Starting /dee2/code/volunteer_pipeline.sh SRR12161439 current disk space = 3089328545792 free memory = 1582452764 SRR12161439 SRAfilesize 488a3045f0136ad3618efea99f2abb8e SRR12161439.sra SRR12161439.sra file validated SRR12161439 is paired end SRR12161439 is conventional basespace SRR12161439 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56425 37.0 37.0 37.0 37.0 37.0 2 36.494 37.0 37.0 37.0 37.0 37.0 3 36.45 37.0 37.0 37.0 37.0 37.0 4 36.5645 37.0 37.0 37.0 37.0 37.0 5 36.591 37.0 37.0 37.0 37.0 37.0 6 36.5865 37.0 37.0 37.0 37.0 37.0 7 36.575 37.0 37.0 37.0 37.0 37.0 8 36.578 37.0 37.0 37.0 37.0 37.0 9 36.575 37.0 37.0 37.0 37.0 37.0 10-14 36.5576 37.0 37.0 37.0 37.0 37.0 15-19 36.515299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5135 37.0 37.0 37.0 37.0 37.0 25-29 36.474000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4447 37.0 37.0 37.0 37.0 37.0 35-39 36.455799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4001 37.0 37.0 37.0 37.0 37.0 45-49 36.389700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3823 37.0 37.0 37.0 37.0 37.0 55-59 36.396800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3245 37.0 37.0 37.0 37.0 37.0 65-69 36.330799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.316199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3042 37.0 37.0 37.0 37.0 37.0 80-84 36.3317 37.0 37.0 37.0 37.0 37.0 85-89 36.2701 37.0 37.0 37.0 37.0 37.0 90-94 36.3029 37.0 37.0 37.0 37.0 37.0 95-99 36.255900000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.225100000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1663 37.0 37.0 37.0 37.0 37.0 110-114 36.1692 37.0 37.0 37.0 37.0 37.0 115-119 36.1981 37.0 37.0 37.0 37.0 37.0 120-124 36.0835 37.0 37.0 37.0 37.0 37.0 125-129 36.1006 37.0 37.0 37.0 37.0 37.0 130-134 36.042899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9554 37.0 37.0 37.0 37.0 37.0 140-144 35.969100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.94599999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.794250000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 0.0 26 2.0 27 6.0 28 9.0 29 20.0 30 23.0 31 40.0 32 67.0 33 70.0 34 110.0 35 268.0 36 2926.0 37 455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.56064016004001 12.4031007751938 7.076769192298074 37.95948987246812 2 20.8 12.3 34.525 32.375 3 17.2 16.400000000000002 28.549999999999997 37.85 4 19.45 23.9 25.825 30.825000000000003 5 21.275 30.375000000000004 26.05 22.3 6 21.075 33.825 23.474999999999998 21.625 7 15.825 27.224999999999998 39.574999999999996 17.375 8 18.075 28.15 29.725 24.05 9 17.275 24.85 34.475 23.400000000000002 10-14 19.585 29.665000000000003 27.61 23.14 15-19 19.655 28.854999999999997 27.615000000000002 23.875 20-24 19.52 29.360000000000003 27.42 23.7 25-29 20.22 28.749999999999996 27.6 23.43 30-34 19.46 28.625 27.58 24.335 35-39 20.255000000000003 28.71 27.005000000000003 24.03 40-44 19.18 28.96 27.92 23.94 45-49 19.77 27.735 28.065 24.43 50-54 19.645000000000003 28.910000000000004 27.045 24.4 55-59 19.650000000000002 28.865000000000002 27.389999999999997 24.095 60-64 20.369999999999997 28.225 27.450000000000003 23.955000000000002 65-69 20.14 28.585 26.889999999999997 24.385 70-74 19.865 28.715000000000003 27.79 23.630000000000003 75-79 20.0 28.1 28.199999999999996 23.7 80-84 19.99 28.09 27.57 24.349999999999998 85-89 20.085 28.065 27.04 24.81 90-94 20.21 28.355000000000004 27.025 24.41 95-99 20.75 27.985 27.76 23.505000000000003 100-104 20.385 28.360000000000003 27.715 23.54 105-109 20.31 28.035 27.395000000000003 24.26 110-114 20.805 27.73 28.01 23.455000000000002 115-119 20.745 27.91 27.13 24.215 120-124 20.36 27.665 27.865000000000002 24.11 125-129 20.724999999999998 27.860000000000003 27.485 23.93 130-134 20.34 28.26 27.35 24.05 135-139 20.39 27.71 27.994999999999997 23.905 140-144 20.49 28.175 27.775 23.56 145-149 20.925 27.515 27.555000000000003 24.005000000000003 150-151 20.8125 27.375 27.625 24.