Starting /dee2/code/volunteer_pipeline.sh SRR12161438 current disk space = 3089334153216 free memory = 1470520896 SRR12161438 SRAfilesize 83e5e8f811407306fffddb9ff4e89b36 SRR12161438.sra SRR12161438.sra file validated SRR12161438 is paired end SRR12161438 is conventional basespace SRR12161438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64825 37.0 37.0 37.0 37.0 37.0 2 36.451 37.0 37.0 37.0 37.0 37.0 3 36.5695 37.0 37.0 37.0 37.0 37.0 4 36.5885 37.0 37.0 37.0 37.0 37.0 5 36.54 37.0 37.0 37.0 37.0 37.0 6 36.641 37.0 37.0 37.0 37.0 37.0 7 36.579 37.0 37.0 37.0 37.0 37.0 8 36.5185 37.0 37.0 37.0 37.0 37.0 9 36.559 37.0 37.0 37.0 37.0 37.0 10-14 36.5689 37.0 37.0 37.0 37.0 37.0 15-19 36.5687 37.0 37.0 37.0 37.0 37.0 20-24 36.5443 37.0 37.0 37.0 37.0 37.0 25-29 36.5343 37.0 37.0 37.0 37.0 37.0 30-34 36.500600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.434799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4384 37.0 37.0 37.0 37.0 37.0 45-49 36.409800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.388600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3566 37.0 37.0 37.0 37.0 37.0 60-64 36.35809999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.35850000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.35979999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.272000000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.303200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2387 37.0 37.0 37.0 37.0 37.0 90-94 36.2798 37.0 37.0 37.0 37.0 37.0 95-99 36.2315 37.0 37.0 37.0 37.0 37.0 100-104 36.231100000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1917 37.0 37.0 37.0 37.0 37.0 110-114 36.1894 37.0 37.0 37.0 37.0 37.0 115-119 36.1531 37.0 37.0 37.0 37.0 37.0 120-124 36.131 37.0 37.0 37.0 37.0 37.0 125-129 36.1019 37.0 37.0 37.0 37.0 37.0 130-134 36.0654 37.0 37.0 37.0 37.0 37.0 135-139 36.00789999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.9431 37.0 37.0 37.0 37.0 37.0 145-149 35.894600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.73475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 3.0 25 1.0 26 4.0 27 7.0 28 13.0 29 15.0 30 27.0 31 21.0 32 54.0 33 71.0 34 110.0 35 286.0 36 2941.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.76194048512128 13.778444611152787 6.426606651662915 32.03300825206302 2 21.375 11.75 34.699999999999996 32.175 3 17.025000000000002 17.775 29.549999999999997 35.65 4 21.8 24.474999999999998 24.95 28.775000000000002 5 22.650000000000002 32.15 23.625 21.575 6 21.25 34.55 22.825 21.375 7 16.2 25.75 39.725 18.325 8 19.025 25.874999999999996 30.9 24.2 9 17.474999999999998 24.5 33.85 24.175 10-14 19.6 29.845 27.435 23.119999999999997 15-19 20.66 27.725 27.74 23.875 20-24 19.650000000000002 28.485 28.035 23.830000000000002 25-29 19.875 28.849999999999998 27.925 23.35 30-34 19.475 28.705000000000002 28.005000000000003 23.815 35-39 20.015 28.265 27.32 24.4 40-44 19.915 29.099999999999998 27.395000000000003 23.59 45-49 20.22 29.115000000000002 26.729999999999997 23.935000000000002 50-54 20.465 28.655 26.985 23.895 55-59 20.72 28.299999999999997 27.98 23.0 60-64 20.18 28.345 27.79 23.685000000000002 65-69 20.24 28.470000000000002 27.41 23.880000000000003 70-74 20.495 28.349999999999998 27.765 23.39 75-79 21.105 27.96 27.08 23.855 80-84 20.424999999999997 29.044999999999998 26.99 23.54 85-89 20.979999999999997 27.865000000000002 27.775 23.380000000000003 90-94 20.325 28.365000000000002 27.38 23.93 95-99 20.69 28.325 27.13 23.855 100-104 21.51 28.68 27.045 22.765 105-109 20.745 28.015 27.455000000000002 23.785 110-114 21.11 27.750000000000004 27.500000000000004 23.64 115-119 21.085 28.044999999999998 27.74 23.13 120-124 20.48 27.884999999999998 27.415 24.22 125-129 20.724999999999998 28.025 27.32 23.93 130-134 20.71 28.310000000000002 27.83 23.150000000000002 135-139 21.23 27.98 26.955000000000002 23.835 140-144 21.21 27.3 27.815 23.674999999999997 145-149 20.82 28.685 27.255000000000003 23.24 150-151 20.4375 27.85 27.1125 24.