 37.0 2 36.4905 37.0 37.0 37.0 37.0 37.0 3 36.5955 37.0 37.0 37.0 37.0 37.0 4 36.5785 37.0 37.0 37.0 37.0 37.0 5 36.619 37.0 37.0 37.0 37.0 37.0 6 36.6325 37.0 37.0 37.0 37.0 37.0 7 36.502 37.0 37.0 37.0 37.0 37.0 8 36.5485 37.0 37.0 37.0 37.0 37.0 9 36.507 37.0 37.0 37.0 37.0 37.0 10-14 36.5972 37.0 37.0 37.0 37.0 37.0 15-19 36.5413 37.0 37.0 37.0 37.0 37.0 20-24 36.5629 37.0 37.0 37.0 37.0 37.0 25-29 36.483999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.452 37.0 37.0 37.0 37.0 37.0 35-39 36.402699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.411899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3874 37.0 37.0 37.0 37.0 37.0 50-54 36.3354 37.0 37.0 37.0 37.0 37.0 55-59 36.3574 37.0 37.0 37.0 37.0 37.0 60-64 36.333099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3192 37.0 37.0 37.0 37.0 37.0 70-74 36.3649 37.0 37.0 37.0 37.0 37.0 75-79 36.2632 37.0 37.0 37.0 37.0 37.0 80-84 36.2966 37.0 37.0 37.0 37.0 37.0 85-89 36.249399999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.281 37.0 37.0 37.0 37.0 37.0 95-99 36.182300000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.173899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1747 37.0 37.0 37.0 37.0 37.0 110-114 36.1038 37.0 37.0 37.0 37.0 37.0 115-119 36.124900000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.1075 37.0 37.0 37.0 37.0 37.0 125-129 36.1028 37.0 37.0 37.0 37.0 37.0 130-134 36.04690000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9668 37.0 37.0 37.0 37.0 37.0 140-144 35.935700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.885000000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.829 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 3.0 22 2.0 23 0.0 24 0.0 25 5.0 26 8.0 27 6.0 28 8.0 29 13.0 30 22.0 31 30.0 32 61.0 33 64.0 34 119.0 35 296.0 36 2921.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.147573786893446 13.48174087043522 6.078039019509754 35.29264632316158 2 20.225 13.375 34.0 32.4 3 15.425 18.725 31.225 34.625 4 20.825 26.625 25.8 26.75 5 22.925 31.974999999999998 22.875 22.225 6 19.825 34.925 23.474999999999998 21.775 7 14.224999999999998 26.724999999999998 42.25 16.8 8 16.375 26.825 31.574999999999996 25.224999999999998 9 17.525 24.099999999999998 33.15 25.224999999999998 10-14 19.155 30.055 27.37 23.419999999999998 15-19 19.994999999999997 28.08 28.439999999999998 23.485 20-24 20.145 28.449999999999996 27.615000000000002 23.79 25-29 20.560000000000002 27.785 27.66 23.995 30-34 19.82 28.09 27.639999999999997 24.45 35-39 20.275000000000002 28.134999999999998 27.515 24.075 40-44 19.595000000000002 29.09 27.3 24.015 45-49 20.005 28.89 27.625 23.48 50-54 20.555 28.32 27.229999999999997 23.895 55-59 20.19 27.865000000000002 27.705000000000002 24.240000000000002 60-64 20.025000000000002 27.694999999999997 28.005000000000003 24.275 65-69 20.11 27.865000000000002 28.025 24.0 70-74 20.57 27.529999999999998 27.925 23.974999999999998 75-79 20.27 27.365000000000002 27.845 24.52 80-84 20.11 27.825 27.700000000000003 24.365000000000002 85-89 20.669999999999998 27.29 27.905 24.135 90-94 20.810000000000002 27.650000000000002 27.595 23.945 95-99 20.165 28.23 27.51 24.095 100-104 20.84 27.985 27.265 23.91 105-109 20.195 28.315 27.275 24.215 110-114 20.73 28.720000000000002 26.765 23.785 115-119 21.19 28.235 27.165 23.41 120-124 20.72 27.73 27.465 24.085 125-129 20.335 27.55 28.144999999999996 23.97 130-134 20.365 27.584999999999997 27.77 24.279999999999998 135-139 20.345 27.87 28.050000000000004 23.735 140-144 21.64 27.02 27.534999999999997 23.805 145-149 20.21 28.249999999999996 27.43 24.11 150-151 21.5625 27.525 26.9625 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 3.0 24 5.0 25 5.0 26 6.0 27 6.5 28 9.0 29 15.0 30 16.5 31 19.0 32 25.0 33 34.5 34 51.0 35 61.5 36 80.0 37 102.0 38 116.5 39 134.5 40 170.5 41 211.0 42 223.5 43 224.5 44 243.0 45 267.5 46 278.0 47 264.0 48 234.5 49 218.5 50 193.5 51 171.0 52 146.0 53 115.0 54 91.5 55 67.5 56 52.0 57 34.5 58 24.0 59 24.0 60 17.0 61 8.0 62 5.5 63 3.5 64 3.0 65 1.5 66 1.