Starting /dee2/code/volunteer_pipeline.sh SRR12161443 current disk space = 3088705015808 free memory = 1478016852 SRR12161443 SRAfilesize 70ed9028747ae04c55dfda5d6fbbe8a5 SRR12161443.sra SRR12161443.sra file validated SRR12161443 is paired end SRR12161443 is conventional basespace SRR12161443 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.502 37.0 37.0 37.0 37.0 37.0 2 36.3935 37.0 37.0 37.0 37.0 37.0 3 36.5565 37.0 37.0 37.0 37.0 37.0 4 36.527 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.6045 37.0 37.0 37.0 37.0 37.0 7 36.6065 37.0 37.0 37.0 37.0 37.0 8 36.637 37.0 37.0 37.0 37.0 37.0 9 36.486 37.0 37.0 37.0 37.0 37.0 10-14 36.631099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5606 37.0 37.0 37.0 37.0 37.0 20-24 36.5394 37.0 37.0 37.0 37.0 37.0 25-29 36.475 37.0 37.0 37.0 37.0 37.0 30-34 36.4428 37.0 37.0 37.0 37.0 37.0 35-39 36.416 37.0 37.0 37.0 37.0 37.0 40-44 36.4468 37.0 37.0 37.0 37.0 37.0 45-49 36.4345 37.0 37.0 37.0 37.0 37.0 50-54 36.3548 37.0 37.0 37.0 37.0 37.0 55-59 36.375800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3686 37.0 37.0 37.0 37.0 37.0 65-69 36.3487 37.0 37.0 37.0 37.0 37.0 70-74 36.320899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3174 37.0 37.0 37.0 37.0 37.0 80-84 36.2522 37.0 37.0 37.0 37.0 37.0 85-89 36.268600000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2748 37.0 37.0 37.0 37.0 37.0 95-99 36.2487 37.0 37.0 37.0 37.0 37.0 100-104 36.2282 37.0 37.0 37.0 37.0 37.0 105-109 36.14020000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1662 37.0 37.0 37.0 37.0 37.0 115-119 36.135799999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.088800000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.041999999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.9838 37.0 37.0 37.0 37.0 37.0 135-139 35.928200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8716 37.0 37.0 37.0 37.0 37.0 145-149 35.8782 37.0 37.0 37.0 37.0 37.0 150-151 35.7735 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 5.0 28 7.0 29 17.0 30 25.0 31 32.0 32 63.0 33 82.0 34 120.0 35 294.0 36 2934.0 37 414.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.87243621810905 11.655827913956978 5.67783891945973 37.793896948474234 2 20.200000000000003 11.85 34.325 33.625 3 16.25 16.225 28.425 39.1 4 20.974999999999998 25.3 24.425 29.299999999999997 5 21.775 31.3 24.7 22.225 6 21.425 33.525 23.799999999999997 21.25 7 15.2 26.075 41.675000000000004 17.05 8 16.675 27.224999999999998 31.424999999999997 24.675 9 16.875 23.599999999999998 33.650000000000006 25.874999999999996 10-14 19.52 29.365000000000002 27.025 24.09 15-19 20.18 27.705000000000002 27.705000000000002 24.41 20-24 20.06 26.979999999999997 27.884999999999998 25.074999999999996 25-29 20.51 27.555000000000003 27.82 24.115000000000002 30-34 19.869999999999997 28.485 27.3 24.345 35-39 20.555 27.595 27.85 24.0 40-44 20.435 28.475 27.3 23.79 45-49 20.215 28.205000000000002 27.900000000000002 23.68 50-54 20.945 27.255000000000003 27.150000000000002 24.65 55-59 20.455000000000002 27.6 28.105000000000004 23.84 60-64 20.75 27.905 27.815 23.53 65-69 20.74 26.99 28.249999999999996 24.02 70-74 20.080000000000002 27.955000000000002 27.46 24.505 75-79 20.48 26.96 27.92 24.64 80-84 20.830000000000002 27.894999999999996 27.58 23.695 85-89 20.085 28.549999999999997 27.229999999999997 24.135 90-94 20.26 28.060000000000002 27.939999999999998 23.74 95-99 20.915 27.565 27.284999999999997 24.235 100-104 20.919999999999998 27.560000000000002 27.169999999999998 24.349999999999998 105-109 20.745 27.779999999999998 27.325 24.15 110-114 20.635 27.810000000000002 27.71 23.845 115-119 21.43 27.865000000000002 27.265 23.44 120-124 20.705000000000002 