Starting /dee2/code/volunteer_pipeline.sh SRR12161448 current disk space = 3089277075456 free memory = 1430783780 SRR12161448 SRAfilesize 2031b675f213e4a013f2e6ecdb6b8e4a SRR12161448.sra SRR12161448.sra file validated SRR12161448 is paired end SRR12161448 is conventional basespace SRR12161448 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50125 37.0 37.0 37.0 37.0 37.0 2 36.3625 37.0 37.0 37.0 37.0 37.0 3 36.497 37.0 37.0 37.0 37.0 37.0 4 36.494 37.0 37.0 37.0 37.0 37.0 5 36.4805 37.0 37.0 37.0 37.0 37.0 6 36.5235 37.0 37.0 37.0 37.0 37.0 7 36.4355 37.0 37.0 37.0 37.0 37.0 8 36.553 37.0 37.0 37.0 37.0 37.0 9 36.4615 37.0 37.0 37.0 37.0 37.0 10-14 36.5281 37.0 37.0 37.0 37.0 37.0 15-19 36.5342 37.0 37.0 37.0 37.0 37.0 20-24 36.518600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4163 37.0 37.0 37.0 37.0 37.0 30-34 36.4233 37.0 37.0 37.0 37.0 37.0 35-39 36.474399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.374900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.390499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.356399999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.3424 37.0 37.0 37.0 37.0 37.0 60-64 36.289100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.287099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2762 37.0 37.0 37.0 37.0 37.0 75-79 36.22239999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2834 37.0 37.0 37.0 37.0 37.0 85-89 36.177800000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2251 37.0 37.0 37.0 37.0 37.0 95-99 36.161699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1605 37.0 37.0 37.0 37.0 37.0 105-109 36.1342 37.0 37.0 37.0 37.0 37.0 110-114 36.116 37.0 37.0 37.0 37.0 37.0 115-119 36.0816 37.0 37.0 37.0 37.0 37.0 120-124 36.0366 37.0 37.0 37.0 37.0 37.0 125-129 36.0147 37.0 37.0 37.0 37.0 37.0 130-134 36.0009 37.0 37.0 37.0 37.0 37.0 135-139 35.9393 37.0 37.0 37.0 37.0 37.0 140-144 35.9035 37.0 37.0 37.0 37.0 37.0 145-149 35.88020000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.63775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 5.0 27 6.0 28 17.0 29 18.0 30 28.0 31 34.0 32 55.0 33 78.0 34 131.0 35 305.0 36 2933.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.48412103025757 10.927731932983246 6.476619154788697 46.111527881970495 2 18.224999999999998 12.55 37.275000000000006 31.95 3 16.3 15.25 27.650000000000002 40.8 4 21.275 22.45 24.099999999999998 32.175 5 23.400000000000002 28.125 25.15 23.325000000000003 6 20.724999999999998 33.225 24.025 22.025 7 15.15 26.700000000000003 41.625 16.525000000000002 8 18.975 24.75 32.35 23.925 9 18.4 22.125 34.825 24.65 10-14 19.805 29.87 27.54 22.785 15-19 20.505000000000003 27.805000000000003 27.32 24.37 20-24 19.689999999999998 28.02 27.815 24.474999999999998 25-29 19.545 27.889999999999997 27.689999999999998 24.875 30-34 20.555 27.55 27.735 24.16 35-39 19.8 27.925 27.450000000000003 24.825 40-44 20.369999999999997 28.084999999999997 27.215 24.33 45-49 20.84 27.589999999999996 27.315 24.255 50-54 20.880000000000003 27.415 27.26 24.445 55-59 20.53 27.3 27.46 24.709999999999997 60-64 20.0 27.465 28.01 24.525 65-69 20.155 27.07 27.994999999999997 24.779999999999998 70-74 20.06 28.000000000000004 27.455000000000002 24.485 75-79 20.25 27.334999999999997 27.61 24.805 80-84 20.22 27.605 27.505000000000003 24.67 85-89 20.135 27.76 27.29 24.815 90-94 20.19 27.485 27.665 24.66 95-99 20.200000000000003 27.615000000000002 28.07 24.115000000000002 100-104 20.27 27.66 27.805000000000003 24.265 105-109 20.25 27.6 27.96 24.19 110-114 20.645 27.375 27.655 24.325 115-119 20.46 27.985 27.639999999999997 23.915 120-124 20.77 27.365000000000002 27.474999999999998 24.39 125-129 20.855 27.47 