Starting /dee2/code/volunteer_pipeline.sh SRR12161444 current disk space = 3089230708736 free memory = 1579197368 SRR12161444 SRAfilesize 79933acac372a44fd529eb1dbfe3ddac SRR12161444.sra SRR12161444.sra file validated SRR12161444 is paired end SRR12161444 is conventional basespace SRR12161444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.523 37.0 37.0 37.0 37.0 37.0 2 36.428 37.0 37.0 37.0 37.0 37.0 3 36.4345 37.0 37.0 37.0 37.0 37.0 4 36.5415 37.0 37.0 37.0 37.0 37.0 5 36.6355 37.0 37.0 37.0 37.0 37.0 6 36.5265 37.0 37.0 37.0 37.0 37.0 7 36.5025 37.0 37.0 37.0 37.0 37.0 8 36.54 37.0 37.0 37.0 37.0 37.0 9 36.507 37.0 37.0 37.0 37.0 37.0 10-14 36.578500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5417 37.0 37.0 37.0 37.0 37.0 20-24 36.4875 37.0 37.0 37.0 37.0 37.0 25-29 36.482000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.440599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.425200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4387 37.0 37.0 37.0 37.0 37.0 45-49 36.394499999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3369 37.0 37.0 37.0 37.0 37.0 55-59 36.3565 37.0 37.0 37.0 37.0 37.0 60-64 36.3176 37.0 37.0 37.0 37.0 37.0 65-69 36.312799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.334199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2577 37.0 37.0 37.0 37.0 37.0 80-84 36.265 37.0 37.0 37.0 37.0 37.0 85-89 36.2884 37.0 37.0 37.0 37.0 37.0 90-94 36.2735 37.0 37.0 37.0 37.0 37.0 95-99 36.23479999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2098 37.0 37.0 37.0 37.0 37.0 105-109 36.1491 37.0 37.0 37.0 37.0 37.0 110-114 36.1515 37.0 37.0 37.0 37.0 37.0 115-119 36.1613 37.0 37.0 37.0 37.0 37.0 120-124 36.1024 37.0 37.0 37.0 37.0 37.0 125-129 36.079 37.0 37.0 37.0 37.0 37.0 130-134 36.0709 37.0 37.0 37.0 37.0 37.0 135-139 35.9679 37.0 37.0 37.0 37.0 37.0 140-144 35.917100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8998 37.0 37.0 37.0 37.0 37.0 150-151 35.71175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 4.0 26 1.0 27 6.0 28 15.0 29 21.0 30 27.0 31 31.0 32 49.0 33 74.0 34 99.0 35 289.0 36 2957.0 37 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.272136068034015 11.380690345172587 6.253126563281642 38.094047023511756 2 19.05 11.799999999999999 35.75 33.4 3 16.150000000000002 15.325 28.849999999999998 39.675 4 21.75 23.575 25.2 29.475 5 24.275 31.0 24.65 20.075000000000003 6 21.525 33.675 24.5 20.3 7 14.875 27.675 40.225 17.224999999999998 8 16.900000000000002 25.624999999999996 31.624999999999996 25.85 9 17.65 24.15 33.5 24.7 10-14 19.755 30.0 27.415 22.830000000000002 15-19 19.64 28.185 28.134999999999998 24.04 20-24 19.89 28.355000000000004 28.115000000000002 23.64 25-29 20.325 28.544999999999998 27.395000000000003 23.735 30-34 19.935 28.904999999999998 27.415 23.745 35-39 20.200000000000003 28.265 27.275 24.26 40-44 19.98 28.785 27.47 23.765 45-49 20.02 28.225 27.71 24.044999999999998 50-54 20.919999999999998 27.67 27.389999999999997 24.02 55-59 19.74 28.29 27.66 24.310000000000002 60-64 19.945 28.68 27.655 23.72 65-69 20.445 27.589999999999996 27.575 24.39 70-74 20.44 28.595 27.525 23.44 75-79 20.035 27.994999999999997 28.4 23.57 80-84 20.095 28.055000000000003 27.805000000000003 24.044999999999998 85-89 20.52 28.055000000000003 27.900000000000002 23.525 90-94 20.674999999999997 27.615000000000002 27.63 24.08 95-99 19.96 28.249999999999996 27.534999999999997 24.255 100-104 20.015 28.93 27.189999999999998 23.865 105-109 20.474999999999998 27.79 28.000000000000004 23.735 110-114 20.28 28.07 27.845 23.805 115-119 20.59 28.42 27.63 23.36 120-124 20.695 28.375 27.445000000000004 23.485 125-129 20.355 28.17 27.525 23.95 130-134 20.735 28.494999999999997 27.57 23.200000000000003 135-139 20.665 28.48 27.310000000000002 23.544999999999998 140-144 20.97 28.215 27.439999999999998 23.375 145-149 21.255 27.965 27.02 23.76 150-151 21.8625 27.6625 27.3375 23.