Starting /dee2/code/volunteer_pipeline.sh SRR12161436 current disk space = 3088851656704 free memory = 1380742196 SRR12161436 SRAfilesize f9d740419fbb08d30a273eb255321444 SRR12161436.sra SRR12161436.sra file validated SRR12161436 is paired end SRR12161436 is conventional basespace SRR12161436 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5305 37.0 37.0 37.0 37.0 37.0 2 36.3915 37.0 37.0 37.0 37.0 37.0 3 36.511 37.0 37.0 37.0 37.0 37.0 4 36.5715 37.0 37.0 37.0 37.0 37.0 5 36.5435 37.0 37.0 37.0 37.0 37.0 6 36.5495 37.0 37.0 37.0 37.0 37.0 7 36.5065 37.0 37.0 37.0 37.0 37.0 8 36.556 37.0 37.0 37.0 37.0 37.0 9 36.5535 37.0 37.0 37.0 37.0 37.0 10-14 36.6038 37.0 37.0 37.0 37.0 37.0 15-19 36.527699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4815 37.0 37.0 37.0 37.0 37.0 25-29 36.4253 37.0 37.0 37.0 37.0 37.0 30-34 36.4511 37.0 37.0 37.0 37.0 37.0 35-39 36.4135 37.0 37.0 37.0 37.0 37.0 40-44 36.4187 37.0 37.0 37.0 37.0 37.0 45-49 36.347899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3515 37.0 37.0 37.0 37.0 37.0 55-59 36.3525 37.0 37.0 37.0 37.0 37.0 60-64 36.2905 37.0 37.0 37.0 37.0 37.0 65-69 36.271 37.0 37.0 37.0 37.0 37.0 70-74 36.2965 37.0 37.0 37.0 37.0 37.0 75-79 36.262 37.0 37.0 37.0 37.0 37.0 80-84 36.2662 37.0 37.0 37.0 37.0 37.0 85-89 36.2401 37.0 37.0 37.0 37.0 37.0 90-94 36.2316 37.0 37.0 37.0 37.0 37.0 95-99 36.1872 37.0 37.0 37.0 37.0 37.0 100-104 36.1961 37.0 37.0 37.0 37.0 37.0 105-109 36.1049 37.0 37.0 37.0 37.0 37.0 110-114 36.1493 37.0 37.0 37.0 37.0 37.0 115-119 36.1125 37.0 37.0 37.0 37.0 37.0 120-124 36.0625 37.0 37.0 37.0 37.0 37.0 125-129 35.963100000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.068799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.955 37.0 37.0 37.0 37.0 37.0 140-144 35.904199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.9097 37.0 37.0 37.0 37.0 37.0 150-151 35.63775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 2.0 26 4.0 27 7.0 28 19.0 29 23.0 30 23.0 31 35.0 32 52.0 33 88.0 34 110.0 35 296.0 36 2889.0 37 450.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.125 12.125 5.525 32.225 2 21.725 13.8 33.0 31.474999999999998 3 17.175 18.7 30.475 33.650000000000006 4 20.775 25.55 26.1 27.575 5 23.65 32.025 23.674999999999997 20.65 6 21.099999999999998 35.15 22.85 20.9 7 14.6 27.125 40.875 17.4 8 17.65 26.700000000000003 30.75 24.9 9 17.65 24.975 33.375 24.0 10-14 20.419999999999998 29.175 27.325 23.080000000000002 15-19 20.71 27.625 27.505000000000003 24.16 20-24 20.380000000000003 28.105000000000004 27.54 23.974999999999998 25-29 20.105 28.29 28.139999999999997 23.465 30-34 19.715 28.565 27.41 24.310000000000002 35-39 20.14 27.48 27.82 24.560000000000002 40-44 20.48 28.09 27.865000000000002 23.565 45-49 20.32 28.48 27.224999999999998 23.974999999999998 50-54 20.535 27.675 28.050000000000004 23.74 55-59 20.25 28.175 27.334999999999997 24.240000000000002 60-64 20.48 28.02 27.715 23.785 65-69 20.435 27.644999999999996 27.42 24.5 70-74 19.77 27.689999999999998 27.915 24.625 75-79 20.599999999999998 27.800000000000004 27.3 24.3 80-84 20.84 27.694999999999997 27.195000000000004 24.27 85-89 20.36 28.21 27.61 23.82 90-94 20.86 27.87 27.58 23.69 95-99 20.5 27.495000000000005 