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05174713256869 88.14999999999999 2 5.361429714590558 10.05 3 0.4534542544678581 1.275 4 0.10669511869831955 0.4 5 0.026673779674579887 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5375 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.7000000000000002 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161434 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2525 37.0 37.0 37.0 37.0 37.0 2 36.057 37.0 37.0 37.0 37.0 37.0 3 36.036 37.0 37.0 37.0 37.0 37.0 4 36.093 37.0 37.0 37.0 37.0 37.0 5 36.168 37.0 37.0 37.0 37.0 37.0 6 36.1515 37.0 37.0 37.0 37.0 37.0 7 36.108 37.0 37.0 37.0 37.0 37.0 8 36.298 37.0 37.0 37.0 37.0 37.0 9 36.2245 37.0 37.0 37.0 37.0 37.0 10-14 36.228300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2356 37.0 37.0 37.0 37.0 37.0 20-24 36.2144 37.0 37.0 37.0 37.0 37.0 25-29 36.135000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1436 37.0 37.0 37.0 37.0 37.0 35-39 36.117599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.114999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.060199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1216 37.0 37.0 37.0 37.0 37.0 55-59 36.019099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.023999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.002700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.950399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.942400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.9423 37.0 37.0 37.0 37.0 37.0 85-89 35.9114 37.0 37.0 37.0 37.0 37.0 90-94 35.8558 37.0 37.0 37.0 37.0 37.0 95-99 35.904700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8519 37.0 37.0 37.0 37.0 37.0 105-109 35.8166 37.0 37.0 37.0 37.0 37.0 110-114 35.8047 37.0 37.0 37.0 37.0 37.0 115-119 35.802299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.799099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7274 37.0 37.0 37.0 37.0 37.0 130-134 35.5989 37.0 37.0 37.0 37.0 37.0 135-139 35.6597 37.0 37.0 37.0 37.0 37.0 140-144 35.60869999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.62670000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.21625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 3.0 16 5.0 17 0.0 18 2.0 19 1.0 20 1.0 21 2.0 22 4.0 23 3.0 24 7.0 25 8.0 26 6.0 27 12.0 28 13.0 29 15.0 30 20.0 31 34.0 32 55.0 33 101.0 34 185.0 35 497.0 36 2753.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.6 25.6 7.725 22.075 2 28.475 25.174999999999997 29.025000000000002 17.325 3 22.5 27.05 32.15 18.3 4 24.474999999999998 33.825 22.650000000000002 19.05 5 25.424999999999997 37.675 19.725 17.175 6 20.925 40.699999999999996 18.75 19.625 7 20.3 23.75 36.775000000000006 19.175 8 20.150000000000002 26.125 27.825 25.900000000000002 9 21.675 24.85 31.175000000000004 22.3 10-14 23.94 29.01 26.314999999999998 20.735 15-19 23.265 28.53 27.1 21.105 20-24 23.41 28.4 26.810000000000002 21.38 25-29 23.169999999999998 28.525 27.445000000000004 20.86 30-34 23.48 27.939999999999998 27.700000000000003 20.880000000000003 35-39 23.005 27.965 27.529999999999998 21.5 40-44 23.69 27.85 27.250000000000004 21.21 45-49 22.830000000000002 27.794999999999998 28.18 21.195 50-54 23.044999999999998 27.915 27.855 21.185000000000002 55-59 23.235 28.02 26.810000000000002 21.935 60-64 23.9 28.16 27.155 20.785 65-69 23.315 27.715 27.375 21.595 70-74 23.465 27.455000000000002 27.450000000000003 21.63 