Starting /dee2/code/volunteer_pipeline.sh SRR12161446 current disk space = 3089249767424 free memory = 1445674076 SRR12161446 SRAfilesize 3c276bea4d33d02cdb28a557bb77a9ce SRR12161446.sra SRR12161446.sra file validated SRR12161446 is paired end SRR12161446 is conventional basespace SRR12161446 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.569 37.0 37.0 37.0 37.0 37.0 2 36.4555 37.0 37.0 37.0 37.0 37.0 3 36.486 37.0 37.0 37.0 37.0 37.0 4 36.5835 37.0 37.0 37.0 37.0 37.0 5 36.537 37.0 37.0 37.0 37.0 37.0 6 36.551 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.528 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.562599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5184 37.0 37.0 37.0 37.0 37.0 20-24 36.4832 37.0 37.0 37.0 37.0 37.0 25-29 36.4873 37.0 37.0 37.0 37.0 37.0 30-34 36.4319 37.0 37.0 37.0 37.0 37.0 35-39 36.4224 37.0 37.0 37.0 37.0 37.0 40-44 36.422700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.373400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.35690000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3726 37.0 37.0 37.0 37.0 37.0 60-64 36.344100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3797 37.0 37.0 37.0 37.0 37.0 70-74 36.32940000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.267199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2864 37.0 37.0 37.0 37.0 37.0 85-89 36.282000000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.304899999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.27210000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1796 37.0 37.0 37.0 37.0 37.0 105-109 36.1425 37.0 37.0 37.0 37.0 37.0 110-114 36.1526 37.0 37.0 37.0 37.0 37.0 115-119 36.137899999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.1241 37.0 37.0 37.0 37.0 37.0 125-129 36.0827 37.0 37.0 37.0 37.0 37.0 130-134 36.078399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.977000000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.001400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.868300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.8065 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 7.0 27 5.0 28 12.0 29 21.0 30 16.0 31 41.0 32 39.0 33 80.0 34 118.0 35 285.0 36 2960.0 37 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.52326163081541 12.131065532766383 5.102551275637819 36.24312156078039 2 20.175 12.375 35.35 32.1 3 16.35 16.650000000000002 27.250000000000004 39.75 4 21.75 25.35 24.675 28.225 5 23.3 30.625000000000004 24.75 21.325 6 21.2 34.9 23.025000000000002 20.875 7 15.55 26.35 42.1 16.0 8 16.825000000000003 27.0 32.074999999999996 24.099999999999998 9 16.75 25.25 33.975 24.025 10-14 19.66 30.159999999999997 27.084999999999997 23.095 15-19 20.32 28.38 27.544999999999998 23.755000000000003 20-24 20.16 28.815 27.21 23.815 25-29 20.0 28.205000000000002 28.535 23.26 30-34 19.900000000000002 28.43 27.565 24.104999999999997 35-39 19.67 28.705000000000002 27.675 23.95 40-44 20.200000000000003 28.665000000000003 27.565 23.57 45-49 19.735 29.13 26.935 24.2 50-54 20.294999999999998 28.27 27.505000000000003 23.93 55-59 20.225 28.275 27.245 24.255 60-64 20.07 29.01 26.715 24.205 65-69 19.755 27.85 27.889999999999997 24.505 70-74 19.905 28.835 27.500000000000004 23.76 75-79 19.98 27.715 27.825 24.48 80-84 20.150000000000002 28.68 27.060000000000002 24.11 85-89 20.415 28.04 27.48 24.065 90-94 20.07 28.075 27.644999999999996 24.21 95-99 20.419999999999998 28.175 27.229999999999997 24.175 100-104 19.825 28.365000000000002 27.49 24.32 105-109 20.65 27.950000000000003 27.405 23.995 110-114 20.47 27.905 28.305000000000003 23.32 115-119 20.405 27.76 27.889999999999997 23.945 120-124 20.745 28.405 27.245 23.605 125-129 20.745 27.884999999999998 27.589999999999996 23.78 130-134 20.44 