28.095 23.91 100-104 20.465 28.139999999999997 27.334999999999997 24.060000000000002 105-109 20.87 28.185 27.529999999999998 23.415 110-114 20.669999999999998 28.15 27.11 24.07 115-119 20.53 28.134999999999998 27.6 23.735 120-124 20.7 27.939999999999998 27.54 23.82 125-129 20.01 28.444999999999997 27.63 23.915 130-134 21.21 27.99 27.195000000000004 23.605 135-139 21.765 27.925 27.105 23.205000000000002 140-144 20.974999999999998 27.96 27.060000000000002 24.005000000000003 145-149 20.785 28.185 27.284999999999997 23.745 150-151 21.3875 28.349999999999998 26.575 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 0.0 25 2.0 26 5.0 27 8.0 28 11.0 29 13.5 30 13.0 31 22.0 32 30.5 33 36.5 34 53.5 35 71.5 36 75.0 37 88.0 38 116.5 39 135.0 40 173.0 41 206.0 42 220.0 43 243.0 44 258.5 45 262.5 46 254.0 47 243.0 48 235.5 49 232.5 50 204.5 51 156.0 52 144.0 53 127.5 54 86.0 55 60.0 56 48.0 57 36.5 58 31.5 59 30.0 60 20.0 61 12.5 62 7.5 63 2.5 64 3.5 65 3.5 66 1.5 67 1.0 68 2.0 69 2.0 70 1.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40466719702997 89.0 2 5.171042163882259 9.75 3 0.3977724741447892 1.125 4 0.0 0.0 5 0.026518164942985947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0125 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.0625 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.15 0.0 0.0 0.025 0.0 88-89 0.16249999999999998 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.2875 0.0 0.0 0.025 0.0 94-95 0.325 0.0 0.0 0.025 0.0 96-97 0.475 0.0 0.0 0.025 0.0 98-99 0.5375000000000001 0.0 0.0 0.025 0.0 100-101 0.625 0.0 0.0 0.025 0.0 102-103 0.675 0.0 0.0 0.025 0.0 104-105 0.7124999999999999 0.0 0.0 0.025 0.0 106-107 0.8125 0.0 0.0 0.025 0.0 108-109 0.8999999999999999 0.0 0.0 0.025 0.0 110-111 1.0375 0.0 0.0 0.025 0.0 112-113 1.175 0.0 0.0 0.025 0.0 114-115 1.3875000000000002 0.0 0.0 0.025 0.0 116-117 1.55 0.0 0.0 0.025 0.0 118-119 1.7000000000000002 0.0 0.0 0.025 0.0 120-121 1.9625 0.0 0.0 0.025 0.0 122-123 2.075 0.0 0.0 0.025 0.0 124-125 2.3625 0.0 0.0 0.025 0.0 126-127 2.5999999999999996 0.0 0.0 0.025 0.0 128-129 2.95 0.0 0.0 0.025 0.0 130-131 3.325 0.0 0.0 0.025 0.0 132-133 3.7249999999999996 0.0 0.0 0.025 0.0 134-135 3.9749999999999996 0.0 0.0 0.025 0.0 136-137 4.512499999999999 0.0 0.0 0.025 0.0 138-139 5.0375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACT 10 0.006830828 145.0 6 >>END_MODULE SRR12161436 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2255 37.0 37.0 37.0 37.0 37.0 2 35.861 37.0 37.0 37.0 37.0 37.0 3 35.859 37.0 37.0 37.0 37.0 37.0 4 36.003 37.0 37.0 37.0 37.0 37.0 5 36.1005 37.0 37.0 37.0 37.0 37.0 6 36.106 37.0 37.0 37.0 37.0 37.0 7 36.1175 37.0 37.0 37.0 37.0 37.0 8 36.2035 37.0 37.0 37.0 37.0 37.0 9 36.1295 37.0 37.0 37.0 37.0 37.0 10-14 36.1294 37.0 37.0 37.0 37.0 37.0 15-19 36.1405 37.0 37.0 37.0 37.0 37.0 20-24 36.165299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0989 37.0 37.0 37.0 37.0 37.0 30-34 35.9767 37.0 37.0 37.0 37.0 37.0 35-39 36.029399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.00789999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.956399999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.9353 37.0 37.0 37.0 37.0 37.0 55-59 