Starting /dee2/code/volunteer_pipeline.sh SRR12161447 current disk space = 3089326653440 free memory = 1582256396 SRR12161447 SRAfilesize 3f9722f096dc4ecd5ab8a4c9f69a5751 SRR12161447.sra SRR12161447.sra file validated SRR12161447 is paired end SRR12161447 is conventional basespace SRR12161447 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.49075 37.0 37.0 37.0 37.0 37.0 2 36.369 37.0 37.0 37.0 37.0 37.0 3 36.495 37.0 37.0 37.0 37.0 37.0 4 36.602 37.0 37.0 37.0 37.0 37.0 5 36.5505 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.478 37.0 37.0 37.0 37.0 37.0 8 36.5325 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.5743 37.0 37.0 37.0 37.0 37.0 15-19 36.562400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4951 37.0 37.0 37.0 37.0 37.0 25-29 36.472500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.483399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4205 37.0 37.0 37.0 37.0 37.0 40-44 36.396300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3812 37.0 37.0 37.0 37.0 37.0 50-54 36.3663 37.0 37.0 37.0 37.0 37.0 55-59 36.3242 37.0 37.0 37.0 37.0 37.0 60-64 36.328500000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3232 37.0 37.0 37.0 37.0 37.0 70-74 36.3163 37.0 37.0 37.0 37.0 37.0 75-79 36.3259 37.0 37.0 37.0 37.0 37.0 80-84 36.3113 37.0 37.0 37.0 37.0 37.0 85-89 36.3049 37.0 37.0 37.0 37.0 37.0 90-94 36.3029 37.0 37.0 37.0 37.0 37.0 95-99 36.2764 37.0 37.0 37.0 37.0 37.0 100-104 36.2037 37.0 37.0 37.0 37.0 37.0 105-109 36.1457 37.0 37.0 37.0 37.0 37.0 110-114 36.1716 37.0 37.0 37.0 37.0 37.0 115-119 36.166000000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.10209999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.066100000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.0501 37.0 37.0 37.0 37.0 37.0 135-139 35.9995 37.0 37.0 37.0 37.0 37.0 140-144 35.9625 37.0 37.0 37.0 37.0 37.0 145-149 35.9801 37.0 37.0 37.0 37.0 37.0 150-151 35.851749999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 1.0 26 3.0 27 8.0 28 9.0 29 18.0 30 22.0 31 36.0 32 65.0 33 72.0 34 104.0 35 288.0 36 2963.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.04881101376721 12.215269086357948 6.357947434292866 42.377972465581976 2 19.35 13.200000000000001 35.275 32.175 3 15.950000000000001 14.399999999999999 28.425 41.225 4 21.8 23.775 22.75 31.674999999999997 5 23.25 29.049999999999997 25.5 22.2 6 20.75 33.650000000000006 24.175 21.425 7 15.4 26.75 41.875 15.975 8 18.675 24.8 32.5 24.025 9 18.05 23.65 34.35 23.95 10-14 19.48 29.965000000000003 27.855 22.7 15-19 19.425 27.944999999999997 28.155 24.474999999999998 20-24 19.98 28.49 27.775 23.755000000000003 25-29 19.99 28.134999999999998 28.22 23.655 30-34 19.865 28.555000000000003 27.51 24.07 35-39 19.96 28.125 27.325 24.59 40-44 20.32 28.435 27.455000000000002 23.79 45-49 20.13 28.37 27.62 23.880000000000003 50-54 20.24 28.04 27.815 23.905 55-59 20.235 28.000000000000004 28.025 23.74 60-64 20.09 27.400000000000002 27.99 24.52 65-69 19.375 27.715 28.765 24.145 70-74 20.375 27.96 27.93 23.735 75-79 19.975 28.27 27.744999999999997 24.01 80-84 19.945 28.410000000000004 27.54 24.104999999999997 85-89 20.335 27.950000000000003 27.615000000000002 24.099999999999998 90-94 20.22 28.33 27.415 24.035 95-99 20.27 27.625 27.82 24.285 100-104 20.0 27.855 27.98 24.165 105-109 20.66 27.505000000000003 27.85 23.985 110-114 20.54 27.900000000000002 28.125 23.435 115-119 20.585 28.17 27.805000000000003 23.44 120-124 20.275000000000002 27.47 28.675 23.580000000000002 125-129 20.555 28.17 27.235 24.04 130-134 20.424999999999997 27.950000000000003 28.194999999999997 23.43 135-139 