Starting /dee2/code/volunteer_pipeline.sh SRR12161441 current disk space = 3088673419264 free memory = 1446191536 SRR12161441 SRAfilesize 10c0a4de9951f1ec520ca4cd728835a4 SRR12161441.sra SRR12161441.sra file validated SRR12161441 is paired end SRR12161441 is conventional basespace SRR12161441 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5635 37.0 37.0 37.0 37.0 37.0 2 36.4945 37.0 37.0 37.0 37.0 37.0 3 36.576 37.0 37.0 37.0 37.0 37.0 4 36.5935 37.0 37.0 37.0 37.0 37.0 5 36.564 37.0 37.0 37.0 37.0 37.0 6 36.597 37.0 37.0 37.0 37.0 37.0 7 36.4955 37.0 37.0 37.0 37.0 37.0 8 36.5875 37.0 37.0 37.0 37.0 37.0 9 36.5345 37.0 37.0 37.0 37.0 37.0 10-14 36.575100000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5544 37.0 37.0 37.0 37.0 37.0 20-24 36.4856 37.0 37.0 37.0 37.0 37.0 25-29 36.433 37.0 37.0 37.0 37.0 37.0 30-34 36.44279999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.41179999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4039 37.0 37.0 37.0 37.0 37.0 45-49 36.387699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.338800000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.36959999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3146 37.0 37.0 37.0 37.0 37.0 65-69 36.355900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.378699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3004 37.0 37.0 37.0 37.0 37.0 80-84 36.283500000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2453 37.0 37.0 37.0 37.0 37.0 90-94 36.264700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1813 37.0 37.0 37.0 37.0 37.0 100-104 36.1899 37.0 37.0 37.0 37.0 37.0 105-109 36.1554 37.0 37.0 37.0 37.0 37.0 110-114 36.2113 37.0 37.0 37.0 37.0 37.0 115-119 36.1586 37.0 37.0 37.0 37.0 37.0 120-124 36.0752 37.0 37.0 37.0 37.0 37.0 125-129 36.0945 37.0 37.0 37.0 37.0 37.0 130-134 36.072199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.935 37.0 37.0 37.0 37.0 37.0 140-144 35.871900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.865700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.67475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 5.0 27 7.0 28 10.0 29 19.0 30 24.0 31 34.0 32 53.0 33 82.0 34 110.0 35 312.0 36 2907.0 37 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.31531531531532 12.412412412412413 6.556556556556556 40.71571571571572 2 18.625 12.875 36.55 31.95 3 15.875 17.175 27.35 39.6 4 20.974999999999998 24.8 24.075 30.15 5 22.5 31.0 24.575 21.925 6 19.375 35.075 23.3 22.25 7 15.9 27.575 39.525 17.0 8 17.849999999999998 27.325 31.2 23.625 9 17.299999999999997 25.650000000000002 34.125 22.925 10-14 19.495 29.585 27.615000000000002 23.305 15-19 19.895 27.82 28.37 23.915 20-24 20.19 28.42 27.755000000000003 23.635 25-29 19.5 28.4 28.360000000000003 23.74 30-34 19.54 29.48 26.840000000000003 24.14 35-39 19.985 28.615000000000002 27.839999999999996 23.56 40-44 19.08 29.075 27.55 24.295 45-49 20.349999999999998 28.455000000000002 27.82 23.375 50-54 20.085 28.470000000000002 27.47 23.974999999999998 55-59 20.555 28.285 27.26 23.9 60-64 20.105 28.585 27.52 23.79 65-69 20.015 28.285 27.205000000000002 24.495 70-74 20.205000000000002 28.549999999999997 26.935 24.310000000000002 75-79 20.325 28.050000000000004 27.939999999999998 23.685000000000002 80-84 20.979999999999997 27.85 27.279999999999998 23.89 85-89 20.669999999999998 27.955000000000002 27.534999999999997 23.84 90-94 20.49 27.725 27.575 24.21 95-99 20.45 28.53 27.48 23.54 100-104 20.61 29.265 27.11 23.015 105-109 19.975 27.765 28.194999999999997 24.065 110-114 20.51 28.294999999999998 27.139999999999997 24.055 115-119 20.585 28.165000000000003 27.465 23.785 120-124 20.294999999999998 28.285 26.900000000000002 24.52 125-129 20.59 28.17 27.534999999999997 23.705000000000002 130-134 20.855 