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 4.5 25 4.5 26 4.5 27 4.0 28 7.0 29 16.0 30 19.5 31 22.0 32 29.0 33 41.5 34 46.5 35 65.5 36 95.5 37 104.5 38 123.5 39 145.0 40 165.5 41 198.0 42 221.5 43 239.5 44 260.0 45 270.5 46 264.0 47 261.5 48 249.5 49 226.5 50 196.5 51 146.5 52 118.0 53 103.0 54 86.5 55 67.5 56 45.5 57 36.5 58 30.0 59 24.5 60 17.5 61 9.0 62 6.5 63 6.0 64 2.5 65 1.0 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57097457627118 89.275 2 4.978813559322034 9.4 3 0.423728813559322 1.2 4 0.0 0.0 5 0.026483050847457626 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6124999999999998 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.2875 0.0 0.0 0.0 0.0 138-139 2.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACTC 10 0.006830828 145.0 2 AGCTAGA 10 0.006830828 145.0 4 GTCAGCT 10 0.006830828 145.0 1 >>END_MODULE SRR12161444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.148 37.0 37.0 37.0 37.0 37.0 2 35.969 37.0 37.0 37.0 37.0 37.0 3 35.8885 37.0 37.0 37.0 37.0 37.0 4 35.9175 37.0 37.0 37.0 37.0 37.0 5 36.1295 37.0 37.0 37.0 37.0 37.0 6 36.108 37.0 37.0 37.0 37.0 37.0 7 36.0655 37.0 37.0 37.0 37.0 37.0 8 36.2035 37.0 37.0 37.0 37.0 37.0 9 36.1985 37.0 37.0 37.0 37.0 37.0 10-14 36.1531 37.0 37.0 37.0 37.0 37.0 15-19 36.1402 37.0 37.0 37.0 37.0 37.0 20-24 36.1008 37.0 37.0 37.0 37.0 37.0 25-29 36.1075 37.0 37.0 37.0 37.0 37.0 30-34 36.024699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0667 37.0 37.0 37.0 37.0 37.0 40-44 36.012600000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.905899999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.9857 37.0 37.0 37.0 37.0 37.0 55-59 35.854 37.0 37.0 37.0 37.0 37.0 60-64 35.82299999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.8808 37.0 37.0 37.0 37.0 37.0 70-74 35.7937 37.0 37.0 37.0 37.0 37.0 75-79 35.75019999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8455 37.0 37.0 37.0 37.0 37.0 85-89 35.741 37.0 37.0 37.0 37.0 37.0 90-94 35.6941 37.0 37.0 37.0 37.0 37.0 95-99 35.783100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7282 37.0 37.0 37.0 37.0 37.0 105-109 35.6781 37.0 37.0 37.0 37.0 37.0 110-114 35.6654 37.0 37.0 37.0 37.0 37.0 115-119 35.5972 37.0 37.0 37.0 37.0 37.0 120-124 35.607099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.471 37.0 37.0 37.0 37.0 37.0 130-134 35.348 37.0 37.0 37.0 34.6 37.0 135-139 35.4809 37.0 37.0 37.0 37.0 37.0 140-144 35.40409999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.4766 37.0 37.0 37.0 37.0 37.0 150-151 34.825500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 4.0 21 2.0 22 4.0 23 8.0 24 3.0 25 5.0 26 14.0 27 10.0 28 22.0 29 26.0 30 37.0 31 45.0 32 66.0 33 108.0 34 219.0 35 594.0 36 2586.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 25.575 9.25 24.0 2 27.750000000000004 27.6 29.275000000000002 15.375 3 20.775 28.775000000000002 30.825000000000003 19.625 4 23.075000000000003 35.75 23.724999999999998 17.45 5 24.95 36.575 21.475 17.0 6 21.15 39.85 21.875 17.125 7 19.675 22.325 38.45 19.55 8 21.224999999999998 25.775 28.000000000000004 25.0 9 20.925 25.674999999999997 29.95 23.45 10-14 22.0 30.759999999999998 25.7 21.54 15-19 22.615 27.66 28.544999999999998 21.18 20-24 22.439999999999998 28.525 27.565 21.47 25-29 22.795 28.685 27.62 20.9 30-34 22.505 28.03 28.42 21.044999999999998 35-39 22.759999999999998 28.725 27.834999999999997 20.68 40-44 22.735 27.71 28.24 21.315 