Starting /dee2/code/volunteer_pipeline.sh SRR12161445 current disk space = 3089247457280 free memory = 1582346796 SRR12161445 SRAfilesize 1e7913f89768f5df6fade719c37e4f25 SRR12161445.sra SRR12161445.sra file validated SRR12161445 is paired end SRR12161445 is conventional basespace SRR12161445 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54075 37.0 37.0 37.0 37.0 37.0 2 36.463 37.0 37.0 37.0 37.0 37.0 3 36.552 37.0 37.0 37.0 37.0 37.0 4 36.6185 37.0 37.0 37.0 37.0 37.0 5 36.5795 37.0 37.0 37.0 37.0 37.0 6 36.6185 37.0 37.0 37.0 37.0 37.0 7 36.494 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.552499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.554899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4974 37.0 37.0 37.0 37.0 37.0 25-29 36.437 37.0 37.0 37.0 37.0 37.0 30-34 36.4874 37.0 37.0 37.0 37.0 37.0 35-39 36.4567 37.0 37.0 37.0 37.0 37.0 40-44 36.4334 37.0 37.0 37.0 37.0 37.0 45-49 36.41030000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.378 37.0 37.0 37.0 37.0 37.0 55-59 36.3878 37.0 37.0 37.0 37.0 37.0 60-64 36.3463 37.0 37.0 37.0 37.0 37.0 65-69 36.34740000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3258 37.0 37.0 37.0 37.0 37.0 75-79 36.357099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3473 37.0 37.0 37.0 37.0 37.0 85-89 36.3057 37.0 37.0 37.0 37.0 37.0 90-94 36.3031 37.0 37.0 37.0 37.0 37.0 95-99 36.250299999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.183099999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.14919999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.2018 37.0 37.0 37.0 37.0 37.0 115-119 36.163 37.0 37.0 37.0 37.0 37.0 120-124 36.1333 37.0 37.0 37.0 37.0 37.0 125-129 36.1177 37.0 37.0 37.0 37.0 37.0 130-134 36.0836 37.0 37.0 37.0 37.0 37.0 135-139 36.0121 37.0 37.0 37.0 37.0 37.0 140-144 35.9814 37.0 37.0 37.0 37.0 37.0 145-149 35.9796 37.0 37.0 37.0 37.0 37.0 150-151 35.84525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 2.0 26 4.0 27 3.0 28 16.0 29 13.0 30 21.0 31 36.0 32 40.0 33 82.0 34 107.0 35 314.0 36 2937.0 37 424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.985246311577896 11.977994498624655 5.55138784696174 41.485371342835705 2 19.425 11.55 36.15 32.875 3 16.375 15.325 27.200000000000003 41.099999999999994 4 21.05 23.1 24.75 31.1 5 22.95 29.299999999999997 25.124999999999996 22.625 6 21.975 33.575 22.875 21.575 7 15.675 26.825 40.25 17.25 8 16.975 26.825 32.05 24.15 9 17.375 24.3 34.575 23.75 10-14 19.37 30.035 27.51 23.085 15-19 19.945 28.055000000000003 27.83 24.169999999999998 20-24 20.21 28.555000000000003 27.415 23.82 25-29 19.965 28.605000000000004 27.200000000000003 24.23 30-34 19.63 28.63 27.655 24.085 35-39 20.3 27.765 27.76 24.175 40-44 20.36 27.985 27.62 24.035 45-49 20.77 27.575 27.775 23.880000000000003 50-54 20.085 28.875 27.37 23.669999999999998 55-59 20.560000000000002 28.605000000000004 27.389999999999997 23.445 60-64 20.085 28.15 27.72 24.044999999999998 65-69 20.775 27.779999999999998 27.41 24.035 70-74 20.41 28.15 27.794999999999998 23.645 75-79 20.064999999999998 27.92 28.12 23.895 80-84 20.65 28.165000000000003 27.12 24.065 85-89 19.935 28.28 27.245 24.54 90-94 20.724999999999998 27.525 27.644999999999996 24.104999999999997 95-99 20.53 27.700000000000003 28.075 23.695 100-104 20.185 28.16 27.815 23.84 105-109 20.655 27.435 28.37 23.54 110-114 20.560000000000002 27.905 27.66 23.875 115-119 20.74 28.275 27.950000000000003 23.035 120-124 20.625 27.675 27.735 23.965 125-129 20.59 27.575 27.625 24.21 130-134 20.89 27.845 27.38 23.885 135-139 20.95 27.944999999999997 27.51 23.595 140-144 21.205 27.544999999999998 27.529999999999998 23.72 145-149 21.185000000000002 27.839999999999996 27.015 23.96 150-151 21.0375 27.6125 27.3375 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 1.0 25 1.5 26 3.5 27 4.5 28 8.0 29 10.5 30 13.5 31 18.5 32 23.5 33 38.5 34 52.5 35 61.0 36 77.5 37 90.5 38 101.0 39 145.5 40 175.5 41 188.5 42 235.0 43 264.0 44 272.5 45 284.0 46 285.5 47 256.5 48 229.0 49 211.0 50 182.5 51 162.0 52 138.5 53 108.5 54 83.0 55 68.5 56 56.0 57 38.5 58 29.5 59 20.5 60 15.5 61 12.5 62 6.0 63 3.5 64 3.0 65 2.5 66 1.