27.889999999999997 27.72 23.535 135-139 20.445 27.694999999999997 27.155 24.705 140-144 21.82 27.705000000000002 27.075 23.400000000000002 145-149 20.565 28.549999999999997 26.525 24.36 150-151 21.275 27.700000000000003 27.0 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 1.0 24 2.5 25 4.0 26 6.0 27 7.0 28 7.5 29 14.0 30 14.5 31 23.0 32 33.0 33 38.5 34 53.0 35 72.5 36 81.0 37 93.0 38 132.5 39 161.0 40 172.0 41 195.5 42 229.0 43 264.5 44 273.0 45 258.0 46 255.0 47 254.0 48 243.0 49 219.0 50 184.0 51 152.0 52 127.5 53 103.0 54 76.0 55 64.0 56 52.5 57 32.5 58 27.0 59 19.5 60 13.5 61 11.5 62 8.0 63 4.5 64 1.0 65 1.5 66 2.5 67 2.0 68 1.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10139583882012 90.275 2 4.582565183039241 8.7 3 0.26336581511719775 0.75 4 0.0 0.0 5 0.02633658151171978 0.125 6 0.02633658151171978 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 6 0.15 No Hit CTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.300000000000001 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACATC 10 0.006830828 145.0 6 GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR12161441 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4365 37.0 37.0 37.0 37.0 37.0 2 36.1305 37.0 37.0 37.0 37.0 37.0 3 36.2275 37.0 37.0 37.0 37.0 37.0 4 36.1955 37.0 37.0 37.0 37.0 37.0 5 36.3055 37.0 37.0 37.0 37.0 37.0 6 36.2695 37.0 37.0 37.0 37.0 37.0 7 36.1315 37.0 37.0 37.0 37.0 37.0 8 36.402 37.0 37.0 37.0 37.0 37.0 9 36.335 37.0 37.0 37.0 37.0 37.0 10-14 36.354699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2799 37.0 37.0 37.0 37.0 37.0 20-24 36.2768 37.0 37.0 37.0 37.0 37.0 25-29 36.24849999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2072 37.0 37.0 37.0 37.0 37.0 35-39 36.2007 37.0 37.0 37.0 37.0 37.0 40-44 36.1939 37.0 37.0 37.0 37.0 37.0 45-49 36.1699 37.0 37.0 37.0 37.0 37.0 50-54 36.1699 37.0 37.0 37.0 37.0 37.0 55-59 36.153200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1365 37.0 37.0 37.0 37.0 37.0 65-69 36.111599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0033 37.0 37.0 37.0 37.0 37.0 75-79 35.9957 37.0 37.0 37.0 37.0 37.0 80-84 36.0478 37.0 37.0 37.0 37.0 37.0 85-89 36.0005 37.0 37.0 37.0 37.0 37.0 90-94 35.9163 37.0 37.0 37.0 37.0 37.0 95-99 35.9823 37.0 37.0 37.0 37.0 37.0 100-104 35.9513 37.0 37.0 37.0 37.0 37.0 105-109 35.9279 37.0 37.0 37.0 37.0 37.0 110-114 35.857000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.887800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.908 37.0 37.0 37.0 37.0 37.0 125-129 35.7392 37.0 37.0 37.0 37.0 37.0 130-134 35.6839 37.0 37.0 37.0 37.0 37.0 135-139 35.6928 37.0 37.0 37.0 37.0 37.0 140-144 35.577299999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.6566 37.0 37.0 37.0 37.0 37.0 150-151 34.94725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 0.0 21 4.0 22 3.0 23 3.0 24 3.0 25 12.0 26 5.0 27 8.0 28 12.0 29 11.0 30 18.0 31 48.0 32 51.0 33 87.0 34 163.0 35 482.0 36 2744.0 37 334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 25.2 9.9 27.6 2 28.249999999999996 26.400000000000002 27.800000000000004 17.549999999999997 3 19.325 28.425 31.3 20.95 4 22.325 35.05 24.45 18.175 5 24.875 36.525 22.075 16.525000000000002 6 21.125 38.5 23.425 16.950000000000003 7 20.974999999999998 21.9 38.025 19.1 8 21.425 27.025 28.449999999999996 23.1 9 21.875 25.374999999999996 29.525000000000002 23.225 10-14 23.07 29.17 26.590000000000003 21.17 15-19 22.645 28.95 27.16 21.245 20-24 22.689999999999998 28.794999999999998 27.465 21.05 25-29 23.085 28.27 27.87 20.775 30-34 23.355 28.365000000000002 28.144999999999996 20.135 35-39 23.365 28.27 27.175 21.19 40-44 23.525 27.389999999999997 28.07 21.015 45-49 22.675 28.505000000000003 27.925 20.895 50-54 23.375 28.294999999999998 27.435 20.895 55-59 23.75 