Starting /dee2/code/volunteer_pipeline.sh SRR12161455 current disk space = 3089346580480 free memory = 1449785276 SRR12161455 SRAfilesize 0dc33a81f856236caf3d64f622e7cd37 SRR12161455.sra SRR12161455.sra file validated SRR12161455 is paired end SRR12161455 is conventional basespace SRR12161455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37425 37.0 37.0 37.0 37.0 37.0 2 36.3095 37.0 37.0 37.0 37.0 37.0 3 36.447 37.0 37.0 37.0 37.0 37.0 4 36.4385 37.0 37.0 37.0 37.0 37.0 5 36.5325 37.0 37.0 37.0 37.0 37.0 6 36.5185 37.0 37.0 37.0 37.0 37.0 7 36.449 37.0 37.0 37.0 37.0 37.0 8 36.3695 37.0 37.0 37.0 37.0 37.0 9 36.356 37.0 37.0 37.0 37.0 37.0 10-14 36.4724 37.0 37.0 37.0 37.0 37.0 15-19 36.4461 37.0 37.0 37.0 37.0 37.0 20-24 36.388999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.352999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3581 37.0 37.0 37.0 37.0 37.0 35-39 36.290299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.2492 37.0 37.0 37.0 37.0 37.0 45-49 36.2384 37.0 37.0 37.0 37.0 37.0 50-54 36.2101 37.0 37.0 37.0 37.0 37.0 55-59 36.1826 37.0 37.0 37.0 37.0 37.0 60-64 36.1635 37.0 37.0 37.0 37.0 37.0 65-69 36.154799999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.0928 37.0 37.0 37.0 37.0 37.0 75-79 36.0983 37.0 37.0 37.0 37.0 37.0 80-84 36.073600000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.0345 37.0 37.0 37.0 37.0 37.0 90-94 36.008700000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9628 37.0 37.0 37.0 37.0 37.0 100-104 35.9596 37.0 37.0 37.0 37.0 37.0 105-109 35.8575 37.0 37.0 37.0 37.0 37.0 110-114 35.8537 37.0 37.0 37.0 37.0 37.0 115-119 35.8543 37.0 37.0 37.0 37.0 37.0 120-124 35.9148 37.0 37.0 37.0 37.0 37.0 125-129 35.7933 37.0 37.0 37.0 37.0 37.0 130-134 35.7839 37.0 37.0 37.0 37.0 37.0 135-139 35.655899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.630300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.5677 37.0 37.0 37.0 37.0 37.0 150-151 35.39225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 0.0 25 4.0 26 6.0 27 10.0 28 20.0 29 25.0 30 39.0 31 45.0 32 74.0 33 96.0 34 161.0 35 367.0 36 2858.0 37 291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8359668924003 13.81991472284926 6.270378730875345 38.073739653875094 2 19.675 13.15 36.275 30.9 3 17.675 17.95 28.4 35.975 4 20.875 26.125 24.625 28.375 5 22.15 32.074999999999996 25.224999999999998 20.549999999999997 6 21.275 34.150000000000006 24.05 20.525 7 15.125 26.05 42.25 16.575 8 17.424999999999997 26.825 31.974999999999998 23.775 9 17.724999999999998 24.099999999999998 34.425 23.75 10-14 19.115 29.720000000000002 28.310000000000002 22.855 15-19 19.755 28.325 28.355000000000004 23.565 20-24 19.805 28.71 28.125 23.36 25-29 19.785 28.475 27.889999999999997 23.849999999999998 30-34 19.925 28.860000000000003 27.91 23.305 35-39 19.675 28.749999999999996 28.199999999999996 23.375 40-44 19.5 28.465 28.485 23.549999999999997 45-49 20.03 28.655 27.634999999999998 23.68 50-54 20.155 28.12 28.09 23.635 55-59 20.165 28.18 28.405 23.25 60-64 20.365 28.804999999999996 26.97 23.86 65-69 20.355 28.444999999999997 27.765 23.435 70-74 20.47 28.000000000000004 28.125 23.405 75-79 20.335 28.075 27.565 24.025 80-84 20.02 28.4 27.915 23.665 85-89 20.0 28.005000000000003 28.360000000000003 23.635 90-94 20.715 28.49 27.215 23.580000000000002 95-99 20.244999999999997 28.18 27.865000000000002 23.71 100-104 20.625 28.244999999999997 27.665 23.465 105-109 20.23 28.54 27.865000000000002 23.365 110-114 20.3 28.625 27.115000000000002 23.96 115-119 20.46 28.955 27.68 22.905 120-124 20.919999999999998 28.435 27.355 23.29 125-129 20.41 28.02 27.544999999999998 24.025 130-134 21.09 28.485 27.265 23.16 135-139 21.005 28.110000000000003 27.345000000000002 23.54 140-144 20.355 28.175 27.125 24.345 145-149 20.87 28.125 26.665 24.34 150-151 21.95 27.987499999999997 27.325 22.