28.235 27.63 23.695 135-139 21.05 27.875 27.994999999999997 23.080000000000002 140-144 21.029999999999998 28.025 27.665 23.28 145-149 20.965 27.3 27.88 23.855 150-151 20.275000000000002 27.700000000000003 28.15 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 3.0 27 8.0 28 10.0 29 12.0 30 18.0 31 20.0 32 26.0 33 34.5 34 46.0 35 71.0 36 89.0 37 98.0 38 118.5 39 157.0 40 170.0 41 196.5 42 236.5 43 244.5 44 260.5 45 284.5 46 278.0 47 249.5 48 230.5 49 222.5 50 195.0 51 149.0 52 130.5 53 109.5 54 85.0 55 65.5 56 47.0 57 32.5 58 20.5 59 19.5 60 17.5 61 10.5 62 7.0 63 6.5 64 4.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.11297950604309 90.5 2 4.676826064109301 8.9 3 0.21019442984760903 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.9874999999999999 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.4875 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.8 0.0 0.0 0.0 0.0 138-139 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTG 10 0.006830828 145.0 2 GCAGGAT 10 0.006830828 145.0 1 GATCAAC 10 0.006830828 145.0 6 >>END_MODULE SRR12161446 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3725 37.0 37.0 37.0 37.0 37.0 2 35.9885 37.0 37.0 37.0 37.0 37.0 3 36.0855 37.0 37.0 37.0 37.0 37.0 4 36.026 37.0 37.0 37.0 37.0 37.0 5 36.2385 37.0 37.0 37.0 37.0 37.0 6 36.105 37.0 37.0 37.0 37.0 37.0 7 36.174 37.0 37.0 37.0 37.0 37.0 8 36.3 37.0 37.0 37.0 37.0 37.0 9 36.2635 37.0 37.0 37.0 37.0 37.0 10-14 36.2496 37.0 37.0 37.0 37.0 37.0 15-19 36.2307 37.0 37.0 37.0 37.0 37.0 20-24 36.174 37.0 37.0 37.0 37.0 37.0 25-29 36.107600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.117399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.114999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0855 37.0 37.0 37.0 37.0 37.0 45-49 36.0327 37.0 37.0 37.0 37.0 37.0 50-54 36.0481 37.0 37.0 37.0 37.0 37.0 55-59 35.9808 37.0 37.0 37.0 37.0 37.0 60-64 36.0195 37.0 37.0 37.0 37.0 37.0 65-69 35.9908 37.0 37.0 37.0 37.0 37.0 70-74 35.907 37.0 37.0 37.0 37.0 37.0 75-79 35.8206 37.0 37.0 37.0 37.0 37.0 80-84 35.870999999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.877599999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8883 37.0 37.0 37.0 37.0 37.0 95-99 35.8342 37.0 37.0 37.0 37.0 37.0 100-104 35.8506 37.0 37.0 37.0 37.0 37.0 105-109 35.8232 37.0 37.0 37.0 37.0 37.0 110-114 35.784800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7593 37.0 37.0 37.0 37.0 37.0 120-124 35.742200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.572500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5167 37.0 37.0 37.0 37.0 37.0 135-139 35.6182 37.0 37.0 37.0 37.0 37.0 140-144 35.534 37.0 37.0 37.0 37.0 37.0 145-149 35.5433 37.0 37.0 37.0 37.0 37.0 150-151 35.013000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 6.0 15 0.0 16 1.0 17 2.0 18 2.0 19 1.0 20 0.0 21 7.0 22 2.0 23 3.0 24 2.0 25 4.0 26 8.0 27 12.0 28 18.0 29 25.0 30 16.0 31 38.0 32 56.0 33 109.0 34 188.0 35 570.0 36 2676.0 37 251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 25.1 7.675 24.2 2 27.0 28.050000000000004 29.75 15.2 3 19.975 28.4 32.175 19.45 4 22.625 34.849999999999994 23.549999999999997 18.975 5 24.675 37.7 21.4 16.225 6 21.05 39.675 21.099999999999998 18.175 7 19.625 23.325000000000003 36.85 20.200000000000003 8 20.05 26.424999999999997 28.499999999999996 25.025 9 21.125 24.925 31.3 22.650000000000002 10-14 22.725 29.4 26.505000000000003 21.37 15-19 22.845 28.225 28.01 20.919999999999998 20-24 22.689999999999998 29.335 27.525 20.45 25-29 22.900000000000002 28.544999999999998 27.51 21.044999999999998 30-34 23.22 27.965 27.560000000000002 21.255 35-39 22.535 28.735 27.405 21.325 40-44 23.080000000000002 28.38 27.575 20.965 45-49 22.86 28.299999999999997 27.584999999999997 21.255 