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.38865096359743 87.225 2 6.183083511777302 11.55 3 0.4014989293361884 1.125 4 0.02676659528907923 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.45 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161445 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.347 37.0 37.0 37.0 37.0 37.0 2 36.0485 37.0 37.0 37.0 37.0 37.0 3 36.167 37.0 37.0 37.0 37.0 37.0 4 36.0685 37.0 37.0 37.0 37.0 37.0 5 36.3405 37.0 37.0 37.0 37.0 37.0 6 36.1275 37.0 37.0 37.0 37.0 37.0 7 36.071 37.0 37.0 37.0 37.0 37.0 8 36.206 37.0 37.0 37.0 37.0 37.0 9 36.2385 37.0 37.0 37.0 37.0 37.0 10-14 36.2568 37.0 37.0 37.0 37.0 37.0 15-19 36.2615 37.0 37.0 37.0 37.0 37.0 20-24 36.2368 37.0 37.0 37.0 37.0 37.0 25-29 36.161500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0832 37.0 37.0 37.0 37.0 37.0 35-39 36.1061 37.0 37.0 37.0 37.0 37.0 40-44 36.1532 37.0 37.0 37.0 37.0 37.0 45-49 36.01649999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1035 37.0 37.0 37.0 37.0 37.0 55-59 36.049899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.029599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0043 37.0 37.0 37.0 37.0 37.0 70-74 35.8821 37.0 37.0 37.0 37.0 37.0 75-79 35.8645 37.0 37.0 37.0 37.0 37.0 80-84 35.958600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8727 37.0 37.0 37.0 37.0 37.0 90-94 35.8087 37.0 37.0 37.0 37.0 37.0 95-99 35.8718 37.0 37.0 37.0 37.0 37.0 100-104 35.818400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7954 37.0 37.0 37.0 37.0 37.0 110-114 35.7759 37.0 37.0 37.0 37.0 37.0 115-119 35.7813 37.0 37.0 37.0 37.0 37.0 120-124 35.7838 37.0 37.0 37.0 37.0 37.0 125-129 35.6238 37.0 37.0 37.0 37.0 37.0 130-134 35.6335 37.0 37.0 37.0 37.0 37.0 135-139 35.6673 37.0 37.0 37.0 37.0 37.0 140-144 35.600100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.62349999999999 37.0 37.0 37.0 37.0 37.0 150-151 34.87475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 2.0 20 3.0 21 1.0 22 5.0 23 3.0 24 4.0 25 7.0 26 6.0 27 4.0 28 16.0 29 15.0 30 21.0 31 47.0 32 66.0 33 110.0 34 222.0 35 582.0 36 2645.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.325 27.425 9.325 25.924999999999997 2 27.200000000000003 27.200000000000003 29.875 15.725 3 19.725 29.675 31.874999999999996 18.725 4 24.05 35.099999999999994 23.7 17.150000000000002 5 23.474999999999998 38.2 21.65 16.675 6 20.9 41.099999999999994 21.875 16.125 7 21.425 23.150000000000002 37.0 18.425 8 22.3 26.724999999999998 28.1 22.875 9 21.349999999999998 25.624999999999996 30.525000000000002 22.5 10-14 22.675 30.17 26.195 20.96 15-19 22.56 28.57 27.650000000000002 21.22 20-24 22.34 29.675 26.584999999999997 21.4 25-29 22.805 29.175 27.07 20.95 30-34 22.18 28.595 27.450000000000003 21.775 35-39 22.68 28.475 28.125 20.72 40-44 22.835 28.560000000000002 27.145000000000003 21.46 45-49 22.830000000000002 27.975 28.1 21.095 50-54 23.055 27.815 27.77 21.36 55-59 22.884999999999998 27.93 27.560000000000002 21.625 60-64 23.205000000000002 27.93 28.410000000000004 20.455000000000002 65-69 22.855 27.065 27.99 22.09 70-74 23.075000000000003 27.675 27.495000000000005 