75-79 23.665 27.88 27.01 21.445 80-84 24.01 27.525 26.93 21.535 85-89 23.674999999999997 28.315 26.72 21.29 90-94 23.555 28.29 27.13 21.025 95-99 23.65 28.305000000000003 27.12 20.925 100-104 23.885 27.965 27.125 21.025 105-109 23.365 28.09 27.57 20.974999999999998 110-114 23.474999999999998 27.985 27.155 21.385 115-119 23.265 28.199999999999996 27.435 21.099999999999998 120-124 23.494999999999997 28.055000000000003 27.33 21.12 125-129 24.279999999999998 28.244999999999997 26.815 20.66 130-134 24.72 27.22 27.29 20.77 135-139 24.295 28.139999999999997 26.974999999999998 20.59 140-144 24.585 28.01 27.200000000000003 20.205000000000002 145-149 25.169999999999998 27.915 26.715 20.200000000000003 150-151 24.675 28.075 26.650000000000002 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 2.5 27 2.0 28 4.5 29 6.5 30 16.0 31 20.5 32 22.5 33 33.0 34 41.0 35 54.0 36 71.0 37 103.5 38 143.5 39 169.5 40 195.5 41 218.5 42 228.5 43 251.5 44 259.5 45 253.0 46 258.5 47 255.0 48 230.0 49 202.0 50 180.5 51 145.5 52 118.0 53 102.0 54 84.0 55 74.5 56 59.5 57 46.0 58 37.5 59 25.0 60 21.5 61 15.5 62 9.0 63 6.5 64 3.5 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.26207632772885 88.3 2 5.044035228182546 9.45 3 0.5337603416066187 1.5 4 0.08006405124099279 0.3 5 0.0 0.0 6 0.08006405124099279 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.5875 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6125 0.0 0.0 0.0 0.0 134-135 1.7999999999999998 0.0 0.0 0.0 0.0 136-137 2.1 0.0 0.0 0.0 0.0 138-139 2.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACTC 10 0.006830828 145.0 3 >>END_MODULE Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882313 spots for SRR12161434.sra Written 882313 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra Read 882306 spots for SRR12161434.sra Written 882306 spots for SRR12161434.sra SRR ids: ['SRR12161434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ons9kj9 SRR12161434.sra spots: 17646127 blocks: [[1, 882306], [882307, 1764612], [1764613, 2646918], [2646919, 3529224], [3529225, 4411530], [4411531, 5293836], [5293837, 6176142], [6176143, 7058448], [7058449, 7940754], [7940755, 8823060], [8823061, 9705366], [9705367, 10587672], [10587673, 11469978], [11469979, 12352284], [12352285, 13234590], [13234591, 14116896], [14116897, 14999202], [14999203, 15881508], [15881509, 16763814], [16763815, 17646127]] SRR12161434 file size 5975225 SRR12161434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161434 SRR12161434_1.fastq SRR12161434_2.fastq Input file: SRR12161434_1.fastq Paired file: SRR12161434_2.fastq trimmed: SRR12161434-trimmed-pair1.fastq, SRR12161434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:40:19 2025 >> started Thu Feb 13 22:40:47 2025 >> done (27.626s) 17646127 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 3131 ( 0.02%) empty read pairs filtered out after trimming by size control 17642971 (99.98%) read pairs available; of these: 783529 ( 4.44%) trimmed read pairs available after processing 16859442 (95.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 12 0.00% 21 4 0.00% 22 8 0.00% 23 7 0.00% 24 14 0.00% 25 11 0.00% 26 8 0.00% 27 13 0.00% 28 16 0.00% 29 10 0.00% 30 19 0.00% 31 16 0.00% 32 16 0.00% 33 11 0.00% 34 17 0.00% 35 14 0.00% 36 14 0.00% 37 21 0.00% 38 11 0.00% 39 14 0.00% 40 6 0.00% 41 19 0.00% 42 13 0.00% 43 10 0.00% 44 18 0.00% 45 16 0.00% 46 28 0.00% 47 17 0.00% 48 28 0.00% 49 18 0.00% 50 26 0.00% 51 28 0.00% 52 28 0.00% 53 28 0.00% 54 37 0.00% 55 29 0.00% 56 44 0.00% 57 43 0.00% 58 43 0.00% 59 52 0.00% 60 63 0.00% 61 67 0.00% 62 73 0.00% 63 81 0.00% 64 93 0.00% 65 95 0.00% 66 104 0.00% 67 122 0.00% 68 109 0.00% 69 163 0.00% 70 157 0.00% 71 177 0.00% 72 210 0.00% 73 233 0.00% 74 