Starting /dee2/code/volunteer_pipeline.sh SRR12161437 current disk space = 3088788406272 free memory = 1398292620 SRR12161437 SRAfilesize 5ba329fdc39bacb2a5806ea138b59901 SRR12161437.sra SRR12161437.sra file validated SRR12161437 is paired end SRR12161437 is conventional basespace SRR12161437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57675 37.0 37.0 37.0 37.0 37.0 2 36.441 37.0 37.0 37.0 37.0 37.0 3 36.478 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.617 37.0 37.0 37.0 37.0 37.0 6 36.6015 37.0 37.0 37.0 37.0 37.0 7 36.64 37.0 37.0 37.0 37.0 37.0 8 36.58 37.0 37.0 37.0 37.0 37.0 9 36.491 37.0 37.0 37.0 37.0 37.0 10-14 36.564299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5134 37.0 37.0 37.0 37.0 37.0 20-24 36.512 37.0 37.0 37.0 37.0 37.0 25-29 36.4436 37.0 37.0 37.0 37.0 37.0 30-34 36.44799999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.441199999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.452999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4289 37.0 37.0 37.0 37.0 37.0 50-54 36.3916 37.0 37.0 37.0 37.0 37.0 55-59 36.419200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.35 37.0 37.0 37.0 37.0 37.0 65-69 36.34589999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3189 37.0 37.0 37.0 37.0 37.0 75-79 36.329499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.317499999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2704 37.0 37.0 37.0 37.0 37.0 90-94 36.2706 37.0 37.0 37.0 37.0 37.0 95-99 36.221199999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.182500000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1228 37.0 37.0 37.0 37.0 37.0 110-114 36.200599999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.174800000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.14319999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0363 37.0 37.0 37.0 37.0 37.0 130-134 36.0312 37.0 37.0 37.0 37.0 37.0 135-139 35.9503 37.0 37.0 37.0 37.0 37.0 140-144 35.958600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.850199999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.717749999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 7.0 28 11.0 29 8.0 30 30.0 31 35.0 32 63.0 33 71.0 34 126.0 35 269.0 36 2956.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.236059014753685 11.877969492373094 6.651662915728933 37.23430857714429 2 21.099999999999998 12.825000000000001 34.075 32.0 3 17.2 17.974999999999998 29.95 34.875 4 21.6 25.424999999999997 24.625 28.349999999999998 5 23.125 31.85 22.95 22.075 6 19.75 33.725 24.45 22.075 7 13.900000000000002 25.85 44.375 15.875 8 16.650000000000002 26.5 31.85 25.0 9 18.575 23.575 34.300000000000004 23.549999999999997 10-14 19.634999999999998 29.849999999999998 27.169999999999998 23.345 15-19 20.575 28.345 27.305 23.775 20-24 19.900000000000002 28.555000000000003 27.944999999999997 23.599999999999998 25-29 19.945 28.705000000000002 28.025 23.325000000000003 30-34 20.41 28.720000000000002 27.355 23.515 35-39 20.175 27.97 27.529999999999998 24.325 40-44 19.88 28.689999999999998 27.48 23.95 45-49 20.06 28.63 27.48 23.830000000000002 50-54 19.93 28.24 27.99 23.84 55-59 20.485 27.650000000000002 27.634999999999998 24.23 60-64 19.98 27.644999999999996 27.889999999999997 24.485 65-69 20.24 28.21 27.445000000000004 24.104999999999997 70-74 20.22 28.494999999999997 27.07 24.215 75-79 20.31 27.71 27.77 24.21 80-84 20.275000000000002 27.889999999999997 27.345000000000002 24.490000000000002 85-89 20.02 27.655 28.4 23.925 90-94 20.385 28.04 27.625 23.95 95-99 19.845 28.005000000000003 27.79 24.36 100-104 20.330000000000002 27.98 27.665 24.025 105-109 20.62 27.675 