50-54 23.39 27.705000000000002 27.775 21.13 55-59 23.455000000000002 28.105000000000004 27.42 21.02 60-64 23.665 27.595 27.71 21.029999999999998 65-69 23.115 27.939999999999998 27.87 21.075 70-74 23.05 27.889999999999997 27.865000000000002 21.195 75-79 22.505 28.084999999999997 27.82 21.59 80-84 23.03 27.735 27.639999999999997 21.595 85-89 23.395 27.534999999999997 27.794999999999998 21.275 90-94 23.28 27.650000000000002 27.71 21.36 95-99 23.405 27.889999999999997 27.900000000000002 20.805 100-104 23.425 27.900000000000002 27.785 20.89 105-109 23.474999999999998 27.785 27.689999999999998 21.05 110-114 23.974999999999998 28.505000000000003 27.0 20.52 115-119 23.895 27.905 27.584999999999997 20.615 120-124 24.425 27.52 27.26 20.794999999999998 125-129 23.79 27.810000000000002 27.615000000000002 20.785 130-134 23.535 27.73 27.700000000000003 21.035 135-139 23.805 27.994999999999997 28.02 20.18 140-144 24.25 27.810000000000002 27.175 20.765 145-149 24.42 27.744999999999997 27.35 20.485 150-151 24.0125 27.037499999999998 27.787499999999998 21.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 3.5 26 6.0 27 6.0 28 7.0 29 10.0 30 14.0 31 22.0 32 32.5 33 36.0 34 46.0 35 68.0 36 87.5 37 106.0 38 135.0 39 155.0 40 170.5 41 209.5 42 244.0 43 282.5 44 293.0 45 290.5 46 282.5 47 247.0 48 233.0 49 209.5 50 162.5 51 121.0 52 96.0 53 83.0 54 76.5 55 57.5 56 46.5 57 40.0 58 27.0 59 23.0 60 17.0 61 9.5 62 5.0 63 6.0 64 6.0 65 2.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.88126649076517 89.9 2 4.749340369393139 9.0 3 0.31662269129287596 0.8999999999999999 4 0.05277044854881266 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.5125 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 2.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCTC 10 0.006830828 145.0 5 GGGAAAT 10 0.006830828 145.0 1 GGCAGAA 10 0.006830828 145.0 9 TGAAATA 10 0.006830828 145.0 3 >>END_MODULE Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815021 spots for SRR12161446.sra Written 815021 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra Read 815016 spots for SRR12161446.sra Written 815016 spots for SRR12161446.sra SRR ids: ['SRR12161446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7_kn676 SRR12161446.sra spots: 16300325 blocks: [[1, 815016], [815017, 1630032], [1630033, 2445048], [2445049, 3260064], [3260065, 4075080], [4075081, 4890096], [4890097, 5705112], [5705113, 6520128], [6520129, 7335144], [7335145, 8150160], [8150161, 8965176], [8965177, 9780192], [9780193, 10595208], [10595209, 11410224], [11410225, 12225240], [12225241, 13040256], [13040257, 13855272], [13855273, 14670288], [14670289, 15485304], [15485305, 16300325]] SRR12161446 file size 5517863 SRR12161446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161446 SRR12161446_1.fastq SRR12161446_2.fastq Input file: SRR12161446_1.fastq Paired file: SRR12161446_2.fastq trimmed: SRR12161446-trimmed-pair1.fastq, SRR12161446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:50:18 2025 >> started Thu Feb 13 22:50:35 2025 >> done (17.119s) 16300325 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 1223 ( 0.01%) empty read pairs filtered out after trimming by size control 16299077 (99.99%) read pairs available; of these: 588139 ( 3.61%) trimmed read pairs available after processing 15710938 (96.