27.33 24.345 130-134 20.72 27.315 27.575 24.39 135-139 20.919999999999998 27.345000000000002 27.49 24.245 140-144 20.79 27.675 27.13 24.404999999999998 145-149 20.919999999999998 27.63 27.275 24.175 150-151 20.3375 27.9375 27.450000000000003 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 5.0 27 5.0 28 4.5 29 9.0 30 13.0 31 20.0 32 29.5 33 38.0 34 49.5 35 68.5 36 83.5 37 94.0 38 111.5 39 152.0 40 179.0 41 182.5 42 211.0 43 238.5 44 242.5 45 243.5 46 242.0 47 244.0 48 235.0 49 207.0 50 198.5 51 173.5 52 138.0 53 117.0 54 91.5 55 82.0 56 70.0 57 52.5 58 40.5 59 35.0 60 28.5 61 18.0 62 13.0 63 7.5 64 5.0 65 3.0 66 1.5 67 2.5 68 2.0 69 1.0 70 1.0 71 0.0 72 0.0 73 1.5 74 1.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91033755274262 89.97500000000001 2 4.720464135021097 8.95 3 0.3428270042194093 0.975 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCACC 10 0.006830828 145.0 2 >>END_MODULE SRR12161448 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2325 37.0 37.0 37.0 37.0 37.0 2 35.9555 37.0 37.0 37.0 37.0 37.0 3 36.006 37.0 37.0 37.0 37.0 37.0 4 36.0715 37.0 37.0 37.0 37.0 37.0 5 36.1595 37.0 37.0 37.0 37.0 37.0 6 36.034 37.0 37.0 37.0 37.0 37.0 7 36.1265 37.0 37.0 37.0 37.0 37.0 8 36.2075 37.0 37.0 37.0 37.0 37.0 9 36.2345 37.0 37.0 37.0 37.0 37.0 10-14 36.25169999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.1927 37.0 37.0 37.0 37.0 37.0 20-24 36.116 37.0 37.0 37.0 37.0 37.0 25-29 36.0565 37.0 37.0 37.0 37.0 37.0 30-34 36.095099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0638 37.0 37.0 37.0 37.0 37.0 40-44 36.053799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.041199999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9956 37.0 37.0 37.0 37.0 37.0 55-59 35.9606 37.0 37.0 37.0 37.0 37.0 60-64 35.9868 37.0 37.0 37.0 37.0 37.0 65-69 35.963499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8273 37.0 37.0 37.0 37.0 37.0 75-79 35.8409 37.0 37.0 37.0 37.0 37.0 80-84 35.871 37.0 37.0 37.0 37.0 37.0 85-89 35.797399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.777699999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.759299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8204 37.0 37.0 37.0 37.0 37.0 105-109 35.75359999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7038 37.0 37.0 37.0 37.0 37.0 115-119 35.681200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.676100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5946 37.0 37.0 37.0 37.0 37.0 130-134 35.5387 37.0 37.0 37.0 37.0 37.0 135-139 35.5911 37.0 37.0 37.0 37.0 37.0 140-144 35.485 37.0 37.0 37.0 37.0 37.0 145-149 35.507799999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.923 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 2.0 16 3.0 17 1.0 18 0.0 19 2.0 20 1.0 21 0.0 22 3.0 23 3.0 24 5.0 25 9.0 26 9.0 27 13.0 28 18.0 29 21.0 30 30.0 31 45.0 32 47.0 33 134.0 34 212.0 35 601.0 36 2618.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.3 23.925 9.625 30.15 2 26.3 27.3 30.15 16.25 3 19.5 29.2 31.15 20.150000000000002 4 23.45 34.599999999999994 22.975 18.975 5 24.525 35.975 22.75 16.75 6 19.575 38.2 25.074999999999996 17.150000000000002 7 19.75 22.325 37.925 20.0 8 20.925 25.575 28.125 25.374999999999996 9 22.2 24.525 30.25 23.025000000000002 10-14 23.135 29.21 26.105 21.55 15-19 22.98 28.08 27.455000000000002 21.485000000000003 20-24 23.02 28.349999999999998 27.155 21.475 25-29 23.34 28.425 26.884999999999998 21.349999999999998 30-34 23.84 27.765 27.655 20.74 35-39 23.21 27.775 27.435 21.58 40-44 23.305 27.32 27.58 21.795 45-49 23.055 27.99 27.395000000000003 21.560000000000002 50-54 23.455000000000002 27.88 27.655 21.01 55-59 23.03 28.34 27.235 21.395 60-64 23.044999999999998 