Starting /dee2/code/volunteer_pipeline.sh SRR12161456 current disk space = 3089316749312 free memory = 1444987424 SRR12161456 SRAfilesize cd494c27c8d7768e777e8ec9beb28992 SRR12161456.sra SRR12161456.sra file validated SRR12161456 is paired end SRR12161456 is conventional basespace SRR12161456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45425 37.0 37.0 37.0 37.0 37.0 2 36.493 37.0 37.0 37.0 37.0 37.0 3 36.4325 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.541 37.0 37.0 37.0 37.0 37.0 6 36.583 37.0 37.0 37.0 37.0 37.0 7 36.3985 37.0 37.0 37.0 37.0 37.0 8 36.399 37.0 37.0 37.0 37.0 37.0 9 36.5025 37.0 37.0 37.0 37.0 37.0 10-14 36.525400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5295 37.0 37.0 37.0 37.0 37.0 20-24 36.473699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4002 37.0 37.0 37.0 37.0 37.0 30-34 36.3867 37.0 37.0 37.0 37.0 37.0 35-39 36.3381 37.0 37.0 37.0 37.0 37.0 40-44 36.3132 37.0 37.0 37.0 37.0 37.0 45-49 36.3046 37.0 37.0 37.0 37.0 37.0 50-54 36.287400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2712 37.0 37.0 37.0 37.0 37.0 60-64 36.243900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.288799999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.157599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.1689 37.0 37.0 37.0 37.0 37.0 80-84 36.1139 37.0 37.0 37.0 37.0 37.0 85-89 36.0507 37.0 37.0 37.0 37.0 37.0 90-94 36.095600000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.077299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.999900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.953700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.892399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.969500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.981700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9092 37.0 37.0 37.0 37.0 37.0 130-134 35.8126 37.0 37.0 37.0 37.0 37.0 135-139 35.7947 37.0 37.0 37.0 37.0 37.0 140-144 35.6541 37.0 37.0 37.0 37.0 37.0 145-149 35.718500000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.6225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 4.0 26 6.0 27 8.0 28 16.0 29 22.0 30 36.0 31 49.0 32 50.0 33 97.0 34 135.0 35 339.0 36 2900.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.217772215269086 12.440550688360451 6.958698372966207 46.38297872340426 2 18.3 12.825000000000001 37.775 31.1 3 16.85 15.375 27.6 40.175 4 22.225 23.075000000000003 24.175 30.525000000000002 5 22.525000000000002 29.125 25.05 23.3 6 20.875 33.300000000000004 23.400000000000002 22.425 7 15.525 28.775000000000002 39.65 16.05 8 17.325 25.6 33.15 23.925 9 17.5 23.849999999999998 36.125 22.525000000000002 10-14 19.03 29.56 28.794999999999998 22.615 15-19 19.59 28.325 28.345 23.74 20-24 19.49 28.555000000000003 28.18 23.775 25-29 19.66 28.37 28.74 23.23 30-34 20.4 28.63 27.405 23.565 35-39 19.63 28.405 28.01 23.955000000000002 40-44 19.485 28.199999999999996 28.444999999999997 23.87 45-49 19.830000000000002 28.4 28.199999999999996 23.57 50-54 19.994999999999997 28.095 28.499999999999996 23.41 55-59 19.785 28.610000000000003 28.084999999999997 23.52 60-64 20.085 28.575 27.46 23.880000000000003 65-69 19.91 28.345 28.194999999999997 23.549999999999997 70-74 20.085 27.905 28.03 23.98 75-79 20.4 27.584999999999997 28.494999999999997 23.52 80-84 20.380000000000003 27.365000000000002 28.375 23.880000000000003 85-89 19.64 28.335 28.1 23.925 90-94 20.46 27.900000000000002 27.755000000000003 23.885 95-99 20.745 28.449999999999996 27.775 23.03 100-104 19.82 28.83 27.625 23.724999999999998 105-109 20.185 28.215 27.82 23.78 110-114 19.89 27.625 28.52 23.965 115-119 20.75 27.505000000000003 28.315 23.43 120-124 20.685000000000002 28.065 27.465 23.785 125-129 21.099999999999998 27.994999999999997 27.165 23.74 130-134 20.435 28.225 27.439999999999998 23.9 135-139 21.215 27.98 27.384999999999998 23.419999999999998 140-144 20.905 27.77 27.405 23.919999999999998 145-149 20.945 28.265 26.634999999999998 24.154999999999998 150-151 21.45 27.6875 26.35 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 3.0 25 3.0 26 3.5 27 4.0 28 6.5 29 7.5 30 8.5 31 14.0 32 19.5 33 27.5 34 52.5 35 72.0 36 81.0 37 104.5 38 132.5 39 162.0 40 195.0 41 225.0 42 243.5 43 278.5 44 300.5 45 276.0 46 271.0 47 284.5 48 257.0 49 216.5 50 188.5 51 148.5 52 124.5 53 98.0 54 56.5 55 40.0 56 35.5 57 23.0 58 11.0 59 7.5 60 6.0 61 3.5 62 0.5 63 0.