Starting /dee2/code/volunteer_pipeline.sh SRR12161440 current disk space = 3088879091712 free memory = 1421032576 SRR12161440 SRAfilesize 8ff542549a165b6957102074d8761455 SRR12161440.sra SRR12161440.sra file validated SRR12161440 is paired end SRR12161440 is conventional basespace SRR12161440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.593 37.0 37.0 37.0 37.0 37.0 2 36.546 37.0 37.0 37.0 37.0 37.0 3 36.56 37.0 37.0 37.0 37.0 37.0 4 36.5915 37.0 37.0 37.0 37.0 37.0 5 36.5835 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.497 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.583600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5319 37.0 37.0 37.0 37.0 37.0 20-24 36.5664 37.0 37.0 37.0 37.0 37.0 25-29 36.5045 37.0 37.0 37.0 37.0 37.0 30-34 36.5068 37.0 37.0 37.0 37.0 37.0 35-39 36.439800000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4677 37.0 37.0 37.0 37.0 37.0 45-49 36.4462 37.0 37.0 37.0 37.0 37.0 50-54 36.4236 37.0 37.0 37.0 37.0 37.0 55-59 36.382099999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.36070000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3661 37.0 37.0 37.0 37.0 37.0 70-74 36.366699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3387 37.0 37.0 37.0 37.0 37.0 80-84 36.3515 37.0 37.0 37.0 37.0 37.0 85-89 36.263200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.304899999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.246500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2809 37.0 37.0 37.0 37.0 37.0 105-109 36.1709 37.0 37.0 37.0 37.0 37.0 110-114 36.23309999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1794 37.0 37.0 37.0 37.0 37.0 120-124 36.1544 37.0 37.0 37.0 37.0 37.0 125-129 36.098699999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.0368 37.0 37.0 37.0 37.0 37.0 135-139 36.0494 37.0 37.0 37.0 37.0 37.0 140-144 36.0272 37.0 37.0 37.0 37.0 37.0 145-149 36.0036 37.0 37.0 37.0 37.0 37.0 150-151 35.814 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 6.0 27 3.0 28 11.0 29 19.0 30 27.0 31 41.0 32 44.0 33 65.0 34 95.0 35 241.0 36 2989.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.27063531765883 11.805902951475739 6.003001500750376 40.920460230115054 2 19.3 12.049999999999999 35.175 33.475 3 16.25 17.275 27.55 38.925 4 20.625 25.0 24.325 30.049999999999997 5 22.900000000000002 30.025000000000002 24.7 22.375 6 20.5 34.9 22.925 21.675 7 16.150000000000002 26.625 40.0 17.224999999999998 8 16.85 28.15 31.3 23.7 9 17.599999999999998 23.599999999999998 34.849999999999994 23.95 10-14 19.475 29.68 27.595 23.25 15-19 20.24 27.715 28.470000000000002 23.575 20-24 19.89 27.88 27.884999999999998 24.345 25-29 20.39 28.12 27.775 23.715 30-34 19.025 28.749999999999996 27.235 24.990000000000002 35-39 19.72 28.08 27.685 24.515 40-44 19.91 29.035 26.950000000000003 24.104999999999997 45-49 20.145 28.43 27.565 23.86 50-54 19.78 28.375 27.87 23.974999999999998 55-59 20.685000000000002 28.63 26.810000000000002 23.875 60-64 20.155 27.85 27.61 24.385 65-69 19.865 27.485 27.994999999999997 24.654999999999998 70-74 19.865 28.360000000000003 28.055000000000003 23.72 75-79 19.905 27.805000000000003 27.67 24.62 80-84 19.805 27.894999999999996 27.445000000000004 24.855 85-89 20.575 28.835 27.169999999999998 23.419999999999998 90-94 20.21 28.24 26.729999999999997 24.82 95-99 20.845 27.465 27.665 24.025 100-104 20.294999999999998 28.405 27.474999999999998 23.825 105-109 20.21 27.805000000000003 27.76 24.224999999999998 110-114 20.880000000000003 27.715 27.589999999999996 23.815 115-119 20.544999999999998 28.34 27.21 23.905 120-124 20.330000000000002 27.589999999999996 27.255000000000003 24.825 125-129 20.91 27.51 27.67 23.91 130-134 21.025 27.26 28.04 23.674999999999997 135-139 21.16 28.044999999999998 27.284999999999997 23.51 140-144 20.87 28.134999999999998 27.67 23.325000000000003 145-149 20.65 28.165000000000003 27.435 23.75 150-151 21.0375 27.462500000000002 27.487499999999997 24.