28.125 27.310000000000002 21.52 65-69 23.549999999999997 27.384999999999998 27.235 21.83 70-74 23.1 27.785 27.46 21.654999999999998 75-79 22.994999999999997 27.375 27.74 21.89 80-84 23.635 27.71 27.065 21.59 85-89 23.87 27.825 27.05 21.255 90-94 23.77 27.96 27.205000000000002 21.065 95-99 23.98 27.785 27.26 20.974999999999998 100-104 23.805 28.03 26.845000000000002 21.32 105-109 23.055 28.18 27.605 21.16 110-114 23.54 28.470000000000002 26.845000000000002 21.145 115-119 23.77 28.33 27.05 20.849999999999998 120-124 23.974999999999998 27.52 27.544999999999998 20.96 125-129 24.325 27.810000000000002 26.845000000000002 21.02 130-134 24.385 27.845 27.060000000000002 20.71 135-139 24.169999999999998 27.775 27.305 20.75 140-144 24.725 28.005000000000003 26.505000000000003 20.765 145-149 24.75 28.08 26.784999999999997 20.385 150-151 24.75 28.1375 26.200000000000003 20.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.5 20 1.0 21 1.0 22 3.5 23 4.5 24 2.5 25 6.5 26 9.0 27 7.5 28 8.0 29 12.0 30 18.0 31 21.5 32 28.5 33 36.5 34 41.0 35 61.0 36 81.0 37 101.0 38 127.0 39 158.0 40 197.0 41 210.0 42 226.5 43 236.5 44 242.0 45 255.5 46 255.0 47 235.5 48 223.0 49 212.5 50 167.0 51 129.0 52 114.5 53 100.5 54 84.5 55 66.5 56 50.5 57 52.0 58 46.5 59 34.5 60 26.5 61 23.5 62 26.0 63 14.5 64 5.0 65 3.5 66 2.5 67 3.0 68 2.5 69 2.5 70 1.5 71 0.5 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 1.0 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.23056653491436 90.35 2 4.2687747035573125 8.1 3 0.3952569169960474 1.125 4 0.07905138339920949 0.3 5 0.026350461133069828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCGGTGCCGCTCCACCGCCCCTTCTTCCCTTACCGTTCGTGCTGGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTT 10 0.006830828 145.0 3 >>END_MODULE Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638016 spots for SRR12161448.sra Written 638016 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra Read 638005 spots for SRR12161448.sra Written 638005 spots for SRR12161448.sra SRR ids: ['SRR12161448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1lb3fwow SRR12161448.sra spots: 12760111 blocks: [[1, 638005], [638006, 1276010], [1276011, 1914015], [1914016, 2552020], [2552021, 3190025], [3190026, 3828030], [3828031, 4466035], [4466036, 5104040], [5104041, 5742045], [5742046, 6380050], [6380051, 7018055], [7018056, 7656060], [7656061, 8294065], [8294066, 8932070], [8932071, 9570075], [9570076, 10208080], [10208081, 10846085], [10846086, 11484090], [11484091, 12122095], [12122096, 12760111]] SRR12161448 file size 4314743 SRR12161448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161448 SRR12161448_1.fastq SRR12161448_2.fastq Input file: SRR12161448_1.fastq Paired file: SRR12161448_2.fastq trimmed: SRR12161448-trimmed-pair1.fastq, SRR12161448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:51:16 2025 >> started Thu Feb 13 22:51:33 2025 >> done (17.359s) 12760111 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 706 ( 0.01%) empty read pairs filtered out after trimming by size control 12759398 (99.99%) read pairs available; of these: 627444 ( 4.92%) trimmed read pairs available after processing 12131954 (95.