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 0.5 24 2.0 25 4.0 26 5.0 27 9.5 28 11.0 29 14.0 30 21.5 31 29.5 32 38.0 33 47.5 34 59.0 35 74.0 36 88.5 37 98.5 38 119.0 39 144.0 40 158.5 41 178.5 42 218.5 43 248.5 44 250.0 45 241.0 46 256.5 47 273.0 48 256.0 49 228.5 50 209.0 51 172.0 52 125.0 53 93.5 54 76.5 55 64.0 56 46.0 57 36.5 58 25.5 59 18.0 60 14.5 61 10.0 62 8.5 63 6.5 64 3.5 65 2.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51945988880064 89.25 2 5.056923484246757 9.55 3 0.4236166269526079 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.23750000000000002 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAA 10 0.006830828 145.0 3 CCCAATT 10 0.006830828 145.0 1 >>END_MODULE SRR12161439 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3335 37.0 37.0 37.0 37.0 37.0 2 35.9745 37.0 37.0 37.0 37.0 37.0 3 35.9625 37.0 37.0 37.0 37.0 37.0 4 36.0895 37.0 37.0 37.0 37.0 37.0 5 36.1555 37.0 37.0 37.0 37.0 37.0 6 36.1425 37.0 37.0 37.0 37.0 37.0 7 36.148 37.0 37.0 37.0 37.0 37.0 8 36.1805 37.0 37.0 37.0 37.0 37.0 9 36.251 37.0 37.0 37.0 37.0 37.0 10-14 36.240300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.211200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.163399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.114599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0754 37.0 37.0 37.0 37.0 37.0 35-39 36.1197 37.0 37.0 37.0 37.0 37.0 40-44 36.0768 37.0 37.0 37.0 37.0 37.0 45-49 35.9802 37.0 37.0 37.0 37.0 37.0 50-54 36.040800000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.963800000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9379 37.0 37.0 37.0 37.0 37.0 65-69 35.925399999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8903 37.0 37.0 37.0 37.0 37.0 75-79 35.87650000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.9169 37.0 37.0 37.0 37.0 37.0 85-89 35.8283 37.0 37.0 37.0 37.0 37.0 90-94 35.7915 37.0 37.0 37.0 37.0 37.0 95-99 35.803000000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8061 37.0 37.0 37.0 37.0 37.0 105-109 35.7602 37.0 37.0 37.0 37.0 37.0 110-114 35.737 37.0 37.0 37.0 37.0 37.0 115-119 35.6964 37.0 37.0 37.0 37.0 37.0 120-124 35.7042 37.0 37.0 37.0 37.0 37.0 125-129 35.5501 37.0 37.0 37.0 37.0 37.0 130-134 35.5727 37.0 37.0 37.0 37.0 37.0 135-139 35.5083 37.0 37.0 37.0 37.0 37.0 140-144 35.5021 37.0 37.0 37.0 37.0 37.0 145-149 35.5749 37.0 37.0 37.0 37.0 37.0 150-151 34.9945 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 5.0 21 4.0 22 6.0 23 9.0 24 7.0 25 9.0 26 3.0 27 10.0 28 15.0 29 18.0 30 22.0 31 40.0 32 61.0 33 99.0 34 189.0 35 542.0 36 2688.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.975 26.724999999999998 9.45 24.85 2 28.599999999999998 25.624999999999996 29.45 16.325 3 19.175 28.65 33.525 18.65 4 23.3 34.675 24.15 17.875 5 25.374999999999996 36.449999999999996 22.075 16.1 6 21.75 39.725 21.925 16.6 7 21.099999999999998 23.474999999999998 37.525 17.9 8 21.9 26.875 27.55 23.674999999999997 9 21.575 25.775 28.675 23.974999999999998 10-14 23.155 30.049999999999997 26.095000000000002 20.7 15-19 23.49 28.03 27.315 21.165 20-24 23.150000000000002 28.785 27.584999999999997 20.48 25-29 23.055 28.515 27.775 20.655 30-34 23.41 28.24 27.584999999999997 20.765 35-39 23.05 28.27 27.205000000000002 21.475 40-44 23.345 28.345 27.224999999999998 21.085 45-49 23.294999999999998 28.194999999999997 27.839999999999996 20.669999999999998 50-54 23.189999999999998 