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 3.0 24 4.0 25 4.0 26 4.5 27 4.5 28 5.5 29 8.0 30 11.0 31 16.0 32 27.5 33 36.5 34 51.5 35 68.5 36 82.5 37 118.5 38 145.0 39 161.5 40 182.5 41 204.0 42 250.0 43 277.5 44 277.0 45 272.5 46 279.5 47 280.0 48 262.5 49 220.0 50 174.5 51 147.0 52 109.0 53 80.0 54 63.5 55 50.5 56 38.0 57 25.0 58 17.5 59 13.5 60 7.0 61 3.5 62 2.5 63 2.0 64 0.5 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.84399788471708 89.67500000000001 2 4.732945531464834 8.95 3 0.29085140137493387 0.8250000000000001 4 0.10576414595452141 0.4 5 0.0 0.0 6 0.026441036488630353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGTACTGACCACCTGGTTTACTATAGGCCACAATAACTACTTTGTTGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.675 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.737500000000001 0.0 0.0 0.0 0.0 130-131 6.225 0.0 0.0 0.0 0.0 132-133 6.725 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.6125 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATAAA 10 0.006830828 145.0 145 >>END_MODULE SRR12161455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.144 37.0 37.0 37.0 37.0 37.0 2 35.912 37.0 37.0 37.0 37.0 37.0 3 35.886 37.0 37.0 37.0 37.0 37.0 4 36.1145 37.0 37.0 37.0 37.0 37.0 5 36.0165 37.0 37.0 37.0 37.0 37.0 6 36.089 37.0 37.0 37.0 37.0 37.0 7 36.0355 37.0 37.0 37.0 37.0 37.0 8 36.1245 37.0 37.0 37.0 37.0 37.0 9 36.0565 37.0 37.0 37.0 37.0 37.0 10-14 36.1017 37.0 37.0 37.0 37.0 37.0 15-19 36.027 37.0 37.0 37.0 37.0 37.0 20-24 36.0326 37.0 37.0 37.0 37.0 37.0 25-29 35.93090000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.9154 37.0 37.0 37.0 37.0 37.0 35-39 35.923700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.9253 37.0 37.0 37.0 37.0 37.0 45-49 35.898700000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.879 37.0 37.0 37.0 37.0 37.0 55-59 35.8588 37.0 37.0 37.0 37.0 37.0 60-64 35.7196 37.0 37.0 37.0 37.0 37.0 65-69 35.76649999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.7436 37.0 37.0 37.0 37.0 37.0 75-79 35.6682 37.0 37.0 37.0 37.0 37.0 80-84 35.653299999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.5901 37.0 37.0 37.0 37.0 37.0 90-94 35.5683 37.0 37.0 37.0 37.0 37.0 95-99 35.5066 37.0 37.0 37.0 37.0 37.0 100-104 35.5509 37.0 37.0 37.0 37.0 37.0 105-109 35.5702 37.0 37.0 37.0 37.0 37.0 110-114 35.459 37.0 37.0 37.0 37.0 37.0 115-119 35.3949 37.0 37.0 37.0 37.0 37.0 120-124 35.3521 37.0 37.0 37.0 37.0 37.0 125-129 35.2273 37.0 37.0 37.0 32.2 37.0 130-134 35.2725 37.0 37.0 37.0 37.0 37.0 135-139 34.9423 37.0 37.0 37.0 25.0 37.0 140-144 34.949 37.0 37.0 37.0 25.0 37.0 145-149 34.7915 37.0 37.0 37.0 25.0 37.0 150-151 34.434 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 6.0 15 3.0 16 0.0 17 3.0 18 2.0 19 6.0 20 3.0 21 5.0 22 6.0 23 7.0 24 10.0 25 10.0 26 19.0 27 14.0 28 17.0 29 33.0 30 34.0 31 58.0 32 75.0 33 131.0 34 217.0 35 586.0 36 2511.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0 25.45 9.875 23.674999999999997 2 27.875 27.750000000000004 29.25 15.125 3 22.125 27.175 31.95 18.75 4 22.975 34.675 23.200000000000003 19.15 5 26.275 36.199999999999996 21.425 16.1 6 22.925 37.724999999999994 20.95 18.4 7 19.900000000000002 23.5 38.05 18.55 8 20.65 27.224999999999998 27.950000000000003 24.175 9 22.475 24.55 30.4 22.575 10-14 23.544999999999998 29.189999999999998 26.669999999999998 20.595 15-19 23.05 28.675 27.495000000000005 20.78 20-24 23.515 28.605000000000004 27.29 20.59 25-29 22.869999999999997 28.515 28.055000000000003 20.560000000000002 30-34 22.84 28.77 27.785 20.605 35-39 23.585 28.71 27.27 20.435 40-44 22.955000000000002 28.235 27.41 21.4 45-49 22.919999999999998 28.194999999999997 27.815 21.07 50-54 23.135 28.689999999999998 27.950000000000003 20.225 55-59 23.185 28.32 27.93 20.565 60-64 23.235 27.735 