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 8 0.00% 24 6 0.00% 25 4 0.00% 26 2 0.00% 27 11 0.00% 28 10 0.00% 29 9 0.00% 30 10 0.00% 31 15 0.00% 32 13 0.00% 33 16 0.00% 34 8 0.00% 35 9 0.00% 36 10 0.00% 37 16 0.00% 38 18 0.00% 39 15 0.00% 40 12 0.00% 41 12 0.00% 42 9 0.00% 43 14 0.00% 44 12 0.00% 45 15 0.00% 46 14 0.00% 47 21 0.00% 48 20 0.00% 49 29 0.00% 50 15 0.00% 51 20 0.00% 52 25 0.00% 53 16 0.00% 54 29 0.00% 55 19 0.00% 56 36 0.00% 57 28 0.00% 58 42 0.00% 59 41 0.00% 60 39 0.00% 61 40 0.00% 62 58 0.00% 63 74 0.00% 64 73 0.00% 65 67 0.00% 66 74 0.00% 67 91 0.00% 68 82 0.00% 69 88 0.00% 70 125 0.00% 71 112 0.00% 72 141 0.00% 73 173 0.00% 74 199 0.00% 75 202 0.00% 76 200 0.00% 77 257 0.00% 78 288 0.00% 79 281 0.00% 80 351 0.00% 81 403 0.00% 82 407 0.00% 83 509 0.00% 84 543 0.00% 85 607 0.00% 86 647 0.00% 87 706 0.00% 88 827 0.01% 89 909 0.01% 90 983 0.01% 91 1142 0.01% 92 1194 0.01% 93 1327 0.01% 94 1510 0.01% 95 1683 0.01% 96 1770 0.01% 97 1876 0.01% 98 1973 0.01% 99 2269 0.01% 100 2465 0.02% 101 2606 0.02% 102 2840 0.02% 103 3062 0.02% 104 3297 0.02% 105 3470 0.02% 106 3808 0.02% 107 3992 0.02% 108 4229 0.03% 109 4439 0.03% 110 4599 0.03% 111 4930 0.03% 112 5207 0.03% 113 5528 0.03% 114 5952 0.04% 115 6167 0.04% 116 6559 0.04% 117 6787 0.04% 118 7232 0.04% 119 7483 0.05% 120 7744 0.05% 121 8191 0.05% 122 8718 0.05% 123 9144 0.06% 124 9730 0.06% 125 9777 0.06% 126 10223 0.06% 127 11048 0.07% 128 11274 0.07% 129 11832 0.07% 130 12098 0.07% 131 12532 0.08% 132 13087 0.08% 133 13837 0.08% 134 14073 0.09% 135 14524 0.09% 136 15154 0.09% 137 15591 0.10% 138 16077 0.10% 139 16806 0.10% 140 17311 0.11% 141 17953 0.11% 142 18459 0.11% 143 19294 0.12% 144 20141 0.12% 145 20864 0.13% 146 21117 0.13% 147 22231 0.14% 148 22710 0.14% 149 23000 0.14% 150 24024 0.15% 151 15710938 96.39% 16299077 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=12.20 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.7 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=2.3 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=102.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12161446 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:51:36 Started mapping on | Feb 13 22:51:37 Finished on | Feb 13 22:53:09 Mapping speed, Million of reads per hour | 637.79 Number of input reads | 16299077 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14873740 Uniquely mapped reads % | 91.26% Average mapped length | 291.65 Number of splices: Total | 15154061 Number of splices: Annotated (sjdb) | 14835180 Number of splices: GT/AG | 14846953 Number of splices: GC/AG | 248957 Number of splices: AT/AC | 10879 Number of splices: Non-canonical | 47272 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340610 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 34902 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.34% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1084727 1084727 1084727 N_multimapping 340610 340610 340610 N_noFeature 521525 14704721 570781 N_ambiguous 234240 912 113909 UnstrandedReadsAssigned:14117975 PositiveStrandReadsAssigned:168107 NegativeStrandReadsAssigned:14189050 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12161446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161446-trimmed-pair1.fastq SRR12161446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,299,077 reads, 14,648,109 reads pseudoaligned [quant] estimated average fragment length: 281.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR12161446.ke.tsv 34699 SRR12161446.se.tsv 87100 total ==> SRR12161446.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.29 451 16.2218 Potri.005G024800.1.v4.1 1035 754.288 439 36.3681 Potri.004G059700.1.v4.1 961 680.488 54 4.95869 Potri.007G009000.2.v4.1 1416 1135.29 0 0 Potri.003G141000.2.v4.1 2943 2662.29 640 15.0217 Potri.016G087400.1.v4.1 270 70.8553 432 380.983 Potri.015G069301.1.v4.1 564 298.922 0 0 Potri.010G195200.1.v4.1 1773 1492.29 23 0.963094 Potri.012G127500.1.v4.1 977 696.366 352 31.5863 ==> SRR12161446.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 151 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 13 SRR12161446 completed mapping pipeline successfully