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 3.0 25 4.5 26 4.5 27 7.5 28 13.0 29 13.0 30 15.5 31 20.5 32 34.5 33 46.5 34 50.5 35 58.5 36 72.5 37 93.0 38 121.5 39 153.0 40 174.0 41 197.0 42 220.0 43 233.5 44 253.0 45 260.5 46 252.5 47 246.5 48 237.0 49 235.0 50 212.0 51 172.0 52 136.0 53 105.5 54 85.5 55 71.5 56 53.5 57 36.0 58 29.0 59 25.5 60 17.0 61 7.5 62 7.5 63 7.0 64 4.5 65 1.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68815191227601 87.575 2 5.8036908264241776 10.85 3 0.4546670232682536 1.275 4 0.02674511901577962 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02674511901577962 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCA 10 0.006830828 145.0 9 GGCGTTT 10 0.006830828 145.0 1 GTTTCTC 10 0.006830828 145.0 4 AACTTTT 10 0.006830828 145.0 7 CATGGCG 10 0.006830828 145.0 145 CAGAACT 10 0.006830828 145.0 4 CTTCCAG 10 0.006830828 145.0 5 >>END_MODULE SRR12161440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.371 37.0 37.0 37.0 37.0 37.0 2 36.0975 37.0 37.0 37.0 37.0 37.0 3 36.1325 37.0 37.0 37.0 37.0 37.0 4 36.099 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.2445 37.0 37.0 37.0 37.0 37.0 7 36.122 37.0 37.0 37.0 37.0 37.0 8 36.235 37.0 37.0 37.0 37.0 37.0 9 36.204 37.0 37.0 37.0 37.0 37.0 10-14 36.3024 37.0 37.0 37.0 37.0 37.0 15-19 36.256099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2199 37.0 37.0 37.0 37.0 37.0 25-29 36.1885 37.0 37.0 37.0 37.0 37.0 30-34 36.1695 37.0 37.0 37.0 37.0 37.0 35-39 36.0983 37.0 37.0 37.0 37.0 37.0 40-44 36.1326 37.0 37.0 37.0 37.0 37.0 45-49 36.0586 37.0 37.0 37.0 37.0 37.0 50-54 36.1109 37.0 37.0 37.0 37.0 37.0 55-59 36.0049 37.0 37.0 37.0 37.0 37.0 60-64 35.972 37.0 37.0 37.0 37.0 37.0 65-69 36.0195 37.0 37.0 37.0 37.0 37.0 70-74 35.9319 37.0 37.0 37.0 37.0 37.0 75-79 35.9062 37.0 37.0 37.0 37.0 37.0 80-84 35.919599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8976 37.0 37.0 37.0 37.0 37.0 90-94 35.843900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.824200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8327 37.0 37.0 37.0 37.0 37.0 105-109 35.820299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.78679999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.806799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7561 37.0 37.0 37.0 37.0 37.0 125-129 35.683099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5853 37.0 37.0 37.0 37.0 37.0 135-139 35.6631 37.0 37.0 37.0 37.0 37.0 140-144 35.562400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.566700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.1595 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 2.0 16 1.0 17 2.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.0 24 11.0 25 9.0 26 10.0 27 7.0 28 11.0 29 18.0 30 19.0 31 37.0 32 60.0 33 85.0 34 216.0 35 545.0 36 2686.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 24.6 8.85 26.75 2 27.474999999999998 27.325 28.999999999999996 16.2 3 19.950000000000003 28.7 31.775 19.575 4 24.2 33.7 22.625 19.475 5 24.55 36.375 22.625 16.45 6 19.25 38.775 22.650000000000002 19.325 7 19.5 23.25 38.875 18.375 8 21.175 26.275 28.175 24.375 9 20.05 25.05 30.049999999999997 24.85 10-14 23.01 29.244999999999997 26.200000000000003 21.545 15-19 22.515 28.395 27.675 21.415 20-24 22.645 28.615000000000002 27.169999999999998 21.57 25-29 23.200000000000003 28.375 26.825 21.6 30-34 22.86 28.215 27.38 21.545 35-39 22.869999999999997 27.77 28.18 21.18 40-44 23.595 27.865000000000002 27.48 21.060000000000002 45-49 22.884999999999998 28.18 28.04 20.895 50-54 22.98 27.765 