35.877300000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.8962 37.0 37.0 37.0 37.0 37.0 65-69 35.888099999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.7549 37.0 37.0 37.0 37.0 37.0 75-79 35.7999 37.0 37.0 37.0 37.0 37.0 80-84 35.801 37.0 37.0 37.0 37.0 37.0 85-89 35.744600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.75 37.0 37.0 37.0 37.0 37.0 95-99 35.7772 37.0 37.0 37.0 37.0 37.0 100-104 35.753 37.0 37.0 37.0 37.0 37.0 105-109 35.7179 37.0 37.0 37.0 37.0 37.0 110-114 35.67100000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6042 37.0 37.0 37.0 37.0 37.0 120-124 35.5862 37.0 37.0 37.0 37.0 37.0 125-129 35.5313 37.0 37.0 37.0 37.0 37.0 130-134 35.476099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.453199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3347 37.0 37.0 37.0 34.6 37.0 145-149 35.4173 37.0 37.0 37.0 37.0 37.0 150-151 34.68 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 3.0 15 4.0 16 3.0 17 4.0 18 4.0 19 4.0 20 2.0 21 3.0 22 5.0 23 3.0 24 4.0 25 6.0 26 13.0 27 10.0 28 11.0 29 26.0 30 25.0 31 48.0 32 59.0 33 96.0 34 194.0 35 555.0 36 2649.0 37 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.275 24.9 7.5249999999999995 20.3 2 29.425 24.125 29.325000000000003 17.125 3 22.400000000000002 26.700000000000003 33.5 17.4 4 22.425 35.199999999999996 23.375 19.0 5 25.624999999999996 37.0 19.875 17.5 6 22.475 39.324999999999996 20.1 18.099999999999998 7 21.675 23.400000000000002 36.525 18.4 8 21.7 26.924999999999997 27.875 23.5 9 22.400000000000002 23.275000000000002 29.475 24.85 10-14 24.23 29.304999999999996 25.385 21.08 15-19 23.265 28.455000000000002 26.895000000000003 21.385 20-24 23.849999999999998 28.535 27.200000000000003 20.415 25-29 22.99 28.470000000000002 27.185 21.355 30-34 22.98 28.42 27.905 20.695 35-39 23.525 28.115000000000002 27.66 20.7 40-44 23.235 28.22 27.560000000000002 20.985 45-49 23.635 27.575 28.015 20.775 50-54 23.91 27.91 27.605 20.575 55-59 23.185 28.275 27.185 21.355 60-64 23.39 27.755000000000003 27.815 21.04 65-69 23.505000000000003 27.36 28.01 21.125 70-74 23.935000000000002 27.91 26.884999999999998 21.27 75-79 23.765 27.779999999999998 27.21 21.245 80-84 22.915 27.705000000000002 27.54 21.84 85-89 23.865 28.494999999999997 26.790000000000003 20.849999999999998 90-94 23.895 27.485 27.474999999999998 21.145 95-99 23.474999999999998 27.715 27.67 21.14 100-104 24.075 27.51 27.215 21.2 105-109 23.775 27.284999999999997 28.15 20.79 110-114 23.835 27.675 27.474999999999998 21.015 115-119 24.465 27.79 27.0 20.745 120-124 24.345 28.315 27.27 20.07 125-129 24.215 27.839999999999996 27.405 20.54 130-134 24.82 27.49 27.215 20.474999999999998 135-139 25.1 28.465 26.455000000000002 19.98 140-144 24.09 28.194999999999997 27.134999999999998 20.580000000000002 145-149 24.825 27.439999999999998 27.334999999999997 20.4 150-151 24.8625 28.475 26.55 20.1125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 1.0 6 1.5 7 1.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 2.0 21 4.0 22 3.0 23 2.0 24 1.5 25 1.5 26 5.0 27 6.0 28 8.0 29 10.0 30 16.5 31 24.0 32 28.5 33 30.5 34 40.5 35 57.0 36 71.5 37 103.0 38 136.5 39 162.0 40 184.5 41 200.0 42 223.0 43 238.0 44 257.0 45 277.0 46 271.5 47 258.0 48 235.0 49 214.0 50 179.0 51 135.0 52 123.0 53 108.0 54 79.0 55 67.5 56 56.0 57 40.5 58 28.5 59 25.5 60 22.5 61 11.5 62 6.5 63 5.0 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 2.5 70 2.