Starting /dee2/code/volunteer_pipeline.sh SRR12161435 current disk space = 3088862019584 free memory = 1474084232 SRR12161435 SRAfilesize 25d2b3ea4dcb6bfcb5f766180a042d76 SRR12161435.sra SRR12161435.sra file validated SRR12161435 is paired end SRR12161435 is conventional basespace SRR12161435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5665 37.0 37.0 37.0 37.0 37.0 2 36.3035 37.0 37.0 37.0 37.0 37.0 3 36.501 37.0 37.0 37.0 37.0 37.0 4 36.487 37.0 37.0 37.0 37.0 37.0 5 36.4595 37.0 37.0 37.0 37.0 37.0 6 36.5665 37.0 37.0 37.0 37.0 37.0 7 36.433 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.478 37.0 37.0 37.0 37.0 37.0 10-14 36.5498 37.0 37.0 37.0 37.0 37.0 15-19 36.5253 37.0 37.0 37.0 37.0 37.0 20-24 36.4959 37.0 37.0 37.0 37.0 37.0 25-29 36.4331 37.0 37.0 37.0 37.0 37.0 30-34 36.4561 37.0 37.0 37.0 37.0 37.0 35-39 36.4127 37.0 37.0 37.0 37.0 37.0 40-44 36.405 37.0 37.0 37.0 37.0 37.0 45-49 36.330600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.347 37.0 37.0 37.0 37.0 37.0 55-59 36.361000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3224 37.0 37.0 37.0 37.0 37.0 65-69 36.26 37.0 37.0 37.0 37.0 37.0 70-74 36.290299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2261 37.0 37.0 37.0 37.0 37.0 80-84 36.2673 37.0 37.0 37.0 37.0 37.0 85-89 36.2573 37.0 37.0 37.0 37.0 37.0 90-94 36.260200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.149 37.0 37.0 37.0 37.0 37.0 100-104 36.1941 37.0 37.0 37.0 37.0 37.0 105-109 36.1722 37.0 37.0 37.0 37.0 37.0 110-114 36.1708 37.0 37.0 37.0 37.0 37.0 115-119 36.0804 37.0 37.0 37.0 37.0 37.0 120-124 36.0498 37.0 37.0 37.0 37.0 37.0 125-129 36.0038 37.0 37.0 37.0 37.0 37.0 130-134 36.0498 37.0 37.0 37.0 37.0 37.0 135-139 35.951100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9232 37.0 37.0 37.0 37.0 37.0 145-149 35.843199999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.64575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 2.0 26 5.0 27 4.0 28 12.0 29 20.0 30 26.0 31 42.0 32 52.0 33 79.0 34 127.0 35 304.0 36 2899.0 37 424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.87143571785893 13.581790895447723 6.103051525762881 37.44372186093047 2 20.625 12.75 34.275 32.35 3 17.075000000000003 15.9 27.450000000000003 39.574999999999996 4 21.224999999999998 23.5 24.875 30.4 5 23.7 28.225 24.9 23.175 6 21.625 33.550000000000004 23.05 21.775 7 15.975 27.575 38.675 17.775 8 17.95 26.75 33.175 22.125 9 16.7 24.625 35.525 23.150000000000002 10-14 20.01 29.79 27.33 22.869999999999997 15-19 19.8 28.33 28.005000000000003 23.865 20-24 19.975 29.13 27.21 23.685000000000002 25-29 20.405 28.17 27.82 23.605 30-34 19.68 28.494999999999997 27.71 24.115000000000002 35-39 20.1 27.72 27.96 24.22 40-44 19.695 28.765 27.650000000000002 23.89 45-49 20.19 27.85 27.735 24.224999999999998 50-54 20.13 28.17 27.77 23.93 55-59 20.84 27.985 27.85 23.325000000000003 60-64 20.51 27.925 27.51 24.055 65-69 20.445 28.21 27.67 23.674999999999997 70-74 20.555 28.21 27.310000000000002 23.925 75-79 19.470000000000002 28.815 26.93 24.785 80-84 20.57 28.055000000000003 27.48 23.895 85-89 19.91 28.175 27.889999999999997 24.025 90-94 20.849999999999998 28.265 27.095000000000002 23.79 95-99 20.735 27.925 27.700000000000003 23.64 100-104 20.575 28.12 27.650000000000002 23.655 105-109 20.535 27.805000000000003 27.63 24.03 110-114 20.61 28.405 27.189999999999998 23.794999999999998 115-119 21.15 28.035 27.095000000000002 23.72 120-124 21.08 27.705000000000002 27.375 23.84 125-129 20.755000000000003 27.815 27.705000000000002 23.724999999999998 130-134 21.375 27.99 27.055 23.580000000000002 135-139 21.2 27.785 27.295 23.72 140-144 21.185000000000002 28.235 27.29 23.29 145-149 21.45 28.26 27.200000000000003 23.09 150-151 20.8 27.6 27.487499999999997 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 2.5 25 3.0 26 4.5 27 9.0 28 10.0 29 9.0 30 18.5 31 27.0 32 30.5 33 42.0 34 49.5 35 58.5 36 79.5 37 98.0 38 121.0 39 157.0 40 180.5 41 201.0 42 225.5 43 229.5 44 253.0 45 284.0 46 274.0 47 241.5 48 221.0 49 227.5 50 205.5 51 156.0 52 129.5 53 108.5 54 75.5 55 57.5 56 55.5 57 41.5 58 30.5 59 27.0 60 15.5 61 9.0 62 8.5 63 4.5 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.5 72 2.0 73 2.