27.485 28.084999999999997 20.68 60-64 23.05 27.715 28.185 21.05 65-69 23.9 27.955000000000002 27.515 20.630000000000003 70-74 23.5 27.334999999999997 27.705000000000002 21.46 75-79 23.64 27.76 27.115000000000002 21.485000000000003 80-84 23.76 26.995 27.805000000000003 21.44 85-89 23.855 28.044999999999998 27.325 20.775 90-94 23.635 27.785 27.125 21.455 95-99 24.310000000000002 27.605 27.43 20.655 100-104 23.945 27.785 27.365000000000002 20.905 105-109 23.965 28.275 27.334999999999997 20.424999999999997 110-114 24.099999999999998 27.860000000000003 27.67 20.369999999999997 115-119 24.365000000000002 27.500000000000004 27.685 20.45 120-124 24.36 28.285 27.3 20.055 125-129 24.365000000000002 27.944999999999997 26.895000000000003 20.794999999999998 130-134 24.67 27.689999999999998 27.284999999999997 20.355 135-139 24.855 28.1 26.895000000000003 20.150000000000002 140-144 25.474999999999998 27.42 27.205000000000002 19.900000000000002 145-149 25.055 28.110000000000003 26.66 20.175 150-151 24.8125 28.762500000000003 26.724999999999998 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 4.0 27 6.0 28 5.5 29 8.0 30 15.0 31 21.0 32 25.5 33 32.5 34 44.0 35 57.5 36 89.5 37 119.0 38 131.0 39 148.5 40 188.5 41 222.0 42 237.5 43 269.5 44 297.0 45 275.0 46 253.0 47 256.0 48 232.0 49 199.5 50 176.0 51 143.5 52 110.5 53 92.0 54 82.5 55 65.0 56 43.0 57 36.0 58 26.0 59 19.5 60 16.0 61 9.0 62 7.5 63 6.0 64 4.5 65 2.5 66 2.0 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.75357710651828 89.4 2 4.7429782723900376 8.95 3 0.3444621091679915 0.975 4 0.10598834128245893 0.4 5 0.026497085320614733 0.125 6 0.026497085320614733 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAAGCAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAAT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.300000000000001 0.0 0.0 0.0 0.0 138-139 5.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACAC 10 0.006830828 145.0 1 TTGCTGG 10 0.006830828 145.0 9 >>END_MODULE Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666453 spots for SRR12161441.sra Written 666453 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra Read 666446 spots for SRR12161441.sra Written 666446 spots for SRR12161441.sra SRR ids: ['SRR12161441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twget_ps SRR12161441.sra spots: 13328927 blocks: [[1, 666446], [666447, 1332892], [1332893, 1999338], [1999339, 2665784], [2665785, 3332230], [3332231, 3998676], [3998677, 4665122], [4665123, 5331568], [5331569, 5998014], [5998015, 6664460], [6664461, 7330906], [7330907, 7997352], [7997353, 8663798], [8663799, 9330244], [9330245, 9996690], [9996691, 10663136], [10663137, 11329582], [11329583, 11996028], [11996029, 12662474], [12662475, 13328927]] SRR12161441 file size 4508052 SRR12161441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161441 SRR12161441_1.fastq SRR12161441_2.fastq Input file: SRR12161441_1.fastq Paired file: SRR12161441_2.fastq trimmed: SRR12161441-trimmed-pair1.fastq, SRR12161441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:11:14 2025 >> started Thu Feb 13 17:11:29 2025 >> done (14.343s) 13328927 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 2417 ( 0.02%) empty read pairs filtered out after trimming by size control 13326495 (99.98%) read pairs available; of these: 1181853 ( 8.87%) trimmed read pairs available after processing 12144642 (91.