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 1.5 96 1.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.5464219207236 88.85 2 4.8683160415004 9.15 3 0.4522479382814578 1.275 4 0.07980845969672785 0.3 5 0.026602819898909287 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026602819898909287 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.5 0.0 0.0 0.0 0.0 138-139 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGTG 10 0.006830828 145.0 8 AAATTGC 10 0.006830828 145.0 4 CCATCAT 10 0.006830828 145.0 9 AGTCAGC 10 0.006830828 145.0 6 AAGTCAG 10 0.006830828 145.0 5 AGAGAGA 20 0.00593511 29.0 110-114 >>END_MODULE Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750140 spots for SRR12161436.sra Written 750140 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra Read 750124 spots for SRR12161436.sra Written 750124 spots for SRR12161436.sra SRR ids: ['SRR12161436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ea0wnrh_ SRR12161436.sra spots: 15002496 blocks: [[1, 750124], [750125, 1500248], [1500249, 2250372], [2250373, 3000496], [3000497, 3750620], [3750621, 4500744], [4500745, 5250868], [5250869, 6000992], [6000993, 6751116], [6751117, 7501240], [7501241, 8251364], [8251365, 9001488], [9001489, 9751612], [9751613, 10501736], [10501737, 11251860], [11251861, 12001984], [12001985, 12752108], [12752109, 13502232], [13502233, 14252356], [14252357, 15002496]] SRR12161436 file size 5076804 SRR12161436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161436 SRR12161436_1.fastq SRR12161436_2.fastq Input file: SRR12161436_1.fastq Paired file: SRR12161436_2.fastq trimmed: SRR12161436-trimmed-pair1.fastq, SRR12161436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:47:16 2025 >> started Thu Feb 13 16:47:34 2025 >> done (18.206s) 15002496 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 3700 ( 0.02%) empty read pairs filtered out after trimming by size control 14998767 (99.98%) read pairs available; of these: 1233437 ( 8.22%) trimmed read pairs available after processing 13765330 (91.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 6 0.00% 22 8 0.00% 23 11 0.00% 24 3 0.00% 25 14 0.00% 26 19 0.00% 27 12 0.00% 28 14 0.00% 29 14 0.00% 30 13 0.00% 31 18 0.00% 32 17 0.00% 33 15 0.00% 34 13 0.00% 35 15 0.00% 36 17 0.00% 37 15 0.00% 38 22 0.00% 39 25 0.00% 40 33 0.00% 41 27 0.00% 42 24 0.00% 43 23 0.00% 44 14 0.00% 45 20 0.00% 46 24 0.00% 47 22 0.00% 48 32 0.00% 49 31 0.00% 50 37 0.00% 51 37 0.00% 52 41 0.00% 53 42 0.00% 54 40 0.00% 55 55 0.00% 56 67 0.00% 57 55 0.00% 58 76 0.00% 59 79 0.00% 60 94 0.00% 61 108 0.00% 62 130 0.00% 63 119 0.00% 64 139 0.00% 65 137 0.00% 66 154 0.00% 67 187 0.00% 68 190 0.00% 69 241 0.00% 70 263 0.00% 71 295 0.00% 72 358 0.00% 73 404 0.00% 74 427 0.00% 75 486 0.00% 76 522 0.00% 77 637 0.00% 78 688 0.00% 79 765 0.01% 80 819 0.01% 81 1009 0.01% 82 1128 0.01% 83 1286 0.01% 84 1353 0.01% 85 1619 0.01% 86 1682 0.01% 87 1882 0.01% 88 1998 0.01% 89 2339 0.02% 90 2520 0.02% 91 2884 0.02% 92 3147 0.02% 93 3529 