27.975 27.02 24.3 125-129 20.82 27.450000000000003 27.810000000000002 23.919999999999998 130-134 21.465 27.735 26.935 23.865 135-139 21.505 27.6 27.11 23.785 140-144 21.47 27.644999999999996 27.205000000000002 23.68 145-149 20.865000000000002 27.625 27.675 23.835 150-151 21.4125 28.512500000000003 27.187499999999996 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 2.5 26 1.5 27 6.0 28 12.5 29 11.5 30 9.0 31 18.5 32 28.5 33 36.0 34 45.5 35 59.5 36 77.5 37 91.5 38 115.0 39 141.5 40 158.0 41 176.5 42 208.5 43 230.5 44 244.5 45 265.5 46 273.0 47 246.5 48 237.0 49 251.5 50 234.0 51 191.5 52 147.5 53 118.5 54 95.5 55 70.5 56 53.5 57 44.0 58 30.5 59 22.0 60 15.5 61 6.0 62 4.5 63 4.0 64 2.0 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9498933901919 88.125 2 5.676972281449894 10.65 3 0.26652452025586354 0.75 4 0.026652452025586353 0.1 5 0.07995735607675906 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCA 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAATC 10 0.006830828 145.0 7 >>END_MODULE SRR12161443 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3625 37.0 37.0 37.0 37.0 37.0 2 36.2105 37.0 37.0 37.0 37.0 37.0 3 36.1055 37.0 37.0 37.0 37.0 37.0 4 36.1305 37.0 37.0 37.0 37.0 37.0 5 36.3425 37.0 37.0 37.0 37.0 37.0 6 36.1325 37.0 37.0 37.0 37.0 37.0 7 36.2285 37.0 37.0 37.0 37.0 37.0 8 36.315 37.0 37.0 37.0 37.0 37.0 9 36.2645 37.0 37.0 37.0 37.0 37.0 10-14 36.2356 37.0 37.0 37.0 37.0 37.0 15-19 36.289699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.235499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.159 37.0 37.0 37.0 37.0 37.0 30-34 36.1484 37.0 37.0 37.0 37.0 37.0 35-39 36.15560000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0822 37.0 37.0 37.0 37.0 37.0 45-49 36.0938 37.0 37.0 37.0 37.0 37.0 50-54 36.0892 37.0 37.0 37.0 37.0 37.0 55-59 36.0456 37.0 37.0 37.0 37.0 37.0 60-64 36.0339 37.0 37.0 37.0 37.0 37.0 65-69 36.0241 37.0 37.0 37.0 37.0 37.0 70-74 35.9145 37.0 37.0 37.0 37.0 37.0 75-79 35.9177 37.0 37.0 37.0 37.0 37.0 80-84 36.0058 37.0 37.0 37.0 37.0 37.0 85-89 35.946799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8328 37.0 37.0 37.0 37.0 37.0 95-99 35.913799999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.8748 37.0 37.0 37.0 37.0 37.0 105-109 35.8975 37.0 37.0 37.0 37.0 37.0 110-114 35.8445 37.0 37.0 37.0 37.0 37.0 115-119 35.7967 37.0 37.0 37.0 37.0 37.0 120-124 35.82899999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.697 37.0 37.0 37.0 37.0 37.0 130-134 35.6349 37.0 37.0 37.0 37.0 37.0 135-139 35.6452 37.0 37.0 37.0 37.0 37.0 140-144 35.5887 37.0 37.0 37.0 37.0 37.0 145-149 35.609300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.0355 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 1.0 15 6.0 16 0.0 17 0.0 18 1.0 19 0.0 20 6.0 21 0.0 22 3.0 23 4.0 24 3.0 25 7.0 26 6.0 27 7.0 28 10.0 29 20.0 30 26.0 31 37.0 32 66.0 33 92.0 34 174.0 35 513.0 36 2760.0 37 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.475 25.3 8.475000000000001 23.75 2 27.625 28.199999999999996 27.400000000000002 16.775000000000002 3 21.4 27.55 30.95 20.1 4 23.125 35.425000000000004 22.5 18.95 5 24.525 37.574999999999996 21.15 16.75 6 20.875 40.525 20.125 18.475 7 21.125 23.625 35.35 19.900000000000002 8 20.775 27.0 28.000000000000004 24.224999999999998 9 21.425 25.05 28.749999999999996 24.775 10-14 23.125 29.645 25.990000000000002 21.240000000000002 15-19 23.315 28.294999999999998 27.065 21.325 20-24 23.52 27.79 27.229999999999997 21.46 25-29 23.04 28.035 27.605 21.32 30-34 22.535 28.044999999999998 27.875 21.545 35-39 23.125 28.12 26.905 21.85 40-44 22.985 28.09 27.279999999999998 21.645 45-49 22.81 28.02 27.775 21.395 50-54 23.294999999999998 28.07 27.525 21.11 