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 5 0.00% 26 5 0.00% 27 5 0.00% 28 7 0.00% 29 1 0.00% 30 6 0.00% 31 8 0.00% 32 5 0.00% 33 5 0.00% 34 10 0.00% 35 12 0.00% 36 6 0.00% 37 7 0.00% 38 15 0.00% 39 11 0.00% 40 19 0.00% 41 12 0.00% 42 13 0.00% 43 12 0.00% 44 5 0.00% 45 13 0.00% 46 11 0.00% 47 23 0.00% 48 28 0.00% 49 39 0.00% 50 33 0.00% 51 28 0.00% 52 44 0.00% 53 44 0.00% 54 44 0.00% 55 43 0.00% 56 49 0.00% 57 58 0.00% 58 63 0.00% 59 71 0.00% 60 105 0.00% 61 81 0.00% 62 98 0.00% 63 129 0.00% 64 159 0.00% 65 136 0.00% 66 184 0.00% 67 171 0.00% 68 226 0.00% 69 249 0.00% 70 272 0.00% 71 325 0.00% 72 407 0.00% 73 421 0.00% 74 477 0.00% 75 563 0.00% 76 576 0.00% 77 635 0.00% 78 793 0.01% 79 848 0.01% 80 954 0.01% 81 1103 0.01% 82 1287 0.01% 83 1336 0.01% 84 1536 0.01% 85 1742 0.01% 86 1905 0.01% 87 2072 0.02% 88 2419 0.02% 89 2514 0.02% 90 2748 0.02% 91 3188 0.02% 92 3521 0.03% 93 4006 0.03% 94 4195 0.03% 95 4675 0.04% 96 5047 0.04% 97 5402 0.04% 98 5919 0.04% 99 6246 0.05% 100 6597 0.05% 101 7008 0.05% 102 7613 0.06% 103 8213 0.06% 104 8661 0.06% 105 9291 0.07% 106 9920 0.07% 107 10682 0.08% 108 10687 0.08% 109 11392 0.09% 110 11706 0.09% 111 12344 0.09% 112 13229 0.10% 113 13626 0.10% 114 14354 0.11% 115 15037 0.11% 116 16029 0.12% 117 16520 0.12% 118 16980 0.13% 119 17516 0.13% 120 18441 0.14% 121 18956 0.14% 122 19348 0.15% 123 20234 0.15% 124 20979 0.16% 125 21593 0.16% 126 22533 0.17% 127 23014 0.17% 128 23896 0.18% 129 23873 0.18% 130 25094 0.19% 131 25395 0.19% 132 26128 0.20% 133 26590 0.20% 134 27437 0.21% 135 28001 0.21% 136 28760 0.22% 137 29454 0.22% 138 29936 0.22% 139 31309 0.23% 140 31274 0.23% 141 32364 0.24% 142 32947 0.25% 143 33187 0.25% 144 34494 0.26% 145 34927 0.26% 146 35629 0.27% 147 36097 0.27% 148 37104 0.28% 149 37185 0.28% 150 38826 0.29% 151 12144642 91.13% 13326495 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=29.85 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.3 sequence=CATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTTGC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=16.19 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.0 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12161441 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:12:12 Started mapping on | Feb 13 17:12:12 Finished on | Feb 13 17:13:38 Mapping speed, Million of reads per hour | 557.85 Number of input reads | 13326495 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12466859 Uniquely mapped reads % | 93.55% Average mapped length | 296.88 Number of splices: Total | 12755238 Number of splices: Annotated (sjdb) | 12474655 Number of splices: GT/AG | 12491867 Number of splices: GC/AG | 216131 Number of splices: AT/AC | 10304 Number of splices: Non-canonical | 36936 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346183 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 119523 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513453 513453 513453 N_multimapping 346183 346183 346183 N_noFeature 428880 12286285 480243 N_ambiguous 211671 685 82035 UnstrandedReadsAssigned:11826308 PositiveStrandReadsAssigned:179889 NegativeStrandReadsAssigned:11904581 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161441-trimmed-pair1.fastq SRR12161441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,326,495 reads, 12,061,956 reads pseudoaligned [quant] estimated average fragment length: 255.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12161441.ke.tsv 34699 SRR12161441.se.tsv 87100 total ==> SRR12161441.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.57 348 12.881 Potri.005G024800.1.v4.1 1035 780.571 443 37.0472 Potri.004G059700.1.v4.1 961 706.681 23 2.12456 Potri.007G009000.2.v4.1 1416 1161.57 0 0 Potri.003G141000.2.v4.1 2943 2688.57 367 8.91063 Potri.016G087400.1.v4.1 270 79.3204 677.661 557.688 Potri.015G069301.1.v4.1 564 319.827 0 0 Potri.010G195200.1.v4.1 1773 1518.57 18 0.773751 Potri.012G127500.1.v4.1 977 722.637 268 24.2091 ==> SRR12161441.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 404 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR12161441 completed mapping pipeline successfully