28.015 27.689999999999998 21.105 55-59 23.605 28.215 27.07 21.11 60-64 23.125 27.97 28.21 20.695 65-69 24.15 28.355000000000004 27.21 20.285 70-74 23.515 27.865000000000002 27.625 20.995 75-79 23.330000000000002 28.675 27.339999999999996 20.655 80-84 23.615 28.48 27.01 20.895 85-89 23.625 28.000000000000004 27.345000000000002 21.029999999999998 90-94 23.66 28.435 27.165 20.74 95-99 23.79 27.505000000000003 27.474999999999998 21.23 100-104 23.51 28.265 26.955000000000002 21.27 105-109 23.7 28.599999999999998 27.525 20.175 110-114 24.015 28.599999999999998 27.450000000000003 19.935 115-119 24.19 28.08 27.525 20.205000000000002 120-124 23.805 28.125 26.965 21.105 125-129 24.18 28.189999999999998 27.235 20.395 130-134 24.54 28.035 27.400000000000002 20.025000000000002 135-139 24.605 27.950000000000003 27.045 20.4 140-144 24.445 28.43 26.97 20.155 145-149 24.935 28.765 26.674999999999997 19.625 150-151 24.3125 28.4375 27.3 19.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.0 5 1.0 6 0.5 7 1.5 8 1.0 9 1.0 10 1.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 2.5 22 1.0 23 0.5 24 2.5 25 2.5 26 3.0 27 5.0 28 7.5 29 7.5 30 13.0 31 17.5 32 21.5 33 37.5 34 50.5 35 67.5 36 89.5 37 102.0 38 128.0 39 152.0 40 188.0 41 229.0 42 255.5 43 262.0 44 270.0 45 277.0 46 267.5 47 265.0 48 242.5 49 206.5 50 167.5 51 129.5 52 110.5 53 98.0 54 78.0 55 58.5 56 39.0 57 26.0 58 22.5 59 22.0 60 13.0 61 9.5 62 9.5 63 8.0 64 4.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.5 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.74101479915433 89.625 2 4.968287526427061 9.4 3 0.23784355179704017 0.675 4 0.026427061310782242 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026427061310782242 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATTT 10 0.006830828 145.0 3 AATAGGA 10 0.006830828 145.0 7 TTTTTTT 40 0.0076550315 18.125 85-89 >>END_MODULE Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686629 spots for SRR12161439.sra Written 686629 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra Read 686628 spots for SRR12161439.sra Written 686628 spots for SRR12161439.sra SRR ids: ['SRR12161439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rxnx5pfp SRR12161439.sra spots: 13732561 blocks: [[1, 686628], [686629, 1373256], [1373257, 2059884], [2059885, 2746512], [2746513, 3433140], [3433141, 4119768], [4119769, 4806396], [4806397, 5493024], [5493025, 6179652], [6179653, 6866280], [6866281, 7552908], [7552909, 8239536], [8239537, 8926164], [8926165, 9612792], [9612793, 10299420], [10299421, 10986048], [10986049, 11672676], [11672677, 12359304], [12359305, 13045932], [13045933, 13732561]] SRR12161439 file size 4645224 SRR12161439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161439 SRR12161439_1.fastq SRR12161439_2.fastq Input file: SRR12161439_1.fastq Paired file: SRR12161439_2.fastq trimmed: SRR12161439-trimmed-pair1.fastq, SRR12161439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:47:01 2025 >> started Thu Feb 13 23:47:16 2025 >> done (14.287s) 13732561 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 4507 ( 0.03%) empty read pairs filtered out after trimming by size control 13728041 (99.97%) read pairs available; of these: 660305 ( 4.81%) trimmed read pairs available after processing 13067736 (95.