20.7 27.435 28.060000000000002 23.805 140-144 20.580000000000002 27.700000000000003 27.389999999999997 24.33 145-149 20.150000000000002 27.875 27.96 24.015 150-151 20.8 27.775 27.650000000000002 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 5.0 26 6.0 27 5.5 28 8.5 29 12.0 30 17.0 31 25.0 32 30.0 33 33.5 34 44.5 35 65.5 36 85.0 37 99.5 38 131.5 39 150.5 40 166.5 41 205.5 42 237.5 43 258.0 44 254.5 45 246.5 46 261.5 47 271.0 48 241.5 49 220.5 50 198.0 51 158.0 52 118.5 53 99.0 54 92.0 55 67.5 56 50.5 57 35.0 58 19.0 59 18.5 60 16.5 61 7.5 62 8.0 63 7.0 64 5.5 65 4.5 66 1.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.47942276857295 87.45 2 6.226616782469268 11.65 3 0.26723677177979693 0.75 4 0.0 0.0 5 0.0 0.0 6 0.026723677177979688 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGACTCCCTACGCCACACACATGACGGTTTACGTGCTTAATACGTGCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161447 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.326 37.0 37.0 37.0 37.0 37.0 2 36.057 37.0 37.0 37.0 37.0 37.0 3 36.007 37.0 37.0 37.0 37.0 37.0 4 36.171 37.0 37.0 37.0 37.0 37.0 5 36.0655 37.0 37.0 37.0 37.0 37.0 6 36.1845 37.0 37.0 37.0 37.0 37.0 7 36.1565 37.0 37.0 37.0 37.0 37.0 8 36.167 37.0 37.0 37.0 37.0 37.0 9 36.224 37.0 37.0 37.0 37.0 37.0 10-14 36.269800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.245799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2198 37.0 37.0 37.0 37.0 37.0 25-29 36.169 37.0 37.0 37.0 37.0 37.0 30-34 36.1693 37.0 37.0 37.0 37.0 37.0 35-39 36.1431 37.0 37.0 37.0 37.0 37.0 40-44 36.126799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0243 37.0 37.0 37.0 37.0 37.0 50-54 36.051100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.0493 37.0 37.0 37.0 37.0 37.0 60-64 36.0138 37.0 37.0 37.0 37.0 37.0 65-69 35.997 37.0 37.0 37.0 37.0 37.0 70-74 35.9113 37.0 37.0 37.0 37.0 37.0 75-79 35.9051 37.0 37.0 37.0 37.0 37.0 80-84 35.955799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9057 37.0 37.0 37.0 37.0 37.0 90-94 35.8611 37.0 37.0 37.0 37.0 37.0 95-99 35.89919999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.872 37.0 37.0 37.0 37.0 37.0 105-109 35.789100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7389 37.0 37.0 37.0 37.0 37.0 115-119 35.752100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.770599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6827 37.0 37.0 37.0 37.0 37.0 130-134 35.574 37.0 37.0 37.0 37.0 37.0 135-139 35.615700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5751 37.0 37.0 37.0 37.0 37.0 145-149 35.587900000000005 37.0 37.0 37.0 37.0 37.0 150-151 34.96925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 3.0 22 3.0 23 8.0 24 4.0 25 8.0 26 8.0 27 10.0 28 9.0 29 19.0 30 29.0 31 51.0 32 66.0 33 93.0 34 188.0 35 583.0 36 2668.0 37 246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 26.275 9.15 26.900000000000002 2 26.525 28.299999999999997 29.9 15.275 3 19.875 28.849999999999998 31.8 19.475 4 22.175 35.725 23.075000000000003 19.025 5 22.95 37.724999999999994 23.150000000000002 16.175 6 20.625 39.25 23.425 16.7 7 19.7 24.099999999999998 36.025 20.175 8 20.8 27.750000000000004 27.800000000000004 23.65 9 20.599999999999998 25.324999999999996 31.574999999999996 22.5 10-14 23.135 29.735 25.935000000000002 21.195 15-19 22.725 29.01 27.725 20.54 20-24 23.294999999999998 28.465 28.04 20.200000000000003 25-29 22.825 28.134999999999998 28.305000000000003 20.735 30-34 22.56 28.175 27.965 21.3 35-39 22.2 29.020000000000003 28.28 20.5 40-44 22.845 28.825 27.455000000000002 20.875 45-49 23.395 27.87 27.72 21.015 50-54 22.805 28.349999999999998 27.715 