55-59 23.544999999999998 27.794999999999998 27.565 21.095 60-64 23.25 28.455000000000002 26.955000000000002 21.34 65-69 23.74 27.694999999999997 27.235 21.33 70-74 22.89 28.449999999999996 27.310000000000002 21.349999999999998 75-79 22.54 28.310000000000002 26.96 22.189999999999998 80-84 22.925 28.015 27.689999999999998 21.37 85-89 23.315 27.595 27.375 21.715 90-94 23.54 28.410000000000004 26.405 21.645 95-99 23.830000000000002 27.425 27.235 21.51 100-104 23.755000000000003 27.975 27.41 20.86 105-109 23.845 27.565 27.279999999999998 21.310000000000002 110-114 24.025 28.315 26.900000000000002 20.76 115-119 24.095 27.765 26.66 21.48 120-124 24.075 27.529999999999998 27.694999999999997 20.7 125-129 24.365000000000002 28.18 26.745 20.71 130-134 24.125 28.275 26.974999999999998 20.625 135-139 24.535 26.979999999999997 27.605 20.880000000000003 140-144 24.37 27.584999999999997 27.034999999999997 21.01 145-149 24.825 27.68 27.425 20.07 150-151 26.1 28.275 26.337500000000002 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 1.5 24 0.5 25 3.0 26 4.5 27 4.0 28 7.0 29 11.0 30 14.0 31 21.0 32 28.0 33 32.0 34 38.5 35 58.0 36 77.0 37 100.0 38 127.0 39 147.0 40 165.5 41 200.0 42 225.0 43 245.5 44 281.5 45 289.5 46 281.0 47 262.5 48 226.0 49 210.0 50 185.0 51 149.5 52 133.5 53 104.0 54 86.5 55 70.5 56 53.5 57 41.5 58 24.0 59 23.5 60 16.5 61 6.5 62 9.0 63 7.0 64 5.0 65 2.5 66 1.0 67 1.0 68 1.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.83873560139298 87.575 2 5.625502276989017 10.5 3 0.3750334851326011 1.05 4 0.05357621216180017 0.2 5 0.05357621216180017 0.25 6 0.0 0.0 7 0.026788106080900084 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026788106080900084 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9625 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.3375000000000004 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752159 spots for SRR12161443.sra Written 752159 spots for SRR12161443.sra Read 752174 spots for SRR12161443.sra Written 752174 spots for SRR12161443.sra SRR ids: ['SRR12161443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o7go33y0 SRR12161443.sra spots: 15043195 blocks: [[1, 752159], [752160, 1504318], [1504319, 2256477], [2256478, 3008636], [3008637, 3760795], [3760796, 4512954], [4512955, 5265113], [5265114, 6017272], [6017273, 6769431], [6769432, 7521590], [7521591, 8273749], [8273750, 9025908], [9025909, 9778067], [9778068, 10530226], [10530227, 11282385], [11282386, 12034544], [12034545, 12786703], [12786704, 13538862], [13538863, 14291021], [14291022, 15043195]] SRR12161443 file size 5090635 SRR12161443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161443 SRR12161443_1.fastq SRR12161443_2.fastq Input file: SRR12161443_1.fastq Paired file: SRR12161443_2.fastq trimmed: SRR12161443-trimmed-pair1.fastq, SRR12161443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:30:45 2025 >> started Thu Feb 13 17:31:02 2025 >> done (16.413s) 15043195 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 923 ( 0.01%) empty read pairs filtered out after trimming by size control 15042247 (99.99%) read pairs available; of these: 1004010 ( 6.67%) trimmed read pairs available after processing 14038237 (93.