27.860000000000003 23.845 110-114 21.099999999999998 27.884999999999998 27.54 23.474999999999998 115-119 20.62 28.215 26.985 24.18 120-124 20.57 28.315 26.919999999999998 24.195 125-129 20.49 28.08 27.665 23.765 130-134 20.375 27.755000000000003 27.555000000000003 24.315 135-139 20.685000000000002 27.685 27.694999999999997 23.935000000000002 140-144 20.575 28.185 27.250000000000004 23.990000000000002 145-149 20.52 27.775 27.700000000000003 24.005000000000003 150-151 20.8125 27.487499999999997 27.787499999999998 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.5 24 3.5 25 2.5 26 5.0 27 5.5 28 6.5 29 10.0 30 19.5 31 27.5 32 29.0 33 38.5 34 49.5 35 72.0 36 90.5 37 96.5 38 112.5 39 136.5 40 175.5 41 206.0 42 221.5 43 246.0 44 274.5 45 275.0 46 269.0 47 265.5 48 239.5 49 211.0 50 186.5 51 157.5 52 125.0 53 102.0 54 86.5 55 68.0 56 50.0 57 38.0 58 27.5 59 21.0 60 15.5 61 9.5 62 9.0 63 6.0 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30307006035162 90.8 2 4.487011283127788 8.55 3 0.1574389923904487 0.44999999999999996 4 0.05247966413014957 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.3875000000000002 0.0 0.0 0.0 0.0 124-125 1.4874999999999998 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.6624999999999996 0.0 0.0 0.0 0.0 138-139 2.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4255 37.0 37.0 37.0 37.0 37.0 2 36.0845 37.0 37.0 37.0 37.0 37.0 3 36.1735 37.0 37.0 37.0 37.0 37.0 4 36.159 37.0 37.0 37.0 37.0 37.0 5 36.2275 37.0 37.0 37.0 37.0 37.0 6 36.297 37.0 37.0 37.0 37.0 37.0 7 36.286 37.0 37.0 37.0 37.0 37.0 8 36.293 37.0 37.0 37.0 37.0 37.0 9 36.417 37.0 37.0 37.0 37.0 37.0 10-14 36.3064 37.0 37.0 37.0 37.0 37.0 15-19 36.3261 37.0 37.0 37.0 37.0 37.0 20-24 36.259499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2153 37.0 37.0 37.0 37.0 37.0 30-34 36.1942 37.0 37.0 37.0 37.0 37.0 35-39 36.206399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1557 37.0 37.0 37.0 37.0 37.0 45-49 36.1265 37.0 37.0 37.0 37.0 37.0 50-54 36.1115 37.0 37.0 37.0 37.0 37.0 55-59 36.081 37.0 37.0 37.0 37.0 37.0 60-64 36.0789 37.0 37.0 37.0 37.0 37.0 65-69 35.9913 37.0 37.0 37.0 37.0 37.0 70-74 35.9399 37.0 37.0 37.0 37.0 37.0 75-79 35.9707 37.0 37.0 37.0 37.0 37.0 80-84 35.9919 37.0 37.0 37.0 37.0 37.0 85-89 35.9057 37.0 37.0 37.0 37.0 37.0 90-94 35.9014 37.0 37.0 37.0 37.0 37.0 95-99 35.933299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9345 37.0 37.0 37.0 37.0 37.0 105-109 35.922799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.831399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.833600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.82520000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6895 37.0 37.0 37.0 37.0 37.0 130-134 35.6185 37.0 37.0 37.0 37.0 37.0 135-139 35.692699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5501 37.0 37.0 37.0 37.0 37.0 145-149 35.653099999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.1395 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 3.0 15 1.0 16 1.0 17 2.0 18 1.0 19 4.0 20 0.0 21 2.0 22 6.0 23 8.0 24 7.0 25 3.0 26 9.0 27 11.0 28 9.0 29 17.0 30 18.0 31 31.0 32 60.0 33 83.0 34 165.0 35 483.0 36 2766.0 37 306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.800000000000004 25.4 8.25 21.55 2 31.4 25.474999999999998 27.6 15.525 3 21.45 27.625 31.674999999999997 19.25 4 23.799999999999997 35.05 23.575 17.575 5 25.8 36.875 19.650000000000002 17.675 6 21.675 39.025 21.625 17.675 7 20.825 23.400000000000002 37.1 18.675 8 20.875 26.25 26.674999999999997 26.200000000000003 9 22.525000000000002 24.875 28.499999999999996 24.099999999999998 10-14 23.405 29.635 26.015 20.945 15-19 