28.23 20.8 65-69 23.674999999999997 28.325 27.689999999999998 20.31 70-74 23.71 28.455000000000002 27.815 20.02 75-79 23.315 28.24 27.900000000000002 20.544999999999998 80-84 23.56 28.38 27.474999999999998 20.585 85-89 24.15 28.244999999999997 27.67 19.935 90-94 24.2 28.815 26.97 20.015 95-99 23.98 28.470000000000002 27.415 20.135 100-104 24.305 28.525 27.37 19.8 105-109 24.545 28.175 27.1 20.18 110-114 24.45 28.349999999999998 26.950000000000003 20.25 115-119 24.23 28.52 27.22 20.03 120-124 24.67 28.225 27.05 20.055 125-129 24.91 28.294999999999998 26.97 19.825 130-134 25.345000000000002 27.83 27.295 19.53 135-139 25.580000000000002 28.095 26.87 19.455 140-144 25.965 27.55 27.474999999999998 19.009999999999998 145-149 26.779999999999998 27.900000000000002 26.41 18.91 150-151 27.0125 26.687499999999996 27.175 19.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 1.5 14 1.5 15 0.5 16 1.0 17 2.0 18 2.0 19 0.5 20 0.5 21 1.5 22 3.5 23 3.5 24 3.0 25 4.0 26 4.0 27 5.0 28 6.5 29 9.5 30 13.0 31 18.5 32 22.5 33 22.5 34 38.0 35 68.0 36 90.5 37 112.0 38 133.0 39 163.0 40 207.0 41 240.0 42 267.5 43 281.0 44 286.5 45 306.5 46 291.5 47 251.0 48 230.5 49 201.5 50 157.5 51 123.5 52 98.0 53 80.5 54 67.0 55 47.5 56 38.0 57 25.5 58 12.5 59 11.0 60 7.5 61 4.5 62 3.0 63 2.0 64 1.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 1.0 88 1.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.25691699604744 90.375 2 4.426877470355731 8.4 3 0.1844532279314888 0.525 4 0.052700922266139656 0.2 5 0.0 0.0 6 0.052700922266139656 0.3 7 0.0 0.0 8 0.026350461133069828 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.3125 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.699999999999999 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCGTG 10 0.006830828 145.0 145 >>END_MODULE Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339590 spots for SRR12161455.sra Written 1339590 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra Read 1339581 spots for SRR12161455.sra Written 1339581 spots for SRR12161455.sra SRR ids: ['SRR12161455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9mulh7x SRR12161455.sra spots: 26791629 blocks: [[1, 1339581], [1339582, 2679162], [2679163, 4018743], [4018744, 5358324], [5358325, 6697905], [6697906, 8037486], [8037487, 9377067], [9377068, 10716648], [10716649, 12056229], [12056230, 13395810], [13395811, 14735391], [14735392, 16074972], [16074973, 17414553], [17414554, 18754134], [18754135, 20093715], [20093716, 21433296], [21433297, 22772877], [22772878, 24112458], [24112459, 25452039], [25452040, 26791629]] SRR12161455 file size 9083267 SRR12161455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161455 SRR12161455_1.fastq SRR12161455_2.fastq Input file: SRR12161455_1.fastq Paired file: SRR12161455_2.fastq trimmed: SRR12161455-trimmed-pair1.fastq, SRR12161455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:04:26 2025 >> started Thu Feb 13 23:05:08 2025 >> done (42.342s) 26791629 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 9959 ( 0.04%) empty read pairs filtered out after trimming by size control 26781575 (99.96%) read pairs available; of these: 3220630 (12.03%) trimmed read pairs available after processing 23560945 (87.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 10 0.00% 21 14 0.00% 22 19 0.00% 23 27 0.00% 24 25 0.00% 25 18 0.00% 26 39 0.00% 27 34 0.00% 28 37 0.00% 29 31 0.00% 30 42 0.00% 31 35 0.00% 32 46 0.00% 33 50 0.00% 34 45 0.00% 35 56 0.00% 36 58 0.00% 37 61 0.00% 38 79 0.00% 39 63 0.00% 40 75 0.00% 41 81 0.00% 42 86 0.00% 43 80 0.00% 44 93 0.00% 45 121 0.00% 46 107 0.00% 47 119 0.00% 48 123 0.00% 49 142 0.00% 50 166 0.00% 51 177 0.00% 52 186 0.00% 53 185 0.00% 54 203 0.00% 55 229 0.00% 56 267 0.00% 57 264 0.00% 58 304 0.00% 59 371 0.00% 60 446 0.00% 61 537 0.00% 62 583 0.00% 63 