0.02% 94 3901 0.03% 95 4297 0.03% 96 4527 0.03% 97 4965 0.03% 98 5240 0.03% 99 5731 0.04% 100 6093 0.04% 101 6349 0.04% 102 7222 0.05% 103 7729 0.05% 104 8363 0.06% 105 8672 0.06% 106 9153 0.06% 107 9763 0.07% 108 10097 0.07% 109 10833 0.07% 110 10954 0.07% 111 11816 0.08% 112 12829 0.09% 113 13470 0.09% 114 14377 0.10% 115 15002 0.10% 116 15463 0.10% 117 16320 0.11% 118 16533 0.11% 119 17392 0.12% 120 17872 0.12% 121 18559 0.12% 122 19451 0.13% 123 20585 0.14% 124 21698 0.14% 125 22562 0.15% 126 23459 0.16% 127 23672 0.16% 128 24651 0.16% 129 24981 0.17% 130 25559 0.17% 131 26067 0.17% 132 27035 0.18% 133 28796 0.19% 134 29815 0.20% 135 30778 0.21% 136 31758 0.21% 137 31985 0.21% 138 32529 0.22% 139 33140 0.22% 140 33265 0.22% 141 34753 0.23% 142 36065 0.24% 143 37004 0.25% 144 38691 0.26% 145 39822 0.27% 146 40514 0.27% 147 40876 0.27% 148 41160 0.27% 149 41691 0.28% 150 42951 0.29% 151 13765330 91.78% 14998767 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=23 fanout-score=9.49 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=3.7 sequence=ACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=78.46 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12161436 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:48:21 Started mapping on | Feb 13 16:48:21 Finished on | Feb 13 16:50:19 Mapping speed, Million of reads per hour | 457.59 Number of input reads | 14998767 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13825615 Uniquely mapped reads % | 92.18% Average mapped length | 297.21 Number of splices: Total | 14423734 Number of splices: Annotated (sjdb) | 14152705 Number of splices: GT/AG | 14124394 Number of splices: GC/AG | 245920 Number of splices: AT/AC | 11397 Number of splices: Non-canonical | 42023 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328567 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 93236 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.79% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 844585 844585 844585 N_multimapping 328567 328567 328567 N_noFeature 420655 13645230 480986 N_ambiguous 222201 707 101677 UnstrandedReadsAssigned:13182759 PositiveStrandReadsAssigned:179678 NegativeStrandReadsAssigned:13242952 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161436-trimmed-pair1.fastq SRR12161436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,998,767 reads, 13,365,156 reads pseudoaligned [quant] estimated average fragment length: 256.041 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52401 SRR12161436.ke.tsv 34699 SRR12161436.se.tsv 87100 total ==> SRR12161436.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.96 721 27.3894 Potri.005G024800.1.v4.1 1035 779.959 650 55.8125 Potri.004G059700.1.v4.1 961 706.073 32 3.03522 Potri.007G009000.2.v4.1 1416 1160.96 0 0 Potri.003G141000.2.v4.1 2943 2687.96 610 15.1984 Potri.016G087400.1.v4.1 270 79.0281 673.096 570.407 Potri.015G069301.1.v4.1 564 320.494 0 0 Potri.010G195200.1.v4.1 1773 1517.96 80 3.52955 Potri.012G127500.1.v4.1 977 722.006 176 16.3253 ==> SRR12161436.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 412 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12161436 completed mapping pipeline successfully