28.33 20.925 55-59 23.825 27.255000000000003 27.515 21.404999999999998 60-64 22.79 27.639999999999997 27.595 21.975 65-69 23.655 27.189999999999998 27.650000000000002 21.505 70-74 23.68 27.125 27.975 21.22 75-79 23.18 27.175 27.43 22.215 80-84 23.44 28.444999999999997 26.82 21.295 85-89 23.06 27.61 27.275 22.055 90-94 23.24 27.73 27.41 21.62 95-99 23.56 27.845 26.669999999999998 21.925 100-104 24.075 27.72 27.525 20.68 105-109 23.21 28.22 27.655 20.915 110-114 24.22 27.134999999999998 27.334999999999997 21.310000000000002 115-119 23.599999999999998 27.595 27.72 21.085 120-124 24.54 27.750000000000004 27.694999999999997 20.015 125-129 23.78 28.105000000000004 27.275 20.84 130-134 24.765 27.77 27.134999999999998 20.330000000000002 135-139 24.27 26.86 27.884999999999998 20.985 140-144 24.05 27.305 28.110000000000003 20.535 145-149 24.095 27.529999999999998 27.61 20.765 150-151 24.3625 28.237499999999997 27.0125 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 2.5 23 4.0 24 3.5 25 3.0 26 4.0 27 4.5 28 6.5 29 9.5 30 15.0 31 15.5 32 20.5 33 34.5 34 43.5 35 55.5 36 82.0 37 115.0 38 138.0 39 153.0 40 179.5 41 211.0 42 233.5 43 265.0 44 265.5 45 256.0 46 254.5 47 257.0 48 243.5 49 202.0 50 169.0 51 145.5 52 130.0 53 101.5 54 87.0 55 75.5 56 47.5 57 34.5 58 33.0 59 25.0 60 18.0 61 13.5 62 9.0 63 7.5 64 4.5 65 1.0 66 0.5 67 0.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.71643394199786 87.25 2 5.531686358754028 10.299999999999999 3 0.5639097744360901 1.575 4 0.10741138560687433 0.4 5 0.0 0.0 6 0.05370569280343716 0.3 7 0.02685284640171858 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATAT 7 0.17500000000000002 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.5499999999999998 0.0 0.0 0.0 0.0 136-137 1.75 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCAGG 10 0.006830828 145.0 6 CAGGTCA 10 0.006830828 145.0 9 CCAGGTC 10 0.006830828 145.0 8 ACCAGGT 10 0.006830828 145.0 7 >>END_MODULE Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra Read 767886 spots for SRR12161440.sra Written 767886 spots for SRR12161440.sra Read 767883 spots for SRR12161440.sra Written 767883 spots for SRR12161440.sra SRR ids: ['SRR12161440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2r3l7j9s SRR12161440.sra spots: 15357663 blocks: [[1, 767883], [767884, 1535766], [1535767, 2303649], [2303650, 3071532], [3071533, 3839415], [3839416, 4607298], [4607299, 5375181], [5375182, 6143064], [6143065, 6910947], [6910948, 7678830], [7678831, 8446713], [8446714, 9214596], [9214597, 9982479], [9982480, 10750362], [10750363, 11518245], [11518246, 12286128], [12286129, 13054011], [13054012, 13821894], [13821895, 14589777], [14589778, 15357663]] SRR12161440 file size 5197505 SRR12161440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161440 SRR12161440_1.fastq SRR12161440_2.fastq Input file: SRR12161440_1.fastq Paired file: SRR12161440_2.fastq trimmed: SRR12161440-trimmed-pair1.fastq, SRR12161440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:50:08 2025 >> started Thu Feb 13 16:50:26 2025 >> done (17.705s) 15357663 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1238 ( 0.01%) empty read pairs filtered out after trimming by size control 15356402 (99.99%) read pairs available; of these: 460997 ( 3.00%) trimmed read pairs available after processing 14895405 (97.