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 7 0.00% 26 8 0.00% 27 5 0.00% 28 6 0.00% 29 7 0.00% 30 3 0.00% 31 7 0.00% 32 6 0.00% 33 7 0.00% 34 5 0.00% 35 8 0.00% 36 8 0.00% 37 7 0.00% 38 14 0.00% 39 9 0.00% 40 6 0.00% 41 8 0.00% 42 8 0.00% 43 8 0.00% 44 4 0.00% 45 9 0.00% 46 16 0.00% 47 18 0.00% 48 14 0.00% 49 26 0.00% 50 22 0.00% 51 20 0.00% 52 23 0.00% 53 28 0.00% 54 25 0.00% 55 31 0.00% 56 27 0.00% 57 37 0.00% 58 35 0.00% 59 35 0.00% 60 38 0.00% 61 43 0.00% 62 59 0.00% 63 58 0.00% 64 66 0.00% 65 84 0.00% 66 82 0.00% 67 58 0.00% 68 98 0.00% 69 123 0.00% 70 133 0.00% 71 148 0.00% 72 156 0.00% 73 200 0.00% 74 203 0.00% 75 203 0.00% 76 264 0.00% 77 251 0.00% 78 301 0.00% 79 357 0.00% 80 440 0.00% 81 426 0.00% 82 538 0.00% 83 698 0.01% 84 626 0.00% 85 762 0.01% 86 857 0.01% 87 924 0.01% 88 974 0.01% 89 1067 0.01% 90 1167 0.01% 91 1382 0.01% 92 1502 0.01% 93 1663 0.01% 94 1851 0.01% 95 2035 0.01% 96 2195 0.02% 97 2343 0.02% 98 2456 0.02% 99 2680 0.02% 100 2841 0.02% 101 2983 0.02% 102 3377 0.02% 103 3665 0.03% 104 3947 0.03% 105 4354 0.03% 106 4674 0.03% 107 4678 0.03% 108 4945 0.04% 109 5282 0.04% 110 5544 0.04% 111 5898 0.04% 112 6176 0.04% 113 6482 0.05% 114 6918 0.05% 115 7174 0.05% 116 7719 0.06% 117 8138 0.06% 118 8377 0.06% 119 8742 0.06% 120 9281 0.07% 121 9712 0.07% 122 9667 0.07% 123 10298 0.08% 124 11018 0.08% 125 11435 0.08% 126 11961 0.09% 127 12319 0.09% 128 12905 0.09% 129 13255 0.10% 130 13867 0.10% 131 14048 0.10% 132 14732 0.11% 133 15145 0.11% 134 15929 0.12% 135 16198 0.12% 136 16896 0.12% 137 17314 0.13% 138 18002 0.13% 139 18782 0.14% 140 18968 0.14% 141 19732 0.14% 142 20355 0.15% 143 20818 0.15% 144 21599 0.16% 145 22304 0.16% 146 23146 0.17% 147 23626 0.17% 148 24436 0.18% 149 24973 0.18% 150 25627 0.19% 151 13067736 95.19% 13728041 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=64.60 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.9 sequence=AGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGCTAGTGG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=0.77 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=33.67 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161439 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:47:58 Started mapping on | Feb 13 23:47:58 Finished on | Feb 13 23:49:30 Mapping speed, Million of reads per hour | 537.18 Number of input reads | 13728041 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12879145 Uniquely mapped reads % | 93.82% Average mapped length | 298.89 Number of splices: Total | 13280667 Number of splices: Annotated (sjdb) | 13025688 Number of splices: GT/AG | 13010887 Number of splices: GC/AG | 227150 Number of splices: AT/AC | 10508 Number of splices: Non-canonical | 32122 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368605 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 97093 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480291 480291 480291 N_multimapping 368605 368605 368605 N_noFeature 377470 12733113 424030 N_ambiguous 191228 654 91345 UnstrandedReadsAssigned:12310447 PositiveStrandReadsAssigned:145378 NegativeStrandReadsAssigned:12363770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161439-trimmed-pair1.fastq SRR12161439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,728,041 reads, 12,533,448 reads pseudoaligned [quant] estimated average fragment length: 278.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR12161439.ke.tsv 34699 SRR12161439.se.tsv 87100 total ==> SRR12161439.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.37 469 18.2556 Potri.005G024800.1.v4.1 1035 757.368 571 51.0734 Potri.004G059700.1.v4.1 961 683.544 41 4.06334 Potri.007G009000.2.v4.1 1416 1138.37 0 0 Potri.003G141000.2.v4.1 2943 2665.37 314 7.98065 Potri.016G087400.1.v4.1 270 70.092 531.552 513.739 Potri.015G069301.1.v4.1 564 300.905 0 0 Potri.010G195200.1.v4.1 1773 1495.37 4 0.181208 Potri.012G127500.1.v4.1 977 699.472 676 65.4699 ==> SRR12161439.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 16 Potri.001G452600.v4.1 4 SRR12161439 completed mapping pipeline successfully