Starting /dee2/code/volunteer_pipeline.sh SRR12161442 current disk space = 3088662142976 free memory = 1433250580 SRR12161442 SRAfilesize b143b491e0939d3cd8ac78d0f3aa0e5f SRR12161442.sra SRR12161442.sra file validated SRR12161442 is paired end SRR12161442 is conventional basespace SRR12161442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.58675 37.0 37.0 37.0 37.0 37.0 2 36.352 37.0 37.0 37.0 37.0 37.0 3 36.508 37.0 37.0 37.0 37.0 37.0 4 36.584 37.0 37.0 37.0 37.0 37.0 5 36.6085 37.0 37.0 37.0 37.0 37.0 6 36.5545 37.0 37.0 37.0 37.0 37.0 7 36.576 37.0 37.0 37.0 37.0 37.0 8 36.486 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.606700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5656 37.0 37.0 37.0 37.0 37.0 20-24 36.5233 37.0 37.0 37.0 37.0 37.0 25-29 36.4979 37.0 37.0 37.0 37.0 37.0 30-34 36.5062 37.0 37.0 37.0 37.0 37.0 35-39 36.4854 37.0 37.0 37.0 37.0 37.0 40-44 36.468599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4566 37.0 37.0 37.0 37.0 37.0 50-54 36.418600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4034 37.0 37.0 37.0 37.0 37.0 60-64 36.4212 37.0 37.0 37.0 37.0 37.0 65-69 36.3402 37.0 37.0 37.0 37.0 37.0 70-74 36.3832 37.0 37.0 37.0 37.0 37.0 75-79 36.3306 37.0 37.0 37.0 37.0 37.0 80-84 36.340999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.3049 37.0 37.0 37.0 37.0 37.0 90-94 36.3362 37.0 37.0 37.0 37.0 37.0 95-99 36.26090000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.276799999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1706 37.0 37.0 37.0 37.0 37.0 110-114 36.2402 37.0 37.0 37.0 37.0 37.0 115-119 36.1778 37.0 37.0 37.0 37.0 37.0 120-124 36.1772 37.0 37.0 37.0 37.0 37.0 125-129 36.1054 37.0 37.0 37.0 37.0 37.0 130-134 36.1038 37.0 37.0 37.0 37.0 37.0 135-139 36.03580000000001 37.0 37.0 37.0 37.0 37.0 140-144 36.0403 37.0 37.0 37.0 37.0 37.0 145-149 35.966300000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.673249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 2.0 27 1.0 28 12.0 29 18.0 30 17.0 31 36.0 32 46.0 33 65.0 34 119.0 35 275.0 36 3021.0 37 385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.96074018504626 11.602900725181295 5.87646911727932 39.559889972493124 2 19.475 13.5 35.0 32.025 3 15.45 18.125 28.225 38.2 4 21.575 26.55 24.025 27.85 5 23.65 31.775 23.775 20.8 6 19.775000000000002 34.325 24.099999999999998 21.8 7 15.85 24.375 42.65 17.125 8 17.675 25.4 31.924999999999997 25.0 9 16.2 25.1 35.325 23.375 10-14 20.23 29.459999999999997 27.68 22.63 15-19 19.81 27.73 28.655 23.805 20-24 19.925 28.63 28.23 23.215 25-29 19.685 28.065 27.474999999999998 24.775 30-34 19.41 28.78 28.125 23.685000000000002 35-39 19.814999999999998 28.175 27.725 24.285 40-44 20.445 28.71 27.175 23.669999999999998 45-49 20.145 28.134999999999998 28.03 23.69 50-54 19.375 28.87 28.13 23.625 55-59 20.01 28.37 27.24 24.38 60-64 20.315 28.389999999999997 27.060000000000002 24.235 65-69 20.06 27.57 28.255000000000003 24.115000000000002 70-74 19.935 28.18 27.860000000000003 24.025 75-79 19.925 28.025 27.925 24.125 80-84 20.330000000000002 28.665000000000003 27.26 23.745 85-89 20.645 27.99 27.389999999999997 23.974999999999998 90-94 20.395 28.37 27.495000000000005 23.74 95-99 20.47 27.52 28.615000000000002 23.395 100-104 20.424999999999997 28.294999999999998 27.584999999999997 23.695 105-109 20.82 28.68 26.529999999999998 23.97 110-114 20.424999999999997 28.12 27.63 23.825 115-119 20.75 28.37 27.650000000000002 23.23 120-124 20.93 27.655 26.995 24.42 125-129 20.76 29.185 26.31 23.745 130-134 20.605 28.225 27.76 23.41 135-139 20.61 28.050000000000004 27.905 23.435 140-144 21.099999999999998 28.610000000000003 26.840000000000003 23.45 145-149 20.665 28.565 26.745 24.025 150-151 20.9375 28.037499999999998 26.4625 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 3.5 24 4.0 25 3.5 26 4.5 27 4.0 28 9.5 29 13.0 30 12.0 31 19.5 32 29.0 33 39.5 34 47.5 35 61.5 36 96.5 37 113.0 38 136.0 39 159.5 40 184.5 41 214.0 42 223.5 43 250.5 44 263.0 45 260.0 46 252.0 47 252.0 48 241.5 49 206.5 50 190.5 51 159.5 52 116.0 53 102.0 54 86.0 55 62.5 56 53.5 57 43.0 58 24.0 59 16.5 60 15.0 61 8.5 62 6.5 63 3.5 64 0.0 65 0.