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.73333333333333 87.875 2 5.893333333333333 11.05 3 0.3466666666666667 0.975 4 0.02666666666666667 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.425000000000001 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATATT 10 0.006830828 145.0 6 >>END_MODULE SRR12161456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2995 37.0 37.0 37.0 37.0 37.0 2 36.0455 37.0 37.0 37.0 37.0 37.0 3 36.125 37.0 37.0 37.0 37.0 37.0 4 36.196 37.0 37.0 37.0 37.0 37.0 5 36.162 37.0 37.0 37.0 37.0 37.0 6 36.1865 37.0 37.0 37.0 37.0 37.0 7 36.3455 37.0 37.0 37.0 37.0 37.0 8 36.2385 37.0 37.0 37.0 37.0 37.0 9 36.3005 37.0 37.0 37.0 37.0 37.0 10-14 36.2331 37.0 37.0 37.0 37.0 37.0 15-19 36.233799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.180400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.110699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.1289 37.0 37.0 37.0 37.0 37.0 35-39 36.087199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0361 37.0 37.0 37.0 37.0 37.0 45-49 36.01520000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9991 37.0 37.0 37.0 37.0 37.0 55-59 35.957300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9331 37.0 37.0 37.0 37.0 37.0 65-69 35.8851 37.0 37.0 37.0 37.0 37.0 70-74 35.8661 37.0 37.0 37.0 37.0 37.0 75-79 35.8029 37.0 37.0 37.0 37.0 37.0 80-84 35.756299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8 37.0 37.0 37.0 37.0 37.0 90-94 35.69409999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7275 37.0 37.0 37.0 37.0 37.0 100-104 35.6756 37.0 37.0 37.0 37.0 37.0 105-109 35.614200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5345 37.0 37.0 37.0 37.0 37.0 115-119 35.563599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.5373 37.0 37.0 37.0 37.0 37.0 125-129 35.4825 37.0 37.0 37.0 37.0 37.0 130-134 35.423700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.2757 37.0 37.0 37.0 34.6 37.0 140-144 35.118100000000005 37.0 37.0 37.0 27.4 37.0 145-149 35.1045 37.0 37.0 37.0 25.0 37.0 150-151 34.759 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 2.0 16 1.0 17 3.0 18 1.0 19 0.0 20 3.0 21 2.0 22 5.0 23 3.0 24 6.0 25 11.0 26 16.0 27 10.0 28 19.0 29 21.0 30 25.0 31 50.0 32 74.0 33 116.0 34 212.0 35 597.0 36 2592.0 37 226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.9 24.15 10.625 30.325000000000003 2 27.55 27.925 29.45 15.075 3 19.425 29.299999999999997 31.65 19.625 4 22.475 33.95 24.4 19.175 5 25.124999999999996 36.275 22.225 16.375 6 21.175 38.7 22.8 17.325 7 20.674999999999997 22.975 38.2 18.15 8 21.575 25.85 29.2 23.375 9 21.925 25.8 29.9 22.375 10-14 22.665 28.999999999999996 26.840000000000003 21.495 15-19 23.03 28.599999999999998 27.405 20.965 20-24 23.215 28.22 28.115000000000002 20.45 25-29 23.255 28.395 27.77 20.580000000000002 30-34 22.21 28.794999999999998 27.63 21.365000000000002 35-39 22.585 28.57 27.345000000000002 21.5 40-44 22.650000000000002 28.645 27.85 20.855 45-49 22.564999999999998 28.525 27.750000000000004 21.16 50-54 23.369999999999997 27.944999999999997 28.634999999999998 20.05 55-59 23.400000000000002 28.000000000000004 28.050000000000004 20.549999999999997 60-64 23.34 28.235 27.46 20.965 65-69 23.055 28.13 28.449999999999996 20.365 70-74 22.439999999999998 29.24 27.185 21.135 75-79 23.799999999999997 28.93 26.845000000000002 20.424999999999997 80-84 23.455000000000002 28.215 27.97 20.36 