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 7 0.00% 21 3 0.00% 22 1 0.00% 23 8 0.00% 24 7 0.00% 25 5 0.00% 26 12 0.00% 27 7 0.00% 28 11 0.00% 29 9 0.00% 30 6 0.00% 31 2 0.00% 32 6 0.00% 33 6 0.00% 34 8 0.00% 35 8 0.00% 36 6 0.00% 37 7 0.00% 38 11 0.00% 39 4 0.00% 40 12 0.00% 41 10 0.00% 42 7 0.00% 43 9 0.00% 44 10 0.00% 45 7 0.00% 46 13 0.00% 47 22 0.00% 48 13 0.00% 49 15 0.00% 50 22 0.00% 51 15 0.00% 52 26 0.00% 53 21 0.00% 54 15 0.00% 55 19 0.00% 56 28 0.00% 57 26 0.00% 58 27 0.00% 59 41 0.00% 60 29 0.00% 61 35 0.00% 62 33 0.00% 63 39 0.00% 64 37 0.00% 65 41 0.00% 66 43 0.00% 67 58 0.00% 68 72 0.00% 69 75 0.00% 70 83 0.00% 71 90 0.00% 72 85 0.00% 73 114 0.00% 74 109 0.00% 75 144 0.00% 76 151 0.00% 77 162 0.00% 78 208 0.00% 79 208 0.00% 80 246 0.00% 81 240 0.00% 82 274 0.00% 83 328 0.00% 84 347 0.00% 85 418 0.00% 86 471 0.00% 87 515 0.00% 88 540 0.00% 89 589 0.00% 90 701 0.00% 91 772 0.01% 92 819 0.01% 93 862 0.01% 94 1004 0.01% 95 1157 0.01% 96 1231 0.01% 97 1296 0.01% 98 1456 0.01% 99 1505 0.01% 100 1674 0.01% 101 1890 0.01% 102 2072 0.01% 103 2188 0.01% 104 2218 0.01% 105 2476 0.02% 106 2687 0.02% 107 2742 0.02% 108 3165 0.02% 109 3273 0.02% 110 3439 0.02% 111 3580 0.02% 112 3955 0.03% 113 4029 0.03% 114 4479 0.03% 115 4728 0.03% 116 4991 0.03% 117 5218 0.03% 118 5481 0.04% 119 5673 0.04% 120 5952 0.04% 121 6294 0.04% 122 6606 0.04% 123 7002 0.05% 124 7464 0.05% 125 7562 0.05% 126 8053 0.05% 127 8424 0.05% 128 9020 0.06% 129 8908 0.06% 130 9406 0.06% 131 9698 0.06% 132 10237 0.07% 133 10748 0.07% 134 11211 0.07% 135 11642 0.08% 136 11967 0.08% 137 12406 0.08% 138 12767 0.08% 139 13712 0.09% 140 14101 0.09% 141 14628 0.10% 142 14779 0.10% 143 15756 0.10% 144 16118 0.10% 145 16937 0.11% 146 17250 0.11% 147 17835 0.12% 148 18539 0.12% 149 19285 0.13% 150 19650 0.13% 151 14895405 97.00% 15356402 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.86 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=64.30 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=19 prefix-density=1.04 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=29.92 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=6.2 sequence=AAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR12161440 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:51:09 Started mapping on | Feb 13 16:51:09 Finished on | Feb 13 16:52:59 Mapping speed, Million of reads per hour | 502.57 Number of input reads | 15356402 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14393670 Uniquely mapped reads % | 93.73% Average mapped length | 299.75 Number of splices: Total | 14865805 Number of splices: Annotated (sjdb) | 14598876 Number of splices: GT/AG | 14559018 Number of splices: GC/AG | 262548 Number of splices: AT/AC | 10302 Number of splices: Non-canonical | 33937 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406246 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 124861 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 556486 556486 556486 N_multimapping 406246 406246 406246 N_noFeature 428966 14238517 472232 N_ambiguous 208337 828 95892 UnstrandedReadsAssigned:13756367 PositiveStrandReadsAssigned:154325 NegativeStrandReadsAssigned:13825546 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161440-trimmed-pair1.fastq SRR12161440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,356,402 reads, 13,951,305 reads pseudoaligned [quant] estimated average fragment length: 283.416 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12161440.ke.tsv 34699 SRR12161440.se.tsv 87100 total ==> SRR12161440.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.58 391 14.0128 Potri.005G024800.1.v4.1 1035 752.584 225 18.5961 Potri.004G059700.1.v4.1 961 678.698 31 2.84106 Potri.007G009000.2.v4.1 1416 1133.58 0 0 Potri.003G141000.2.v4.1 2943 2660.58 441 10.3099 Potri.016G087400.1.v4.1 270 62.8386 921 911.65 Potri.015G069301.1.v4.1 564 293.889 0 0 Potri.010G195200.1.v4.1 1773 1490.58 4 0.166916 Potri.012G127500.1.v4.1 977 694.647 487 43.6073 ==> SRR12161440.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 121 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161440 completed mapping pipeline successfully