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.11297950604309 90.5 2 4.7031003678402525 8.95 3 0.1576458223857068 0.44999999999999996 4 0.02627430373095113 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.9124999999999996 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAAG 10 0.006830828 145.0 2 GAAAGGA 10 0.006830828 145.0 4 >>END_MODULE SRR12161442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3425 37.0 37.0 37.0 37.0 37.0 2 36.046 37.0 37.0 37.0 37.0 37.0 3 35.8915 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.219 37.0 37.0 37.0 37.0 37.0 6 36.1995 37.0 37.0 37.0 37.0 37.0 7 36.3155 37.0 37.0 37.0 37.0 37.0 8 36.3465 37.0 37.0 37.0 37.0 37.0 9 36.1845 37.0 37.0 37.0 37.0 37.0 10-14 36.2243 37.0 37.0 37.0 37.0 37.0 15-19 36.2094 37.0 37.0 37.0 37.0 37.0 20-24 36.1471 37.0 37.0 37.0 37.0 37.0 25-29 36.1425 37.0 37.0 37.0 37.0 37.0 30-34 36.14399999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.116 37.0 37.0 37.0 37.0 37.0 40-44 36.092499999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0842 37.0 37.0 37.0 37.0 37.0 50-54 36.094500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.007999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0106 37.0 37.0 37.0 37.0 37.0 65-69 35.937 37.0 37.0 37.0 37.0 37.0 70-74 35.978899999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8973 37.0 37.0 37.0 37.0 37.0 80-84 35.9576 37.0 37.0 37.0 37.0 37.0 85-89 35.8979 37.0 37.0 37.0 37.0 37.0 90-94 35.8087 37.0 37.0 37.0 37.0 37.0 95-99 35.8679 37.0 37.0 37.0 37.0 37.0 100-104 35.795 37.0 37.0 37.0 37.0 37.0 105-109 35.7964 37.0 37.0 37.0 37.0 37.0 110-114 35.7861 37.0 37.0 37.0 37.0 37.0 115-119 35.809999999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.769800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.581 37.0 37.0 37.0 37.0 37.0 130-134 35.5631 37.0 37.0 37.0 37.0 37.0 135-139 35.6063 37.0 37.0 37.0 37.0 37.0 140-144 35.505199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5708 37.0 37.0 37.0 37.0 37.0 150-151 35.057500000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 3.0 21 1.0 22 6.0 23 5.0 24 12.0 25 7.0 26 9.0 27 10.0 28 18.0 29 15.0 30 19.0 31 34.0 32 57.0 33 103.0 34 181.0 35 558.0 36 2709.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 24.8 8.525 24.875 2 26.3 27.500000000000004 30.475 15.725 3 19.35 28.449999999999996 32.25 19.950000000000003 4 23.125 34.525 24.275 18.075 5 23.95 37.8 20.575 17.675 6 20.45 39.825 22.45 17.275 7 20.075000000000003 23.325000000000003 37.95 18.65 8 20.599999999999998 25.95 28.475 24.975 9 20.7 24.525 29.95 24.825 10-14 23.51 28.999999999999996 26.400000000000002 21.09 15-19 22.905 28.375 27.525 21.195 20-24 22.31 28.115000000000002 28.225 21.349999999999998 25-29 23.105 28.044999999999998 27.560000000000002 21.29 30-34 22.5 28.13 28.025 21.345 35-39 22.725 27.575 28.025 21.675 40-44 23.005 28.33 27.544999999999998 21.12 45-49 23.169999999999998 27.485 28.28 21.065 50-54 23.105 27.500000000000004 28.08 21.315 55-59 23.22 28.075 27.965 20.74 60-64 22.745 27.79 27.455000000000002 22.009999999999998 65-69 22.675 28.02 27.785 21.52 70-74 23.435 27.894999999999996 