45-49 22.285 28.475 28.01 21.23 50-54 22.785 28.415000000000003 27.584999999999997 21.215 55-59 22.935 27.735 27.725 21.605 60-64 23.215 28.01 27.889999999999997 20.885 65-69 22.925 27.96 27.595 21.52 70-74 23.064999999999998 28.095 27.72 21.12 75-79 23.265 27.694999999999997 27.935 21.105 80-84 23.205000000000002 27.950000000000003 27.245 21.6 85-89 23.494999999999997 27.889999999999997 27.139999999999997 21.475 90-94 23.51 28.035 27.415 21.04 95-99 23.599999999999998 27.67 27.18 21.55 100-104 23.175 28.075 27.54 21.21 105-109 23.54 27.750000000000004 27.439999999999998 21.27 110-114 23.044999999999998 28.665000000000003 27.485 20.805 115-119 23.48 27.79 27.515 21.215 120-124 23.799999999999997 27.439999999999998 27.58 21.18 125-129 23.29 28.025 27.495000000000005 21.19 130-134 24.16 27.71 27.315 20.815 135-139 23.915 27.529999999999998 27.58 20.974999999999998 140-144 23.96 28.115000000000002 27.41 20.515 145-149 24.07 27.875 27.54 20.515 150-151 24.712500000000002 27.500000000000004 27.85 19.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.5 17 2.5 18 1.0 19 0.0 20 0.0 21 2.0 22 3.5 23 2.5 24 3.0 25 3.0 26 6.0 27 8.0 28 10.0 29 11.0 30 14.0 31 19.0 32 22.5 33 32.5 34 46.0 35 66.5 36 90.5 37 102.5 38 132.0 39 159.0 40 187.0 41 231.5 42 261.0 43 275.0 44 283.0 45 282.0 46 260.0 47 248.0 48 232.5 49 204.5 50 170.5 51 126.0 52 106.5 53 83.5 54 60.0 55 57.5 56 43.0 57 29.5 58 25.5 59 24.0 60 15.0 61 10.0 62 10.5 63 7.0 64 3.5 65 2.0 66 2.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.67549668874172 89.35 2 4.847682119205298 9.15 3 0.3443708609271523 0.975 4 0.10596026490066225 0.4 5 0.026490066225165563 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.8250000000000002 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCT 10 0.006830828 145.0 8 >>END_MODULE Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672033 spots for SRR12161444.sra Written 672033 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra Read 672016 spots for SRR12161444.sra Written 672016 spots for SRR12161444.sra SRR ids: ['SRR12161444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8a9gf8q3 SRR12161444.sra spots: 13440337 blocks: [[1, 672016], [672017, 1344032], [1344033, 2016048], [2016049, 2688064], [2688065, 3360080], [3360081, 4032096], [4032097, 4704112], [4704113, 5376128], [5376129, 6048144], [6048145, 6720160], [6720161, 7392176], [7392177, 8064192], [8064193, 8736208], [8736209, 9408224], [9408225, 10080240], [10080241, 10752256], [10752257, 11424272], [11424273, 12096288], [12096289, 12768304], [12768305, 13440337]] SRR12161444 file size 4545914 SRR12161444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161444 SRR12161444_1.fastq SRR12161444_2.fastq Input file: SRR12161444_1.fastq Paired file: SRR12161444_2.fastq trimmed: SRR12161444-trimmed-pair1.fastq, SRR12161444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:36:34 2025 >> started Thu Feb 13 23:36:48 2025 >> done (14.288s) 13440337 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 460 ( 0.00%) empty read pairs filtered out after trimming by size control 13439847 (100.00%) read pairs available; of these: 664733 ( 4.95%) trimmed read pairs available after processing 12775114 (95.