23.655 28.33 27.05 20.965 20-24 23.415 28.325 27.205000000000002 21.055 25-29 23.535 28.93 27.034999999999997 20.5 30-34 23.335 28.505000000000003 27.805000000000003 20.355 35-39 23.87 28.355000000000004 27.55 20.225 40-44 22.96 28.68 27.565 20.794999999999998 45-49 23.485 28.660000000000004 27.185 20.669999999999998 50-54 23.325000000000003 28.325 27.61 20.74 55-59 23.59 28.28 27.339999999999996 20.79 60-64 23.34 27.644999999999996 27.77 21.245 65-69 23.695 28.055000000000003 27.92 20.330000000000002 70-74 23.985 28.095 27.405 20.515 75-79 23.605 28.139999999999997 27.889999999999997 20.365 80-84 23.775 28.110000000000003 27.305 20.810000000000002 85-89 23.735 28.494999999999997 27.025 20.745 90-94 23.855 27.455000000000002 28.33 20.36 95-99 24.2 28.09 27.655 20.055 100-104 23.855 28.37 27.705000000000002 20.07 105-109 24.125 27.88 27.634999999999998 20.36 110-114 24.22 28.22 27.48 20.080000000000002 115-119 23.945 28.615000000000002 27.36 20.080000000000002 120-124 23.575 28.144999999999996 27.555000000000003 20.724999999999998 125-129 23.935000000000002 28.1 28.084999999999997 19.88 130-134 24.525 27.650000000000002 28.01 19.814999999999998 135-139 23.9 28.34 27.88 19.88 140-144 24.66 28.65 26.685 20.005 145-149 24.725 28.37 27.060000000000002 19.845 150-151 24.65 28.1375 27.762500000000003 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 1.5 21 3.0 22 2.5 23 1.5 24 3.0 25 3.0 26 3.5 27 5.0 28 6.0 29 13.5 30 19.0 31 22.0 32 32.5 33 40.5 34 46.5 35 58.0 36 69.5 37 90.0 38 131.0 39 162.0 40 181.0 41 218.0 42 249.0 43 268.5 44 260.5 45 264.5 46 269.5 47 265.0 48 244.0 49 202.5 50 175.5 51 138.5 52 119.5 53 99.0 54 76.0 55 64.5 56 47.5 57 31.0 58 26.0 59 23.0 60 19.0 61 13.5 62 7.0 63 3.0 64 1.0 65 0.5 66 0.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4664570230608 91.07499999999999 2 4.245283018867925 8.1 3 0.2882599580712788 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra Read 734879 spots for SRR12161437.sra Written 734879 spots for SRR12161437.sra SRR ids: ['SRR12161437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e9__1lxv SRR12161437.sra spots: 14697580 blocks: [[1, 734879], [734880, 1469758], [1469759, 2204637], [2204638, 2939516], [2939517, 3674395], [3674396, 4409274], [4409275, 5144153], [5144154, 5879032], [5879033, 6613911], [6613912, 7348790], [7348791, 8083669], [8083670, 8818548], [8818549, 9553427], [9553428, 10288306], [10288307, 11023185], [11023186, 11758064], [11758065, 12492943], [12492944, 13227822], [13227823, 13962701], [13962702, 14697580]] SRR12161437 file size 4973180 SRR12161437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161437 SRR12161437_1.fastq SRR12161437_2.fastq Input file: SRR12161437_1.fastq Paired file: SRR12161437_2.fastq trimmed: SRR12161437-trimmed-pair1.fastq, SRR12161437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:33:20 2025 >> started Thu Feb 13 22:33:37 2025 >> done (16.905s) 14697580 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 1364 ( 0.01%) empty read pairs filtered out after trimming by size control 14696201 (99.99%) read pairs available; of these: 784452 ( 5.34%) trimmed read pairs available after processing 13911749 (94.