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 7 0.00% 21 1 0.00% 22 8 0.00% 23 13 0.00% 24 4 0.00% 25 7 0.00% 26 7 0.00% 27 11 0.00% 28 5 0.00% 29 10 0.00% 30 12 0.00% 31 11 0.00% 32 17 0.00% 33 10 0.00% 34 9 0.00% 35 7 0.00% 36 11 0.00% 37 9 0.00% 38 17 0.00% 39 16 0.00% 40 12 0.00% 41 7 0.00% 42 15 0.00% 43 10 0.00% 44 17 0.00% 45 21 0.00% 46 22 0.00% 47 18 0.00% 48 12 0.00% 49 21 0.00% 50 25 0.00% 51 15 0.00% 52 19 0.00% 53 33 0.00% 54 31 0.00% 55 26 0.00% 56 24 0.00% 57 46 0.00% 58 45 0.00% 59 44 0.00% 60 58 0.00% 61 68 0.00% 62 66 0.00% 63 67 0.00% 64 69 0.00% 65 79 0.00% 66 99 0.00% 67 107 0.00% 68 98 0.00% 69 141 0.00% 70 164 0.00% 71 174 0.00% 72 197 0.00% 73 254 0.00% 74 264 0.00% 75 288 0.00% 76 331 0.00% 77 347 0.00% 78 386 0.00% 79 463 0.00% 80 517 0.00% 81 598 0.00% 82 683 0.00% 83 756 0.01% 84 824 0.01% 85 901 0.01% 86 1101 0.01% 87 1151 0.01% 88 1279 0.01% 89 1532 0.01% 90 1573 0.01% 91 1863 0.01% 92 2089 0.01% 93 2266 0.02% 94 2665 0.02% 95 2846 0.02% 96 3017 0.02% 97 3483 0.02% 98 3571 0.02% 99 3914 0.03% 100 4310 0.03% 101 4713 0.03% 102 5027 0.03% 103 5431 0.04% 104 5946 0.04% 105 6286 0.04% 106 6652 0.04% 107 7061 0.05% 108 7355 0.05% 109 7966 0.05% 110 8343 0.06% 111 8852 0.06% 112 9515 0.06% 113 9924 0.07% 114 10772 0.07% 115 11359 0.08% 116 11872 0.08% 117 12821 0.09% 118 13034 0.09% 119 13651 0.09% 120 14369 0.10% 121 15053 0.10% 122 15969 0.11% 123 16761 0.11% 124 17456 0.12% 125 17859 0.12% 126 18821 0.13% 127 19585 0.13% 128 19921 0.13% 129 20849 0.14% 130 21610 0.14% 131 21912 0.15% 132 22812 0.15% 133 24015 0.16% 134 24582 0.16% 135 25493 0.17% 136 26080 0.17% 137 26841 0.18% 138 27464 0.18% 139 28616 0.19% 140 28941 0.19% 141 29824 0.20% 142 30444 0.20% 143 31756 0.21% 144 32977 0.22% 145 33536 0.22% 146 34254 0.23% 147 34780 0.23% 148 36049 0.24% 149 36234 0.24% 150 37247 0.25% 151 14038237 93.33% 15042247 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.86 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=12.36 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=3.4 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=22 prefix-density=1.08 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=33.15 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.6 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAA SRR12161443 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:31:46 Started mapping on | Feb 13 17:31:47 Finished on | Feb 13 17:33:21 Mapping speed, Million of reads per hour | 576.09 Number of input reads | 15042247 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14164022 Uniquely mapped reads % | 94.16% Average mapped length | 298.13 Number of splices: Total | 15069528 Number of splices: Annotated (sjdb) | 14766552 Number of splices: GT/AG | 14759344 Number of splices: GC/AG | 257461 Number of splices: AT/AC | 8834 Number of splices: Non-canonical | 43889 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 349583 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 96788 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 528642 528642 528642 N_multimapping 349583 349583 349583 N_noFeature 477127 13974600 528893 N_ambiguous 235650 1178 97147 UnstrandedReadsAssigned:13451245 PositiveStrandReadsAssigned:188244 NegativeStrandReadsAssigned:13537982 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161443-trimmed-pair1.fastq SRR12161443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,042,247 reads, 13,566,936 reads pseudoaligned [quant] estimated average fragment length: 262.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR12161443.ke.tsv 34699 SRR12161443.se.tsv 87100 total ==> SRR12161443.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.06 364 12.8296 Potri.005G024800.1.v4.1 1035 773.064 250 20.0159 Potri.004G059700.1.v4.1 961 699.219 10 0.885193 Potri.007G009000.2.v4.1 1416 1154.06 0 0 Potri.003G141000.2.v4.1 2943 2681.06 763 17.6144 Potri.016G087400.1.v4.1 270 74.4867 567 471.146 Potri.015G069301.1.v4.1 564 313.299 0 0 Potri.010G195200.1.v4.1 1773 1511.06 14 0.573451 Potri.012G127500.1.v4.1 977 715.146 80 6.92383 ==> SRR12161443.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12161443 completed mapping pipeline successfully