230 0.00% 75 286 0.00% 76 297 0.00% 77 344 0.00% 78 393 0.00% 79 457 0.00% 80 462 0.00% 81 574 0.00% 82 642 0.00% 83 732 0.00% 84 868 0.00% 85 852 0.00% 86 933 0.01% 87 1062 0.01% 88 1099 0.01% 89 1382 0.01% 90 1417 0.01% 91 1657 0.01% 92 1791 0.01% 93 2127 0.01% 94 2188 0.01% 95 2335 0.01% 96 2457 0.01% 97 2728 0.02% 98 2788 0.02% 99 3002 0.02% 100 3375 0.02% 101 3406 0.02% 102 3974 0.02% 103 4321 0.02% 104 4581 0.03% 105 4967 0.03% 106 5144 0.03% 107 5209 0.03% 108 5548 0.03% 109 5883 0.03% 110 6091 0.03% 111 6708 0.04% 112 7247 0.04% 113 7569 0.04% 114 8231 0.05% 115 8454 0.05% 116 8692 0.05% 117 9262 0.05% 118 9532 0.05% 119 9713 0.06% 120 10346 0.06% 121 10911 0.06% 122 11648 0.07% 123 12191 0.07% 124 12964 0.07% 125 13319 0.08% 126 13917 0.08% 127 14248 0.08% 128 14799 0.08% 129 15410 0.09% 130 15855 0.09% 131 16136 0.09% 132 17449 0.10% 133 18096 0.10% 134 19090 0.11% 135 19888 0.11% 136 20547 0.12% 137 20695 0.12% 138 21338 0.12% 139 22042 0.12% 140 22334 0.13% 141 23161 0.13% 142 24291 0.14% 143 25198 0.14% 144 26925 0.15% 145 28086 0.16% 146 28760 0.16% 147 29102 0.16% 148 29813 0.17% 149 29991 0.17% 150 31428 0.18% 151 16859442 95.56% 17642971 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=17 prefix-density=1.20 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=50.42 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.0 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACGCTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGC criterion=sequence-density sequence-density=1.63 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.62 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=108.39 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR12161434 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:41:36 Started mapping on | Feb 13 22:41:37 Finished on | Feb 13 22:44:04 Mapping speed, Million of reads per hour | 432.07 Number of input reads | 17642971 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16109478 Uniquely mapped reads % | 91.31% Average mapped length | 298.97 Number of splices: Total | 17319897 Number of splices: Annotated (sjdb) | 17022341 Number of splices: GT/AG | 16951756 Number of splices: GC/AG | 316843 Number of splices: AT/AC | 9897 Number of splices: Non-canonical | 41401 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422055 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 145865 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.19% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1111438 1111438 1111438 N_multimapping 422055 422055 422055 N_noFeature 415245 15881048 465069 N_ambiguous 292563 921 113410 UnstrandedReadsAssigned:15401670 PositiveStrandReadsAssigned:227509 NegativeStrandReadsAssigned:15530999 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161434-trimmed-pair1.fastq SRR12161434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,642,971 reads, 15,654,659 reads pseudoaligned [quant] estimated average fragment length: 275.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR12161434.ke.tsv 34699 SRR12161434.se.tsv 87100 total ==> SRR12161434.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.79 464 13.0971 Potri.005G024800.1.v4.1 1035 760.792 392 25.3614 Potri.004G059700.1.v4.1 961 687.046 37 2.65075 Potri.007G009000.2.v4.1 1416 1141.79 0 0 Potri.003G141000.2.v4.1 2943 2668.79 717 13.2238 Potri.016G087400.1.v4.1 270 68.5979 679.58 487.621 Potri.015G069301.1.v4.1 564 303.549 0 0 Potri.010G195200.1.v4.1 1773 1498.79 3 0.0985219 Potri.012G127500.1.v4.1 977 702.918 324 22.6878 ==> SRR12161434.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 348 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 32 SRR12161434 completed mapping pipeline successfully