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.73962463653184 89.60000000000001 2 4.9167327517842985 9.3 3 0.2907745175786413 0.8250000000000001 4 0.0 0.0 5 0.026434047052603753 0.125 6 0.026434047052603753 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 6 0.15 No Hit AGCCGCAGCTCCGAAATTGTACAAAGTAGAGTAGTACTTGAGCCCAAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2125000000000004 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTTCA 10 0.006830828 145.0 4 TTCAACG 10 0.006830828 145.0 7 CCGTTTC 10 0.006830828 145.0 3 TTTCAAC 10 0.006830828 145.0 6 GTTTCAA 10 0.006830828 145.0 5 TCAACGC 10 0.006830828 145.0 8 TCCGTTT 10 0.006830828 145.0 2 GGGGTAG 10 0.006830828 145.0 145 CAACGCT 10 0.006830828 145.0 9 AAAAAAA 40 0.0076550315 18.125 25-29 >>END_MODULE SRR12161435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.391 37.0 37.0 37.0 37.0 37.0 2 36.006 37.0 37.0 37.0 37.0 37.0 3 35.9675 37.0 37.0 37.0 37.0 37.0 4 36.0975 37.0 37.0 37.0 37.0 37.0 5 36.1815 37.0 37.0 37.0 37.0 37.0 6 36.1 37.0 37.0 37.0 37.0 37.0 7 36.143 37.0 37.0 37.0 37.0 37.0 8 36.134 37.0 37.0 37.0 37.0 37.0 9 36.278 37.0 37.0 37.0 37.0 37.0 10-14 36.2529 37.0 37.0 37.0 37.0 37.0 15-19 36.186400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.1426 37.0 37.0 37.0 37.0 37.0 25-29 36.1468 37.0 37.0 37.0 37.0 37.0 30-34 36.1185 37.0 37.0 37.0 37.0 37.0 35-39 36.09740000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0988 37.0 37.0 37.0 37.0 37.0 45-49 36.058899999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0454 37.0 37.0 37.0 37.0 37.0 55-59 36.0339 37.0 37.0 37.0 37.0 37.0 60-64 35.995799999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9483 37.0 37.0 37.0 37.0 37.0 70-74 35.884 37.0 37.0 37.0 37.0 37.0 75-79 35.7711 37.0 37.0 37.0 37.0 37.0 80-84 35.94870000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8916 37.0 37.0 37.0 37.0 37.0 90-94 35.8645 37.0 37.0 37.0 37.0 37.0 95-99 35.873000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8905 37.0 37.0 37.0 37.0 37.0 105-109 35.8578 37.0 37.0 37.0 37.0 37.0 110-114 35.8249 37.0 37.0 37.0 37.0 37.0 115-119 35.745999999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7361 37.0 37.0 37.0 37.0 37.0 125-129 35.6768 37.0 37.0 37.0 37.0 37.0 130-134 35.5842 37.0 37.0 37.0 37.0 37.0 135-139 35.581599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5649 37.0 37.0 37.0 37.0 37.0 145-149 35.63269999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.05 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 4.0 21 4.0 22 3.0 23 3.0 24 6.0 25 6.0 26 11.0 27 9.0 28 20.0 29 16.0 30 29.0 31 41.0 32 66.0 33 100.0 34 202.0 35 537.0 36 2672.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.65 26.775 9.25 25.324999999999996 2 26.724999999999998 26.5 30.825000000000003 15.950000000000001 3 20.75 28.825 31.05 19.375 4 22.175 35.775 23.775 18.275 5 24.275 37.05 22.575 16.1 6 21.5 39.0 21.6 17.9 7 21.025 23.875 37.05 18.05 8 21.65 25.874999999999996 29.675 22.8 9 22.400000000000002 25.45 29.7 22.45 10-14 22.88 30.255 25.6 21.265 15-19 22.84 28.665000000000003 27.505000000000003 20.990000000000002 20-24 22.830000000000002 28.775000000000002 27.46 20.935000000000002 25-29 23.44 28.720000000000002 27.474999999999998 20.365 30-34 22.91 28.22 27.665 21.205 35-39 23.035 28.52 27.500000000000004 20.945 40-44 23.425 28.315 27.375 20.885 45-49 22.675 28.92 27.450000000000003 20.955 50-54 23.405 28.815 27.084999999999997 20.695 