21.13 55-59 23.48 28.505000000000003 27.38 20.635 60-64 22.655 27.35 28.7 21.295 65-69 23.535 28.050000000000004 27.67 20.745 70-74 23.62 27.88 27.115000000000002 21.385 75-79 23.1 28.355000000000004 26.91 21.634999999999998 80-84 22.485 28.345 27.595 21.575 85-89 23.34 28.265 27.485 20.91 90-94 23.080000000000002 28.96 27.015 20.945 95-99 23.02 28.139999999999997 27.534999999999997 21.305 100-104 23.705000000000002 28.815 26.97 20.51 105-109 23.244999999999997 27.255000000000003 28.310000000000002 21.19 110-114 23.175 28.415000000000003 27.560000000000002 20.849999999999998 115-119 23.474999999999998 28.58 26.995 20.95 120-124 23.955000000000002 28.384999999999998 27.189999999999998 20.47 125-129 23.599999999999998 27.665 27.625 21.11 130-134 23.615 28.075 27.185 21.125 135-139 23.765 27.865000000000002 28.134999999999998 20.235 140-144 24.14 27.529999999999998 28.09 20.24 145-149 24.41 28.415000000000003 27.534999999999997 19.64 150-151 24.087500000000002 28.000000000000004 27.1375 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.5 21 2.0 22 2.0 23 4.0 24 3.0 25 3.0 26 6.0 27 8.0 28 7.0 29 8.0 30 15.5 31 24.5 32 33.5 33 39.0 34 50.5 35 66.5 36 82.0 37 108.0 38 138.5 39 164.5 40 190.5 41 233.0 42 263.5 43 276.0 44 271.5 45 276.0 46 277.5 47 244.5 48 228.0 49 198.0 50 158.5 51 129.0 52 101.5 53 94.0 54 80.0 55 50.5 56 34.0 57 30.0 58 23.5 59 17.5 60 14.5 61 10.5 62 9.0 63 6.0 64 2.0 65 1.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.76838726932336 87.64999999999999 2 5.776945707408398 10.8 3 0.3476865472051351 0.975 4 0.08023535704733886 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02674511901577962 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTT 10 0.006830828 145.0 4 >>END_MODULE Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010522 spots for SRR12161447.sra Written 1010522 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra Read 1010519 spots for SRR12161447.sra Written 1010519 spots for SRR12161447.sra SRR ids: ['SRR12161447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w3j3ck6v SRR12161447.sra spots: 20210383 blocks: [[1, 1010519], [1010520, 2021038], [2021039, 3031557], [3031558, 4042076], [4042077, 5052595], [5052596, 6063114], [6063115, 7073633], [7073634, 8084152], [8084153, 9094671], [9094672, 10105190], [10105191, 11115709], [11115710, 12126228], [12126229, 13136747], [13136748, 14147266], [14147267, 15157785], [15157786, 16168304], [16168305, 17178823], [17178824, 18189342], [18189343, 19199861], [19199862, 20210383]] SRR12161447 file size 6846671 SRR12161447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161447 SRR12161447_1.fastq SRR12161447_2.fastq Input file: SRR12161447_1.fastq Paired file: SRR12161447_2.fastq trimmed: SRR12161447-trimmed-pair1.fastq, SRR12161447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:47:28 2025 >> started Thu Feb 13 23:47:50 2025 >> done (21.688s) 20210383 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 2761 ( 0.01%) empty read pairs filtered out after trimming by size control 20207603 (99.99%) read pairs available; of these: 616832 ( 3.05%) trimmed read pairs available after processing 19590771 (96.