27.345000000000002 21.325 75-79 22.509999999999998 28.144999999999996 27.855 21.490000000000002 80-84 23.025000000000002 28.125 27.465 21.385 85-89 23.294999999999998 27.950000000000003 27.089999999999996 21.665 90-94 22.994999999999997 28.139999999999997 27.11 21.755 95-99 23.755000000000003 28.000000000000004 27.034999999999997 21.21 100-104 23.225 28.804999999999996 26.889999999999997 21.08 105-109 23.34 28.43 27.58 20.65 110-114 23.27 28.605000000000004 27.455000000000002 20.669999999999998 115-119 23.395 27.384999999999998 28.199999999999996 21.02 120-124 23.810000000000002 27.939999999999998 27.334999999999997 20.915 125-129 24.240000000000002 28.22 27.13 20.41 130-134 23.86 28.050000000000004 27.284999999999997 20.805 135-139 24.255 27.46 27.595 20.69 140-144 24.0 28.04 27.33 20.630000000000003 145-149 24.385 27.965 27.21 20.44 150-151 24.4375 28.449999999999996 26.55 20.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 2.5 18 3.0 19 2.0 20 1.0 21 0.5 22 1.5 23 4.0 24 4.5 25 3.5 26 3.0 27 4.5 28 7.0 29 12.0 30 18.0 31 19.0 32 25.5 33 38.0 34 48.0 35 62.5 36 80.5 37 101.0 38 125.0 39 162.5 40 202.0 41 231.0 42 241.5 43 250.5 44 283.5 45 274.0 46 249.5 47 231.5 48 210.5 49 204.5 50 170.5 51 137.0 52 121.0 53 97.5 54 84.0 55 71.0 56 55.5 57 43.5 58 32.5 59 28.0 60 16.0 61 8.5 62 9.0 63 5.0 64 1.0 65 0.5 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72847682119206 89.4 2 4.768211920529802 9.0 3 0.3443708609271523 0.975 4 0.13245033112582782 0.5 5 0.026490066225165563 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.7250000000000001 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.0999999999999996 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.9625000000000004 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.525 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676851 spots for SRR12161442.sra Written 676851 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra Read 676844 spots for SRR12161442.sra Written 676844 spots for SRR12161442.sra SRR ids: ['SRR12161442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pps4rk91 SRR12161442.sra spots: 13536887 blocks: [[1, 676844], [676845, 1353688], [1353689, 2030532], [2030533, 2707376], [2707377, 3384220], [3384221, 4061064], [4061065, 4737908], [4737909, 5414752], [5414753, 6091596], [6091597, 6768440], [6768441, 7445284], [7445285, 8122128], [8122129, 8798972], [8798973, 9475816], [9475817, 10152660], [10152661, 10829504], [10829505, 11506348], [11506349, 12183192], [12183193, 12860036], [12860037, 13536887]] SRR12161442 file size 4578726 SRR12161442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161442 SRR12161442_1.fastq SRR12161442_2.fastq Input file: SRR12161442_1.fastq Paired file: SRR12161442_2.fastq trimmed: SRR12161442-trimmed-pair1.fastq, SRR12161442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:12:26 2025 >> started Thu Feb 13 17:12:41 2025 >> done (14.937s) 13536887 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 1470 ( 0.01%) empty read pairs filtered out after trimming by size control 13535381 (99.99%) read pairs available; of these: 860488 ( 6.36%) trimmed read pairs available after processing 12674893 (93.