21.755 75-79 22.975 28.055000000000003 27.405 21.565 80-84 22.97 28.205000000000002 27.125 21.7 85-89 23.05 28.294999999999998 27.67 20.985 90-94 22.915 27.875 27.445000000000004 21.765 95-99 23.84 27.595 27.11 21.455 100-104 23.635 28.035 27.29 21.04 105-109 23.36 28.21 27.439999999999998 20.990000000000002 110-114 23.474999999999998 27.805000000000003 27.825 20.895 115-119 23.635 27.765 27.82 20.78 120-124 23.595 28.249999999999996 27.224999999999998 20.93 125-129 23.544999999999998 27.935 26.76 21.759999999999998 130-134 24.41 27.765 27.355 20.47 135-139 23.830000000000002 27.55 27.825 20.794999999999998 140-144 24.235 27.97 26.584999999999997 21.21 145-149 23.605 28.255000000000003 27.095000000000002 21.044999999999998 150-151 24.7 28.0625 27.487499999999997 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 2.0 10 2.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.5 21 2.0 22 1.0 23 0.5 24 0.5 25 2.0 26 3.5 27 6.0 28 7.5 29 9.0 30 15.0 31 17.5 32 24.0 33 34.0 34 47.0 35 65.5 36 84.0 37 110.0 38 132.0 39 172.5 40 209.0 41 220.0 42 235.5 43 253.5 44 271.0 45 288.5 46 276.5 47 259.0 48 246.5 49 209.0 50 158.5 51 122.5 52 103.0 53 88.0 54 79.0 55 60.0 56 46.5 57 40.0 58 24.5 59 14.0 60 16.0 61 11.0 62 5.0 63 5.0 64 4.0 65 1.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3655654042439 86.9 2 5.9629331184528604 11.1 3 0.5372011818426001 1.5 4 0.13430029546065003 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.45 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGGCT 10 0.006830828 145.0 8 AGGCATA 10 0.006830828 145.0 4 >>END_MODULE Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903957 spots for SRR12161445.sra Written 903957 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra Read 903947 spots for SRR12161445.sra Written 903947 spots for SRR12161445.sra SRR ids: ['SRR12161445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ci9y9fet SRR12161445.sra spots: 18078950 blocks: [[1, 903947], [903948, 1807894], [1807895, 2711841], [2711842, 3615788], [3615789, 4519735], [4519736, 5423682], [5423683, 6327629], [6327630, 7231576], [7231577, 8135523], [8135524, 9039470], [9039471, 9943417], [9943418, 10847364], [10847365, 11751311], [11751312, 12655258], [12655259, 13559205], [13559206, 14463152], [14463153, 15367099], [15367100, 16271046], [16271047, 17174993], [17174994, 18078950]] SRR12161445 file size 6122317 SRR12161445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161445 SRR12161445_1.fastq SRR12161445_2.fastq Input file: SRR12161445_1.fastq Paired file: SRR12161445_2.fastq trimmed: SRR12161445-trimmed-pair1.fastq, SRR12161445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:24:06 2025 >> started Thu Feb 13 23:24:27 2025 >> done (21.050s) 18078950 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 2042 ( 0.01%) empty read pairs filtered out after trimming by size control 18076883 (99.99%) read pairs available; of these: 527721 ( 2.92%) trimmed read pairs available after processing 17549162 (97.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 10 0.00% 21 6 0.00% 22 1 0.00% 23 8 0.00% 24 7 0.00% 25 6 0.00% 26 3 0.00% 27 5 0.00% 28 10 0.00% 29 4 0.00% 30 9 0.00% 31 17 0.00% 32 9 0.00% 33 7 0.00% 34 11 0.00% 35 12 0.00% 36 19 0.00% 37 7 0.00% 38 9 0.00% 39 18 0.00% 40 12 0.00% 41 16 0.00% 42 7 0.00% 43 11 0.00% 44 16 0.00% 45 11 0.00% 46 14 0.00% 47 22 0.00% 48 23 0.00% 49 18 0.00% 50 25 0.00% 51 24 0.00% 52 28 0.00% 53 17 0.00% 54 29 0.00% 55 27 0.00% 56 25 0.00% 57 25 0.00% 58 34 0.00% 59 31 0.00% 60 51 0.00% 61 45 0.00% 62 49 0.00% 63 59 0.00% 64 57 0.00% 65 63 0.00% 66 53 0.00% 67 77 0.00% 68 83 0.00% 