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 9 0.00% 26 7 0.00% 27 5 0.00% 28 7 0.00% 29 10 0.00% 30 9 0.00% 31 7 0.00% 32 15 0.00% 33 8 0.00% 34 10 0.00% 35 8 0.00% 36 9 0.00% 37 15 0.00% 38 19 0.00% 39 13 0.00% 40 14 0.00% 41 7 0.00% 42 9 0.00% 43 14 0.00% 44 19 0.00% 45 10 0.00% 46 18 0.00% 47 14 0.00% 48 17 0.00% 49 29 0.00% 50 26 0.00% 51 25 0.00% 52 26 0.00% 53 21 0.00% 54 37 0.00% 55 17 0.00% 56 29 0.00% 57 33 0.00% 58 46 0.00% 59 44 0.00% 60 33 0.00% 61 42 0.00% 62 53 0.00% 63 49 0.00% 64 59 0.00% 65 57 0.00% 66 75 0.00% 67 83 0.00% 68 73 0.00% 69 83 0.00% 70 113 0.00% 71 131 0.00% 72 128 0.00% 73 158 0.00% 74 155 0.00% 75 192 0.00% 76 180 0.00% 77 211 0.00% 78 270 0.00% 79 262 0.00% 80 316 0.00% 81 367 0.00% 82 386 0.00% 83 429 0.00% 84 534 0.00% 85 517 0.00% 86 615 0.00% 87 671 0.00% 88 776 0.00% 89 869 0.00% 90 954 0.00% 91 1101 0.01% 92 1175 0.01% 93 1310 0.01% 94 1485 0.01% 95 1555 0.01% 96 1699 0.01% 97 1829 0.01% 98 1998 0.01% 99 2200 0.01% 100 2414 0.01% 101 2540 0.01% 102 2749 0.01% 103 2902 0.01% 104 3190 0.02% 105 3433 0.02% 106 3675 0.02% 107 3887 0.02% 108 4245 0.02% 109 4449 0.02% 110 4683 0.02% 111 4945 0.02% 112 5359 0.03% 113 5615 0.03% 114 6078 0.03% 115 6403 0.03% 116 6755 0.03% 117 6919 0.03% 118 7404 0.04% 119 7579 0.04% 120 8156 0.04% 121 8649 0.04% 122 8863 0.04% 123 9434 0.05% 124 9816 0.05% 125 10281 0.05% 126 10839 0.05% 127 11294 0.06% 128 11889 0.06% 129 12104 0.06% 130 12585 0.06% 131 13217 0.07% 132 13607 0.07% 133 14441 0.07% 134 14719 0.07% 135 15574 0.08% 136 16271 0.08% 137 16474 0.08% 138 17088 0.08% 139 17843 0.09% 140 18662 0.09% 141 19223 0.10% 142 20200 0.10% 143 20521 0.10% 144 21549 0.11% 145 22157 0.11% 146 22940 0.11% 147 23633 0.12% 148 24775 0.12% 149 24904 0.12% 150 26089 0.13% 151 19590771 96.95% 20207603 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=8.84 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.2 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.75 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=27 fanout-score=13.49 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=4.4 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12161447 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:48:46 Started mapping on | Feb 13 23:48:47 Finished on | Feb 13 23:51:05 Mapping speed, Million of reads per hour | 527.15 Number of input reads | 20207603 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19265316 Uniquely mapped reads % | 95.34% Average mapped length | 299.65 Number of splices: Total | 20365080 Number of splices: Annotated (sjdb) | 19926113 Number of splices: GT/AG | 19969771 Number of splices: GC/AG | 324223 Number of splices: AT/AC | 13704 Number of splices: Non-canonical | 57382 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441791 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 89811 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 500496 500496 500496 N_multimapping 441791 441791 441791 N_noFeature 715122 18978565 797053 N_ambiguous 338575 1639 132626 UnstrandedReadsAssigned:18211619 PositiveStrandReadsAssigned:285112 NegativeStrandReadsAssigned:18335637 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161447-trimmed-pair1.fastq SRR12161447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,207,603 reads, 18,278,126 reads pseudoaligned [quant] estimated average fragment length: 288.569 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR12161447.ke.tsv 34699 SRR12161447.se.tsv 87100 total ==> SRR12161447.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.43 496 12.4809 Potri.005G024800.1.v4.1 1035 747.431 192 11.1853 Potri.004G059700.1.v4.1 961 673.633 29 1.87454 Potri.007G009000.2.v4.1 1416 1128.43 0 0 Potri.003G141000.2.v4.1 2943 2655.43 880.007 14.4301 Potri.016G087400.1.v4.1 270 62.6337 672 467.175 Potri.015G069301.1.v4.1 564 290.781 0 0 Potri.010G195200.1.v4.1 1773 1485.43 46 1.34842 Potri.012G127500.1.v4.1 977 689.556 209 13.1976 ==> SRR12161447.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161447 completed mapping pipeline successfully