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 8 0.00% 26 6 0.00% 27 12 0.00% 28 5 0.00% 29 7 0.00% 30 8 0.00% 31 11 0.00% 32 8 0.00% 33 3 0.00% 34 5 0.00% 35 11 0.00% 36 4 0.00% 37 6 0.00% 38 14 0.00% 39 13 0.00% 40 13 0.00% 41 13 0.00% 42 13 0.00% 43 10 0.00% 44 11 0.00% 45 15 0.00% 46 10 0.00% 47 10 0.00% 48 9 0.00% 49 13 0.00% 50 26 0.00% 51 23 0.00% 52 30 0.00% 53 18 0.00% 54 24 0.00% 55 30 0.00% 56 35 0.00% 57 44 0.00% 58 33 0.00% 59 48 0.00% 60 53 0.00% 61 65 0.00% 62 65 0.00% 63 79 0.00% 64 74 0.00% 65 79 0.00% 66 84 0.00% 67 96 0.00% 68 100 0.00% 69 123 0.00% 70 174 0.00% 71 154 0.00% 72 195 0.00% 73 220 0.00% 74 233 0.00% 75 230 0.00% 76 297 0.00% 77 312 0.00% 78 380 0.00% 79 436 0.00% 80 455 0.00% 81 531 0.00% 82 640 0.00% 83 728 0.01% 84 850 0.01% 85 862 0.01% 86 952 0.01% 87 1057 0.01% 88 1176 0.01% 89 1304 0.01% 90 1530 0.01% 91 1792 0.01% 92 1884 0.01% 93 2103 0.02% 94 2291 0.02% 95 2615 0.02% 96 2636 0.02% 97 2958 0.02% 98 3213 0.02% 99 3431 0.03% 100 3789 0.03% 101 4125 0.03% 102 4627 0.03% 103 4980 0.04% 104 5414 0.04% 105 5755 0.04% 106 6079 0.04% 107 6392 0.05% 108 6694 0.05% 109 7297 0.05% 110 7464 0.06% 111 7948 0.06% 112 8639 0.06% 113 8999 0.07% 114 9488 0.07% 115 10072 0.07% 116 10563 0.08% 117 11027 0.08% 118 11734 0.09% 119 11873 0.09% 120 12430 0.09% 121 13122 0.10% 122 13942 0.10% 123 14617 0.11% 124 15006 0.11% 125 15640 0.12% 126 16290 0.12% 127 16936 0.13% 128 17309 0.13% 129 17771 0.13% 130 18168 0.13% 131 18630 0.14% 132 19452 0.14% 133 20358 0.15% 134 20764 0.15% 135 21695 0.16% 136 22244 0.16% 137 22835 0.17% 138 23038 0.17% 139 24133 0.18% 140 24123 0.18% 141 24880 0.18% 142 26049 0.19% 143 26525 0.20% 144 27150 0.20% 145 28150 0.21% 146 28711 0.21% 147 29251 0.22% 148 30178 0.22% 149 30178 0.22% 150 30925 0.23% 151 12674893 93.64% 13535381 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.72 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=10.15 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.3 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=22 prefix-density=0.96 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=117.96 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12161442 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:13:21 Started mapping on | Feb 13 17:13:21 Finished on | Feb 13 17:14:50 Mapping speed, Million of reads per hour | 547.50 Number of input reads | 13535381 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12765546 Uniquely mapped reads % | 94.31% Average mapped length | 298.19 Number of splices: Total | 13311662 Number of splices: Annotated (sjdb) | 13030848 Number of splices: GT/AG | 13032577 Number of splices: GC/AG | 232697 Number of splices: AT/AC | 7714 Number of splices: Non-canonical | 38674 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297152 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 42283 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472683 472683 472683 N_multimapping 297152 297152 297152 N_noFeature 430712 12600678 480643 N_ambiguous 205910 716 90533 UnstrandedReadsAssigned:12128924 PositiveStrandReadsAssigned:164152 NegativeStrandReadsAssigned:12194370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161442-trimmed-pair1.fastq SRR12161442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,535,381 reads, 12,221,638 reads pseudoaligned [quant] estimated average fragment length: 278.758 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR12161442.ke.tsv 34699 SRR12161442.se.tsv 87100 total ==> SRR12161442.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.24 360 15.1673 Potri.005G024800.1.v4.1 1035 757.242 192 18.5902 Potri.004G059700.1.v4.1 961 683.462 1 0.107276 Potri.007G009000.2.v4.1 1416 1138.24 0 0 Potri.003G141000.2.v4.1 2943 2665.24 562 15.4602 Potri.016G087400.1.v4.1 270 75.4009 575.514 559.623 Potri.015G069301.1.v4.1 564 304.056 0 0 Potri.010G195200.1.v4.1 1773 1495.24 43 2.1085 Potri.012G127500.1.v4.1 977 699.361 79 8.28213 ==> SRR12161442.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR12161442 completed mapping pipeline successfully