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 1.5 22 0.5 23 1.0 24 1.0 25 1.5 26 3.5 27 7.5 28 8.5 29 13.0 30 19.0 31 24.5 32 33.0 33 43.5 34 58.5 35 76.0 36 84.5 37 112.5 38 134.5 39 135.0 40 171.5 41 212.0 42 223.5 43 236.0 44 245.5 45 269.0 46 279.5 47 255.0 48 223.5 49 201.5 50 168.5 51 144.0 52 139.0 53 125.0 54 93.5 55 49.5 56 43.0 57 40.0 58 28.5 59 25.5 60 19.0 61 12.0 62 8.5 63 3.5 64 2.0 65 3.5 66 2.5 67 0.0 68 1.5 69 2.5 70 1.0 71 1.0 72 1.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.49444150344097 89.25 2 5.2143991529910005 9.85 3 0.21175224986765487 0.6 4 0.07940709370037057 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1875 37.0 37.0 37.0 37.0 37.0 2 35.9175 37.0 37.0 37.0 37.0 37.0 3 35.868 37.0 37.0 37.0 37.0 37.0 4 36.0945 37.0 37.0 37.0 37.0 37.0 5 36.1185 37.0 37.0 37.0 37.0 37.0 6 36.138 37.0 37.0 37.0 37.0 37.0 7 36.038 37.0 37.0 37.0 37.0 37.0 8 36.1615 37.0 37.0 37.0 37.0 37.0 9 36.0845 37.0 37.0 37.0 37.0 37.0 10-14 36.121399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.123799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0536 37.0 37.0 37.0 37.0 37.0 25-29 35.9621 37.0 37.0 37.0 37.0 37.0 30-34 35.9671 37.0 37.0 37.0 37.0 37.0 35-39 35.92999999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9119 37.0 37.0 37.0 37.0 37.0 45-49 35.88439999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8359 37.0 37.0 37.0 37.0 37.0 55-59 35.874900000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.8045 37.0 37.0 37.0 37.0 37.0 65-69 35.8138 37.0 37.0 37.0 37.0 37.0 70-74 35.7046 37.0 37.0 37.0 37.0 37.0 75-79 35.6997 37.0 37.0 37.0 37.0 37.0 80-84 35.7913 37.0 37.0 37.0 37.0 37.0 85-89 35.641000000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.6666 37.0 37.0 37.0 37.0 37.0 95-99 35.637800000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.7076 37.0 37.0 37.0 37.0 37.0 105-109 35.6348 37.0 37.0 37.0 37.0 37.0 110-114 35.537600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.539 37.0 37.0 37.0 37.0 37.0 120-124 35.5891 37.0 37.0 37.0 37.0 37.0 125-129 35.3679 37.0 37.0 37.0 37.0 37.0 130-134 35.2621 37.0 37.0 37.0 34.6 37.0 135-139 35.3396 37.0 37.0 37.0 37.0 37.0 140-144 35.2602 37.0 37.0 37.0 29.8 37.0 145-149 35.2675 37.0 37.0 37.0 34.6 37.0 150-151 34.607749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 4.0 15 6.0 16 3.0 17 5.0 18 1.0 19 1.0 20 4.0 21 6.0 22 3.0 23 8.0 24 9.0 25 9.0 26 7.0 27 7.0 28 17.0 29 14.0 30 24.0 31 43.0 32 73.0 33 128.0 34 210.0 35 589.0 36 2624.0 37 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.175 25.55 7.925 21.349999999999998 2 28.000000000000004 24.85 29.125 18.025 3 21.6 27.700000000000003 33.15 17.549999999999997 4 23.175 34.300000000000004 23.825 18.7 5 24.575 38.35 20.375 16.7 6 20.375 40.6 21.0 18.025 7 21.8 23.775 36.425000000000004 18.0 8 21.25 26.025 26.5 26.224999999999998 9 21.45 24.65 30.4 23.5 10-14 23.355 29.794999999999998 25.72 21.13 15-19 23.45 27.97 27.485 21.095 20-24 23.080000000000002 28.825 27.279999999999998 20.815 25-29 23.465 29.04 26.840000000000003 20.655 30-34 23.195 27.91 28.060000000000002 20.835 35-39 23.59 28.389999999999997 27.015 21.005 40-44 23.365 27.965 27.534999999999997 21.135 45-49 23.119999999999997 28.515 