593 0.00% 64 674 0.00% 65 717 0.00% 66 796 0.00% 67 799 0.00% 68 1018 0.00% 69 1148 0.00% 70 1312 0.00% 71 1565 0.01% 72 1824 0.01% 73 2093 0.01% 74 2286 0.01% 75 2511 0.01% 76 2767 0.01% 77 2948 0.01% 78 3351 0.01% 79 3691 0.01% 80 4246 0.02% 81 4805 0.02% 82 5712 0.02% 83 6393 0.02% 84 7063 0.03% 85 7865 0.03% 86 8281 0.03% 87 8911 0.03% 88 9590 0.04% 89 10339 0.04% 90 11527 0.04% 91 12603 0.05% 92 14355 0.05% 93 15591 0.06% 94 17039 0.06% 95 18185 0.07% 96 19087 0.07% 97 19848 0.07% 98 21113 0.08% 99 22110 0.08% 100 23740 0.09% 101 25130 0.09% 102 27172 0.10% 103 29126 0.11% 104 31069 0.12% 105 32544 0.12% 106 33513 0.13% 107 34805 0.13% 108 35626 0.13% 109 36530 0.14% 110 37632 0.14% 111 39628 0.15% 112 41695 0.16% 113 43500 0.16% 114 45629 0.17% 115 47517 0.18% 116 48861 0.18% 117 49440 0.18% 118 49836 0.19% 119 50810 0.19% 120 51808 0.19% 121 53640 0.20% 122 54942 0.21% 123 57387 0.21% 124 59367 0.22% 125 60599 0.23% 126 62493 0.23% 127 63654 0.24% 128 64380 0.24% 129 62877 0.23% 130 63862 0.24% 131 65208 0.24% 132 67135 0.25% 133 69391 0.26% 134 71249 0.27% 135 73039 0.27% 136 73713 0.28% 137 74159 0.28% 138 73713 0.28% 139 74509 0.28% 140 74917 0.28% 141 75234 0.28% 142 77014 0.29% 143 78083 0.29% 144 80556 0.30% 145 82327 0.31% 146 82604 0.31% 147 82671 0.31% 148 82531 0.31% 149 81336 0.30% 150 81924 0.31% 151 23560945 87.97% 26781575 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=32 prefix-density=0.35 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=401.16 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=35.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=33 prefix-density=0.50 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=321.45 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=31.7 sequence=GAAGAAGAAGAAA SRR12161455 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:05:56 Started mapping on | Feb 13 23:05:56 Finished on | Feb 13 23:08:58 Mapping speed, Million of reads per hour | 529.75 Number of input reads | 26781575 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 24783467 Uniquely mapped reads % | 92.54% Average mapped length | 294.49 Number of splices: Total | 25951697 Number of splices: Annotated (sjdb) | 25439839 Number of splices: GT/AG | 25531316 Number of splices: GC/AG | 333818 Number of splices: AT/AC | 21344 Number of splices: Non-canonical | 65219 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 686925 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 42546 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.54% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1311183 1311183 1311183 N_multimapping 686925 686925 686925 N_noFeature 573677 24572956 672344 N_ambiguous 245323 1212 132873 UnstrandedReadsAssigned:23964467 PositiveStrandReadsAssigned:209299 NegativeStrandReadsAssigned:23978250 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161455-trimmed-pair1.fastq SRR12161455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,781,575 reads, 24,046,428 reads pseudoaligned [quant] estimated average fragment length: 258.588 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR12161455.ke.tsv 34699 SRR12161455.se.tsv 87100 total ==> SRR12161455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.41 2149 51.031 Potri.005G024800.1.v4.1 1035 777.412 344 18.4978 Potri.004G059700.1.v4.1 961 703.565 38 2.25783 Potri.007G009000.2.v4.1 1416 1158.41 0 0 Potri.003G141000.2.v4.1 2943 2685.41 1152.19 17.936 Potri.016G087400.1.v4.1 270 90.0623 1764 818.781 Potri.015G069301.1.v4.1 564 321.196 0 0 Potri.010G195200.1.v4.1 1773 1515.41 323 8.91013 Potri.012G127500.1.v4.1 977 719.481 3741 217.36 ==> SRR12161455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 410 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 897 SRR12161455 completed mapping pipeline successfully