55-59 23.575 28.060000000000002 27.689999999999998 20.674999999999997 60-64 23.04 28.205000000000002 27.16 21.595 65-69 23.695 27.529999999999998 27.700000000000003 21.075 70-74 23.115 27.48 27.894999999999996 21.51 75-79 23.1 27.900000000000002 27.889999999999997 21.11 80-84 23.674999999999997 28.38 26.96 20.985 85-89 23.599999999999998 28.16 27.025 21.215 90-94 23.71 28.24 26.895000000000003 21.154999999999998 95-99 23.74 27.505000000000003 27.889999999999997 20.865000000000002 100-104 23.055 28.365000000000002 27.279999999999998 21.3 105-109 23.48 27.99 27.500000000000004 21.029999999999998 110-114 23.49 28.555000000000003 27.084999999999997 20.87 115-119 23.56 28.24 27.584999999999997 20.615 120-124 23.810000000000002 28.26 27.615000000000002 20.315 125-129 24.310000000000002 28.025 27.51 20.155 130-134 23.95 28.9 26.815 20.335 135-139 24.01 28.04 27.500000000000004 20.45 140-144 23.990000000000002 27.765 27.525 20.72 145-149 24.709999999999997 27.91 26.815 20.565 150-151 26.05 27.85 26.137500000000003 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 1.0 20 1.0 21 2.0 22 1.5 23 2.0 24 2.5 25 2.0 26 4.0 27 7.0 28 10.5 29 11.0 30 10.5 31 15.0 32 24.0 33 31.5 34 47.5 35 63.0 36 90.0 37 126.5 38 139.0 39 171.5 40 201.0 41 210.5 42 220.5 43 238.0 44 280.5 45 292.0 46 272.0 47 257.0 48 233.0 49 201.5 50 165.5 51 133.5 52 109.5 53 90.5 54 79.0 55 62.5 56 44.0 57 35.0 58 27.5 59 23.0 60 16.0 61 6.0 62 4.0 63 4.0 64 2.5 65 3.5 66 3.0 67 0.0 68 0.0 69 2.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.01187648456056 90.0 2 4.565848508841383 8.649999999999999 3 0.3167062549485352 0.8999999999999999 4 0.052784375824755876 0.2 5 0.052784375824755876 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCTTGGTCGAGTTGTATCAGGTTTTGGGTCTGAACATGTCTTGAAAAAG 5 0.125 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2125000000000004 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGAG 10 0.006830828 145.0 5 GAGCCTA 10 0.006830828 145.0 9 TGATAGC 10 0.006830828 145.0 145 CACTTGA 10 0.006830828 145.0 4 AGAGAAT 10 0.006830828 145.0 1 GCCAAAA 10 0.006830828 145.0 2 >>END_MODULE Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642390 spots for SRR12161435.sra Written 642390 spots for SRR12161435.sra Read 642408 spots for SRR12161435.sra Written 642408 spots for SRR12161435.sra SRR ids: ['SRR12161435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1bp5oce SRR12161435.sra spots: 12847818 blocks: [[1, 642390], [642391, 1284780], [1284781, 1927170], [1927171, 2569560], [2569561, 3211950], [3211951, 3854340], [3854341, 4496730], [4496731, 5139120], [5139121, 5781510], [5781511, 6423900], [6423901, 7066290], [7066291, 7708680], [7708681, 8351070], [8351071, 8993460], [8993461, 9635850], [9635851, 10278240], [10278241, 10920630], [10920631, 11563020], [11563021, 12205410], [12205411, 12847818]] SRR12161435 file size 4344550 SRR12161435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161435 SRR12161435_1.fastq SRR12161435_2.fastq Input file: SRR12161435_1.fastq Paired file: SRR12161435_2.fastq trimmed: SRR12161435-trimmed-pair1.fastq, SRR12161435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:37:33 2025 >> started Thu Feb 13 16:37:47 2025 >> done (14.125s) 12847818 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 3808 ( 0.03%) empty read pairs filtered out after trimming by size control 12843999 (99.97%) read pairs available; of these: 568849 ( 4.43%) trimmed read pairs available after processing 12275150 (95.