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 8 0.00% 25 10 0.00% 26 7 0.00% 27 12 0.00% 28 8 0.00% 29 6 0.00% 30 8 0.00% 31 2 0.00% 32 4 0.00% 33 10 0.00% 34 8 0.00% 35 10 0.00% 36 9 0.00% 37 13 0.00% 38 18 0.00% 39 14 0.00% 40 13 0.00% 41 15 0.00% 42 22 0.00% 43 14 0.00% 44 18 0.00% 45 8 0.00% 46 17 0.00% 47 13 0.00% 48 25 0.00% 49 19 0.00% 50 25 0.00% 51 21 0.00% 52 25 0.00% 53 27 0.00% 54 22 0.00% 55 24 0.00% 56 28 0.00% 57 41 0.00% 58 56 0.00% 59 58 0.00% 60 44 0.00% 61 50 0.00% 62 64 0.00% 63 83 0.00% 64 79 0.00% 65 80 0.00% 66 84 0.00% 67 93 0.00% 68 123 0.00% 69 126 0.00% 70 157 0.00% 71 165 0.00% 72 179 0.00% 73 182 0.00% 74 250 0.00% 75 240 0.00% 76 210 0.00% 77 278 0.00% 78 337 0.00% 79 359 0.00% 80 419 0.00% 81 477 0.00% 82 546 0.00% 83 628 0.00% 84 681 0.00% 85 794 0.01% 86 814 0.01% 87 943 0.01% 88 1037 0.01% 89 1070 0.01% 90 1294 0.01% 91 1518 0.01% 92 1643 0.01% 93 1771 0.01% 94 1935 0.01% 95 2134 0.01% 96 2357 0.02% 97 2556 0.02% 98 2612 0.02% 99 2908 0.02% 100 3260 0.02% 101 3484 0.02% 102 3750 0.03% 103 4097 0.03% 104 4325 0.03% 105 4776 0.03% 106 5001 0.03% 107 5234 0.04% 108 5561 0.04% 109 5946 0.04% 110 6329 0.04% 111 6619 0.05% 112 7146 0.05% 113 7516 0.05% 114 7934 0.05% 115 8536 0.06% 116 8930 0.06% 117 9527 0.06% 118 9932 0.07% 119 10321 0.07% 120 10505 0.07% 121 11093 0.08% 122 11615 0.08% 123 12614 0.09% 124 13076 0.09% 125 13509 0.09% 126 14207 0.10% 127 14639 0.10% 128 15255 0.10% 129 15722 0.11% 130 16193 0.11% 131 16843 0.11% 132 17560 0.12% 133 18554 0.13% 134 18891 0.13% 135 20063 0.14% 136 20544 0.14% 137 20922 0.14% 138 21662 0.15% 139 22457 0.15% 140 22733 0.15% 141 23746 0.16% 142 24568 0.17% 143 25450 0.17% 144 26693 0.18% 145 27801 0.19% 146 28139 0.19% 147 28545 0.19% 148 29515 0.20% 149 30313 0.21% 150 30826 0.21% 151 13911749 94.66% 14696201 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=36 prefix-density=0.35 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=50.57 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.35 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=127.18 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.0 sequence=AAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAGA SRR12161437 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:34:21 Started mapping on | Feb 13 22:34:21 Finished on | Feb 13 22:36:01 Mapping speed, Million of reads per hour | 529.06 Number of input reads | 14696201 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13791428 Uniquely mapped reads % | 93.84% Average mapped length | 298.74 Number of splices: Total | 14357071 Number of splices: Annotated (sjdb) | 14039455 Number of splices: GT/AG | 14071151 Number of splices: GC/AG | 232729 Number of splices: AT/AC | 11422 Number of splices: Non-canonical | 41769 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311268 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 88360 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593505 593505 593505 N_multimapping 311268 311268 311268 N_noFeature 499689 13625578 560294 N_ambiguous 193022 1402 86705 UnstrandedReadsAssigned:13098717 PositiveStrandReadsAssigned:164448 NegativeStrandReadsAssigned:13144429 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161437-trimmed-pair1.fastq SRR12161437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,696,201 reads, 13,221,881 reads pseudoaligned [quant] estimated average fragment length: 266.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR12161437.ke.tsv 34699 SRR12161437.se.tsv 87100 total ==> SRR12161437.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.93 567 22.9805 Potri.005G024800.1.v4.1 1035 769.925 653 60.2566 Potri.004G059700.1.v4.1 961 696.038 18 1.8373 Potri.007G009000.2.v4.1 1416 1150.93 0 0 Potri.003G141000.2.v4.1 2943 2677.93 504 13.3713 Potri.016G087400.1.v4.1 270 70.7184 1081 1086.01 Potri.015G069301.1.v4.1 564 309.661 0 0 Potri.010G195200.1.v4.1 1773 1507.93 71 3.34517 Potri.012G127500.1.v4.1 977 711.977 260 25.9446 ==> SRR12161437.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161437 completed mapping pipeline successfully