27.6 20.765 50-54 23.474999999999998 28.18 27.49 20.855 55-59 23.665 27.889999999999997 27.639999999999997 20.805 60-64 23.18 27.500000000000004 27.839999999999996 21.48 65-69 22.855 27.775 28.299999999999997 21.07 70-74 23.61 27.595 27.43 21.365000000000002 75-79 23.535 27.395000000000003 27.689999999999998 21.38 80-84 23.435 28.189999999999998 27.255000000000003 21.12 85-89 23.365 28.000000000000004 27.634999999999998 21.0 90-94 23.46 28.310000000000002 27.255000000000003 20.974999999999998 95-99 24.23 27.72 27.589999999999996 20.46 100-104 24.15 28.24 27.295 20.315 105-109 24.065 28.244999999999997 27.38 20.31 110-114 23.965 27.994999999999997 27.400000000000002 20.64 115-119 23.68 28.199999999999996 27.544999999999998 20.575 120-124 23.71 28.405 27.725 20.16 125-129 23.59 27.575 27.905 20.93 130-134 24.345 27.565 27.235 20.855 135-139 24.46 28.055000000000003 27.450000000000003 20.035 140-144 24.125 27.72 27.834999999999997 20.32 145-149 24.535 28.105000000000004 27.169999999999998 20.19 150-151 25.474999999999998 28.3125 26.75 19.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 3.5 25 5.5 26 2.0 27 3.5 28 9.0 29 10.0 30 17.0 31 25.0 32 27.0 33 35.0 34 46.0 35 66.5 36 91.5 37 108.5 38 126.5 39 155.0 40 182.0 41 214.0 42 239.0 43 266.5 44 282.5 45 274.0 46 268.5 47 253.0 48 227.0 49 197.5 50 167.0 51 130.5 52 103.0 53 87.5 54 76.5 55 65.5 56 51.5 57 38.5 58 28.0 59 22.5 60 19.0 61 14.5 62 10.0 63 5.0 64 3.5 65 4.5 66 2.5 67 0.0 68 1.0 69 2.5 70 1.5 71 1.0 72 2.0 73 2.0 74 1.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.42823029981427 88.97500000000001 2 5.120721676837357 9.65 3 0.371451313345715 1.05 4 0.05306447333510214 0.2 5 0.02653223666755107 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTCA 10 0.006830828 145.0 145 GAGAGAC 10 0.006830828 145.0 1 ACAGGAG 10 0.006830828 145.0 7 >>END_MODULE Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664051 spots for SRR12161438.sra Written 664051 spots for SRR12161438.sra Read 664061 spots for SRR12161438.sra Written 664061 spots for SRR12161438.sra SRR ids: ['SRR12161438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s8najpwl SRR12161438.sra spots: 13281030 blocks: [[1, 664051], [664052, 1328102], [1328103, 1992153], [1992154, 2656204], [2656205, 3320255], [3320256, 3984306], [3984307, 4648357], [4648358, 5312408], [5312409, 5976459], [5976460, 6640510], [6640511, 7304561], [7304562, 7968612], [7968613, 8632663], [8632664, 9296714], [9296715, 9960765], [9960766, 10624816], [10624817, 11288867], [11288868, 11952918], [11952919, 12616969], [12616970, 13281030]] SRR12161438 file size 4491774 SRR12161438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161438 SRR12161438_1.fastq SRR12161438_2.fastq Input file: SRR12161438_1.fastq Paired file: SRR12161438_2.fastq trimmed: SRR12161438-trimmed-pair1.fastq, SRR12161438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:54:51 2025 >> started Thu Feb 13 22:55:08 2025 >> done (16.303s) 13281030 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 6579 ( 0.05%) empty read pairs filtered out after trimming by size control 13274428 (99.95%) read pairs available; of these: 811139 ( 6.11%) trimmed read pairs available after processing 12463289 (93.