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 9 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 6 0.00% 30 2 0.00% 31 5 0.00% 32 5 0.00% 33 5 0.00% 34 7 0.00% 35 12 0.00% 36 7 0.00% 37 4 0.00% 38 11 0.00% 39 7 0.00% 40 10 0.00% 41 3 0.00% 42 14 0.00% 43 8 0.00% 44 8 0.00% 45 16 0.00% 46 16 0.00% 47 16 0.00% 48 14 0.00% 49 20 0.00% 50 19 0.00% 51 17 0.00% 52 27 0.00% 53 30 0.00% 54 22 0.00% 55 20 0.00% 56 31 0.00% 57 17 0.00% 58 35 0.00% 59 40 0.00% 60 64 0.00% 61 63 0.00% 62 72 0.00% 63 71 0.00% 64 61 0.00% 65 79 0.00% 66 76 0.00% 67 94 0.00% 68 90 0.00% 69 109 0.00% 70 121 0.00% 71 124 0.00% 72 163 0.00% 73 179 0.00% 74 208 0.00% 75 214 0.00% 76 250 0.00% 77 289 0.00% 78 300 0.00% 79 377 0.00% 80 405 0.00% 81 421 0.00% 82 445 0.00% 83 546 0.00% 84 682 0.01% 85 736 0.01% 86 790 0.01% 87 862 0.01% 88 1038 0.01% 89 1021 0.01% 90 1183 0.01% 91 1252 0.01% 92 1550 0.01% 93 1718 0.01% 94 1813 0.01% 95 1952 0.02% 96 2121 0.02% 97 2335 0.02% 98 2540 0.02% 99 2744 0.02% 100 2892 0.02% 101 3085 0.02% 102 3254 0.03% 103 3590 0.03% 104 3819 0.03% 105 3928 0.03% 106 4195 0.03% 107 4653 0.04% 108 4947 0.04% 109 5273 0.04% 110 5374 0.04% 111 5691 0.04% 112 6124 0.05% 113 6330 0.05% 114 6666 0.05% 115 7013 0.05% 116 7395 0.06% 117 7700 0.06% 118 7945 0.06% 119 8169 0.06% 120 9024 0.07% 121 9222 0.07% 122 9351 0.07% 123 10136 0.08% 124 10308 0.08% 125 10812 0.08% 126 11188 0.09% 127 11727 0.09% 128 12321 0.10% 129 12418 0.10% 130 13059 0.10% 131 13420 0.11% 132 14136 0.11% 133 14510 0.11% 134 14936 0.12% 135 15432 0.12% 136 15986 0.13% 137 16561 0.13% 138 16918 0.13% 139 18239 0.14% 140 17745 0.14% 141 18532 0.15% 142 19188 0.15% 143 19709 0.15% 144 20682 0.16% 145 21795 0.17% 146 21193 0.17% 147 21931 0.17% 148 22580 0.18% 149 22909 0.18% 150 23779 0.19% 151 12131954 95.08% 12759398 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=21.87 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.3 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=30 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=100.59 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.7 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTTAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR12161448 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:52:15 Started mapping on | Feb 13 22:52:15 Finished on | Feb 13 22:54:00 Mapping speed, Million of reads per hour | 437.47 Number of input reads | 12759398 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11605505 Uniquely mapped reads % | 90.96% Average mapped length | 299.05 Number of splices: Total | 11838668 Number of splices: Annotated (sjdb) | 11578446 Number of splices: GT/AG | 11596274 Number of splices: GC/AG | 199506 Number of splices: AT/AC | 9310 Number of splices: Non-canonical | 33578 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.03% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375215 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 446439 % of reads mapped to too many loci | 3.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 778678 778678 778678 N_multimapping 375215 375215 375215 N_noFeature 658770 11412708 702200 N_ambiguous 220955 1087 70757 UnstrandedReadsAssigned:10725780 PositiveStrandReadsAssigned:191710 NegativeStrandReadsAssigned:10832548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161448-trimmed-pair1.fastq SRR12161448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,759,398 reads, 11,137,329 reads pseudoaligned [quant] estimated average fragment length: 283.971 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12161448.ke.tsv 34699 SRR12161448.se.tsv 87100 total ==> SRR12161448.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.03 333 13.8765 Potri.005G024800.1.v4.1 1035 752.029 335 32.2073 Potri.004G059700.1.v4.1 961 678.215 1 0.106605 Potri.007G009000.2.v4.1 1416 1133.03 0 0 Potri.003G141000.2.v4.1 2943 2660.03 500.085 13.5925 Potri.016G087400.1.v4.1 270 69.6299 576 598.095 Potri.015G069301.1.v4.1 564 297.203 0 0 Potri.010G195200.1.v4.1 1773 1490.03 3 0.145569 Potri.012G127500.1.v4.1 977 694.142 53 5.5204 ==> SRR12161448.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12161448 completed mapping pipeline successfully