69 81 0.00% 70 109 0.00% 71 128 0.00% 72 127 0.00% 73 116 0.00% 74 157 0.00% 75 144 0.00% 76 198 0.00% 77 220 0.00% 78 238 0.00% 79 283 0.00% 80 256 0.00% 81 322 0.00% 82 356 0.00% 83 397 0.00% 84 472 0.00% 85 539 0.00% 86 550 0.00% 87 594 0.00% 88 695 0.00% 89 741 0.00% 90 802 0.00% 91 858 0.00% 92 973 0.01% 93 1147 0.01% 94 1201 0.01% 95 1359 0.01% 96 1534 0.01% 97 1610 0.01% 98 1783 0.01% 99 1891 0.01% 100 1916 0.01% 101 2226 0.01% 102 2380 0.01% 103 2601 0.01% 104 2783 0.02% 105 3046 0.02% 106 3253 0.02% 107 3538 0.02% 108 3662 0.02% 109 3887 0.02% 110 4111 0.02% 111 4409 0.02% 112 4717 0.03% 113 4779 0.03% 114 5206 0.03% 115 5519 0.03% 116 5629 0.03% 117 6005 0.03% 118 6368 0.04% 119 6748 0.04% 120 7041 0.04% 121 7302 0.04% 122 7587 0.04% 123 8220 0.05% 124 8387 0.05% 125 8893 0.05% 126 9339 0.05% 127 9577 0.05% 128 9920 0.05% 129 10335 0.06% 130 10908 0.06% 131 11218 0.06% 132 11753 0.07% 133 12338 0.07% 134 12677 0.07% 135 12998 0.07% 136 13874 0.08% 137 13928 0.08% 138 14429 0.08% 139 15471 0.09% 140 15744 0.09% 141 16243 0.09% 142 16956 0.09% 143 17741 0.10% 144 18362 0.10% 145 19081 0.11% 146 19337 0.11% 147 19966 0.11% 148 20749 0.11% 149 21318 0.12% 150 22231 0.12% 151 17549162 97.08% 18076883 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.72 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=66.10 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=20 prefix-density=0.87 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=36.28 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=6.3 sequence=AAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR12161445 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:25:07 Started mapping on | Feb 13 23:25:07 Finished on | Feb 13 23:26:47 Mapping speed, Million of reads per hour | 650.77 Number of input reads | 18076883 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17177178 Uniquely mapped reads % | 95.02% Average mapped length | 299.79 Number of splices: Total | 17183410 Number of splices: Annotated (sjdb) | 16848362 Number of splices: GT/AG | 16836236 Number of splices: GC/AG | 296884 Number of splices: AT/AC | 12188 Number of splices: Non-canonical | 38102 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484256 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 84301 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415449 415449 415449 N_multimapping 484256 484256 484256 N_noFeature 487029 17000471 542104 N_ambiguous 247581 885 125436 UnstrandedReadsAssigned:16442568 PositiveStrandReadsAssigned:175822 NegativeStrandReadsAssigned:16509638 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161445-trimmed-pair1.fastq SRR12161445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,076,883 reads, 16,623,381 reads pseudoaligned [quant] estimated average fragment length: 289.419 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12161445.ke.tsv 34699 SRR12161445.se.tsv 87100 total ==> SRR12161445.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.58 343 10.7906 Potri.005G024800.1.v4.1 1035 746.581 120 8.74578 Potri.004G059700.1.v4.1 961 672.747 52 4.20577 Potri.007G009000.2.v4.1 1416 1127.58 0 0 Potri.003G141000.2.v4.1 2943 2654.58 427.194 8.75636 Potri.016G087400.1.v4.1 270 62.7206 1227.77 1065.12 Potri.015G069301.1.v4.1 564 290.034 0 0 Potri.010G195200.1.v4.1 1773 1484.58 6 0.219908 Potri.012G127500.1.v4.1 977 688.681 1059 83.6704 ==> SRR12161445.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 98 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 283 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12161445 completed mapping pipeline successfully