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 6 0.00% 22 12 0.00% 23 5 0.00% 24 11 0.00% 25 13 0.00% 26 8 0.00% 27 13 0.00% 28 12 0.00% 29 19 0.00% 30 10 0.00% 31 7 0.00% 32 16 0.00% 33 25 0.00% 34 7 0.00% 35 14 0.00% 36 9 0.00% 37 9 0.00% 38 18 0.00% 39 11 0.00% 40 9 0.00% 41 14 0.00% 42 21 0.00% 43 20 0.00% 44 19 0.00% 45 20 0.00% 46 19 0.00% 47 23 0.00% 48 24 0.00% 49 15 0.00% 50 31 0.00% 51 33 0.00% 52 34 0.00% 53 38 0.00% 54 34 0.00% 55 26 0.00% 56 41 0.00% 57 57 0.00% 58 44 0.00% 59 66 0.00% 60 58 0.00% 61 70 0.00% 62 77 0.00% 63 83 0.00% 64 113 0.00% 65 112 0.00% 66 144 0.00% 67 121 0.00% 68 137 0.00% 69 149 0.00% 70 197 0.00% 71 228 0.00% 72 241 0.00% 73 259 0.00% 74 302 0.00% 75 296 0.00% 76 351 0.00% 77 399 0.00% 78 421 0.00% 79 483 0.00% 80 560 0.00% 81 614 0.00% 82 721 0.01% 83 787 0.01% 84 924 0.01% 85 962 0.01% 86 1097 0.01% 87 1228 0.01% 88 1311 0.01% 89 1394 0.01% 90 1608 0.01% 91 1822 0.01% 92 2037 0.02% 93 2196 0.02% 94 2508 0.02% 95 2675 0.02% 96 2823 0.02% 97 3193 0.02% 98 3302 0.02% 99 3542 0.03% 100 3771 0.03% 101 4041 0.03% 102 4478 0.03% 103 4741 0.04% 104 5220 0.04% 105 5630 0.04% 106 5701 0.04% 107 5993 0.05% 108 6140 0.05% 109 6561 0.05% 110 6715 0.05% 111 7288 0.05% 112 7796 0.06% 113 8200 0.06% 114 8812 0.07% 115 9219 0.07% 116 9765 0.07% 117 10255 0.08% 118 10340 0.08% 119 10963 0.08% 120 11181 0.08% 121 11729 0.09% 122 12542 0.09% 123 13415 0.10% 124 13808 0.10% 125 14197 0.11% 126 15082 0.11% 127 15104 0.11% 128 15727 0.12% 129 16101 0.12% 130 16728 0.13% 131 17065 0.13% 132 17803 0.13% 133 18823 0.14% 134 19462 0.15% 135 20249 0.15% 136 20830 0.16% 137 21186 0.16% 138 21633 0.16% 139 22618 0.17% 140 22805 0.17% 141 23378 0.18% 142 24693 0.19% 143 25162 0.19% 144 26297 0.20% 145 27465 0.21% 146 28071 0.21% 147 27998 0.21% 148 29080 0.22% 149 28896 0.22% 150 30019 0.23% 151 12463289 93.89% 13274428 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=28.14 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.1 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=46.15 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12161438 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:55:55 Started mapping on | Feb 13 22:55:55 Finished on | Feb 13 22:57:53 Mapping speed, Million of reads per hour | 404.98 Number of input reads | 13274428 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12328525 Uniquely mapped reads % | 92.87% Average mapped length | 298.17 Number of splices: Total | 12599322 Number of splices: Annotated (sjdb) | 12341089 Number of splices: GT/AG | 12342371 Number of splices: GC/AG | 215300 Number of splices: AT/AC | 9951 Number of splices: Non-canonical | 31700 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329272 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 71468 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616631 616631 616631 N_multimapping 329272 329272 329272 N_noFeature 364338 12197909 407106 N_ambiguous 175844 587 87715 UnstrandedReadsAssigned:11788343 PositiveStrandReadsAssigned:130029 NegativeStrandReadsAssigned:11833704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161438-trimmed-pair1.fastq SRR12161438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,274,428 reads, 11,964,679 reads pseudoaligned [quant] estimated average fragment length: 271.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12161438.ke.tsv 34699 SRR12161438.se.tsv 87100 total ==> SRR12161438.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.41 264 11.2498 Potri.005G024800.1.v4.1 1035 764.408 451 43.9326 Potri.004G059700.1.v4.1 961 690.671 84 9.05615 Potri.007G009000.2.v4.1 1416 1145.41 0 0 Potri.003G141000.2.v4.1 2943 2672.41 426 11.8698 Potri.016G087400.1.v4.1 270 74.5852 766 764.736 Potri.015G069301.1.v4.1 564 308.492 0 0 Potri.010G195200.1.v4.1 1773 1502.41 9 0.446057 Potri.012G127500.1.v4.1 977 706.569 359 37.8334 ==> SRR12161438.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12161438 completed mapping pipeline successfully