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 5 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 9 0.00% 27 11 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 13 0.00% 32 9 0.00% 33 6 0.00% 34 13 0.00% 35 12 0.00% 36 15 0.00% 37 9 0.00% 38 7 0.00% 39 10 0.00% 40 17 0.00% 41 17 0.00% 42 10 0.00% 43 9 0.00% 44 14 0.00% 45 13 0.00% 46 8 0.00% 47 14 0.00% 48 19 0.00% 49 17 0.00% 50 22 0.00% 51 16 0.00% 52 15 0.00% 53 27 0.00% 54 16 0.00% 55 24 0.00% 56 29 0.00% 57 28 0.00% 58 34 0.00% 59 37 0.00% 60 32 0.00% 61 43 0.00% 62 51 0.00% 63 46 0.00% 64 45 0.00% 65 55 0.00% 66 54 0.00% 67 82 0.00% 68 84 0.00% 69 99 0.00% 70 107 0.00% 71 142 0.00% 72 144 0.00% 73 154 0.00% 74 185 0.00% 75 207 0.00% 76 218 0.00% 77 239 0.00% 78 261 0.00% 79 328 0.00% 80 375 0.00% 81 409 0.00% 82 444 0.00% 83 472 0.00% 84 574 0.00% 85 710 0.01% 86 702 0.01% 87 789 0.01% 88 898 0.01% 89 946 0.01% 90 1101 0.01% 91 1216 0.01% 92 1351 0.01% 93 1433 0.01% 94 1639 0.01% 95 1827 0.01% 96 2071 0.02% 97 2121 0.02% 98 2358 0.02% 99 2481 0.02% 100 2697 0.02% 101 2904 0.02% 102 3189 0.02% 103 3536 0.03% 104 3828 0.03% 105 3969 0.03% 106 4190 0.03% 107 4506 0.03% 108 4892 0.04% 109 5211 0.04% 110 5517 0.04% 111 5782 0.04% 112 6202 0.05% 113 6510 0.05% 114 6773 0.05% 115 7187 0.05% 116 7723 0.06% 117 7980 0.06% 118 8340 0.06% 119 8758 0.07% 120 8892 0.07% 121 9692 0.07% 122 10178 0.08% 123 10949 0.08% 124 11195 0.08% 125 11846 0.09% 126 12268 0.09% 127 12690 0.09% 128 12934 0.10% 129 13258 0.10% 130 13841 0.10% 131 14140 0.11% 132 14749 0.11% 133 15488 0.12% 134 15918 0.12% 135 16857 0.13% 136 17462 0.13% 137 17706 0.13% 138 18414 0.14% 139 18997 0.14% 140 19152 0.14% 141 19843 0.15% 142 20798 0.15% 143 21180 0.16% 144 22524 0.17% 145 23467 0.17% 146 23650 0.18% 147 24246 0.18% 148 24773 0.18% 149 25063 0.19% 150 25833 0.19% 151 12775114 95.05% 13439847 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=11.06 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.4 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.72 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=62.89 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12161444 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:37:33 Started mapping on | Feb 13 23:37:33 Finished on | Feb 13 23:38:53 Mapping speed, Million of reads per hour | 604.79 Number of input reads | 13439847 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12710490 Uniquely mapped reads % | 94.57% Average mapped length | 298.82 Number of splices: Total | 13037004 Number of splices: Annotated (sjdb) | 12749272 Number of splices: GT/AG | 12766293 Number of splices: GC/AG | 218147 Number of splices: AT/AC | 10822 Number of splices: Non-canonical | 41742 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305264 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 40289 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 424093 424093 424093 N_multimapping 305264 305264 305264 N_noFeature 449822 12562146 492599 N_ambiguous 193340 622 87397 UnstrandedReadsAssigned:12067328 PositiveStrandReadsAssigned:147722 NegativeStrandReadsAssigned:12130494 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161444-trimmed-pair1.fastq SRR12161444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,439,847 reads, 12,174,898 reads pseudoaligned [quant] estimated average fragment length: 285.411 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR12161444.ke.tsv 34699 SRR12161444.se.tsv 87100 total ==> SRR12161444.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.59 468 19.0183 Potri.005G024800.1.v4.1 1035 750.589 377 35.3843 Potri.004G059700.1.v4.1 961 676.864 15 1.56121 Potri.007G009000.2.v4.1 1416 1131.59 0 0 Potri.003G141000.2.v4.1 2943 2658.59 368.399 9.76199 Potri.016G087400.1.v4.1 270 71.4673 530 522.444 Potri.015G069301.1.v4.1 564 297.985 0 0 Potri.010G195200.1.v4.1 1773 1488.59 43 2.035 Potri.012G127500.1.v4.1 977 692.734 241 24.5088 ==> SRR12161444.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 96 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12161444 completed mapping pipeline successfully