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 3 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 11 0.00% 28 7 0.00% 29 11 0.00% 30 6 0.00% 31 6 0.00% 32 11 0.00% 33 11 0.00% 34 13 0.00% 35 15 0.00% 36 10 0.00% 37 9 0.00% 38 11 0.00% 39 5 0.00% 40 7 0.00% 41 8 0.00% 42 9 0.00% 43 14 0.00% 44 11 0.00% 45 10 0.00% 46 10 0.00% 47 18 0.00% 48 6 0.00% 49 16 0.00% 50 23 0.00% 51 18 0.00% 52 24 0.00% 53 26 0.00% 54 24 0.00% 55 23 0.00% 56 22 0.00% 57 31 0.00% 58 37 0.00% 59 44 0.00% 60 49 0.00% 61 60 0.00% 62 53 0.00% 63 49 0.00% 64 68 0.00% 65 64 0.00% 66 68 0.00% 67 80 0.00% 68 79 0.00% 69 115 0.00% 70 114 0.00% 71 133 0.00% 72 153 0.00% 73 175 0.00% 74 168 0.00% 75 176 0.00% 76 259 0.00% 77 224 0.00% 78 301 0.00% 79 331 0.00% 80 352 0.00% 81 347 0.00% 82 463 0.00% 83 495 0.00% 84 548 0.00% 85 601 0.00% 86 720 0.01% 87 804 0.01% 88 770 0.01% 89 891 0.01% 90 981 0.01% 91 1066 0.01% 92 1229 0.01% 93 1341 0.01% 94 1528 0.01% 95 1627 0.01% 96 1871 0.01% 97 1897 0.01% 98 1969 0.02% 99 2157 0.02% 100 2392 0.02% 101 2542 0.02% 102 2739 0.02% 103 2968 0.02% 104 3183 0.02% 105 3380 0.03% 106 3657 0.03% 107 3911 0.03% 108 3960 0.03% 109 4257 0.03% 110 4549 0.04% 111 4848 0.04% 112 5053 0.04% 113 5254 0.04% 114 5651 0.04% 115 5962 0.05% 116 6347 0.05% 117 6672 0.05% 118 6936 0.05% 119 7299 0.06% 120 7541 0.06% 121 7888 0.06% 122 8321 0.06% 123 8858 0.07% 124 9203 0.07% 125 9502 0.07% 126 10094 0.08% 127 10488 0.08% 128 10666 0.08% 129 11480 0.09% 130 11723 0.09% 131 12112 0.09% 132 12390 0.10% 133 12867 0.10% 134 13605 0.11% 135 14231 0.11% 136 14727 0.11% 137 15176 0.12% 138 15743 0.12% 139 16442 0.13% 140 16755 0.13% 141 17487 0.14% 142 18344 0.14% 143 18719 0.15% 144 19549 0.15% 145 19814 0.15% 146 20326 0.16% 147 21016 0.16% 148 21579 0.17% 149 22317 0.17% 150 23408 0.18% 151 12275150 95.57% 12843999 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=8.03 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.6 sequence=TAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=27 prefix-density=0.38 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=43.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.8 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR12161435 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:38:28 Started mapping on | Feb 13 16:38:28 Finished on | Feb 13 16:40:01 Mapping speed, Million of reads per hour | 497.19 Number of input reads | 12843999 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11953420 Uniquely mapped reads % | 93.07% Average mapped length | 299.03 Number of splices: Total | 12051767 Number of splices: Annotated (sjdb) | 11795165 Number of splices: GT/AG | 11808826 Number of splices: GC/AG | 203968 Number of splices: AT/AC | 8908 Number of splices: Non-canonical | 30065 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341499 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 118541 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549080 549080 549080 N_multimapping 341499 341499 341499 N_noFeature 357894 11815628 402003 N_ambiguous 183092 758 89105 UnstrandedReadsAssigned:11412434 PositiveStrandReadsAssigned:137034 NegativeStrandReadsAssigned:11462312 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161435-trimmed-pair1.fastq SRR12161435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,843,999 reads, 11,605,570 reads pseudoaligned [quant] estimated average fragment length: 279.418 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR12161435.ke.tsv 34699 SRR12161435.se.tsv 87100 total ==> SRR12161435.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.58 366 16.2895 Potri.005G024800.1.v4.1 1035 756.582 503 51.4734 Potri.004G059700.1.v4.1 961 682.782 23 2.60805 Potri.007G009000.2.v4.1 1416 1137.58 0 0 Potri.003G141000.2.v4.1 2943 2664.58 413.289 12.0087 Potri.016G087400.1.v4.1 270 69.6955 591 656.529 Potri.015G069301.1.v4.1 564 301.376 0 0 Potri.010G195200.1.v4.1 1773 1494.58 16 0.828841 Potri.012G127500.1.v4.1 977 698.691 255 28.257 ==> SRR12161435.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 224 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12161435 completed mapping pipeline successfully