85-89 23.705000000000002 28.59 27.04 20.665 90-94 23.485 28.725 27.55 20.24 95-99 23.84 28.634999999999998 27.175 20.349999999999998 100-104 24.485 28.560000000000002 26.265 20.69 105-109 24.169999999999998 28.21 27.325 20.294999999999998 110-114 24.15 28.74 27.139999999999997 19.97 115-119 24.34 28.835 26.955000000000002 19.869999999999997 120-124 24.195 28.505000000000003 27.26 20.04 125-129 25.385 28.64 26.97 19.005 130-134 24.75 28.26 26.905 20.085 135-139 25.655 28.705000000000002 26.05 19.59 140-144 25.595000000000002 28.294999999999998 26.76 19.35 145-149 26.179999999999996 28.01 26.889999999999997 18.92 150-151 26.4125 28.499999999999996 26.187500000000004 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.0 23 1.0 24 1.5 25 1.5 26 1.0 27 2.5 28 7.5 29 7.0 30 7.5 31 15.5 32 22.5 33 36.0 34 46.0 35 63.5 36 86.5 37 110.0 38 159.5 39 175.5 40 193.0 41 238.5 42 260.5 43 277.5 44 300.0 45 298.5 46 272.0 47 254.5 48 232.0 49 199.5 50 161.0 51 140.0 52 125.0 53 89.5 54 63.0 55 49.0 56 37.5 57 25.0 58 12.5 59 6.0 60 3.5 61 2.0 62 1.5 63 1.0 64 0.0 65 0.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7299893276414 87.825 2 5.923159018143009 11.1 3 0.2934898612593383 0.8250000000000001 4 0.026680896478121666 0.1 5 0.0 0.0 6 0.026680896478121666 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.075 0.0 0.0 0.0 0.0 126-127 5.550000000000001 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.3625 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.337499999999999 0.0 0.0 0.0 0.0 138-139 9.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAATT 10 0.006830828 145.0 2 >>END_MODULE Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658536 spots for SRR12161456.sra Written 1658536 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra Read 1658524 spots for SRR12161456.sra Written 1658524 spots for SRR12161456.sra SRR ids: ['SRR12161456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j012mcm4 SRR12161456.sra spots: 33170492 blocks: [[1, 1658524], [1658525, 3317048], [3317049, 4975572], [4975573, 6634096], [6634097, 8292620], [8292621, 9951144], [9951145, 11609668], [11609669, 13268192], [13268193, 14926716], [14926717, 16585240], [16585241, 18243764], [18243765, 19902288], [19902289, 21560812], [21560813, 23219336], [23219337, 24877860], [24877861, 26536384], [26536385, 28194908], [28194909, 29853432], [29853433, 31511956], [31511957, 33170492]] SRR12161456 file size 11251084 SRR12161456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161456 SRR12161456_1.fastq SRR12161456_2.fastq Input file: SRR12161456_1.fastq Paired file: SRR12161456_2.fastq trimmed: SRR12161456-trimmed-pair1.fastq, SRR12161456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:12:22 2025 >> started Thu Feb 13 23:12:58 2025 >> done (35.623s) 33170492 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 6112 ( 0.02%) empty read pairs filtered out after trimming by size control 33164315 (99.98%) read pairs available; of these: 4162972 (12.55%) trimmed read pairs available after processing 29001343 (87.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 15 0.00% 22 13 0.00% 23 16 0.00% 24 16 0.00% 25 20 0.00% 26 20 0.00% 27 27 0.00% 28 26 0.00% 29 29 0.00% 30 33 0.00% 31 27 0.00% 32 33 0.00% 33 34 0.00% 34 31 0.00% 35 38 0.00% 36 49 0.00% 37 59 0.00% 38 51 0.00% 39 58 0.00% 40 56 0.00% 41 77 0.00% 42 69 0.00% 43 92 0.00% 44 85 0.00% 45 78 0.00% 46 92 0.00% 47 84 0.00% 48 137 0.00% 49 152 0.00% 50 164 0.00% 51 172 0.00% 52 167 0.00% 53 186 0.00% 54 200 0.00% 55 223 0.00% 56 227 0.00% 57 268 0.00% 58 332 0.00% 59 346 0.00% 60 455 0.00% 61 513 0.00% 62 581 0.00% 63 576 0.00% 64 633 0.00% 65 751 0.00% 66 829 0.00% 67 908 0.00% 68 1066 0.00% 69 1146 0.00% 70 1330 0.00% 71 1674 0.01% 72 1803 0.01% 73 2141 0.01% 74 2407 0.01% 75 2814 0.01% 76 3052 0.01% 77 3300 0.01% 78 3680 0.01% 79 4111 0.01% 80 4545 0.01% 81 5295 0.02% 82 5967 0.02% 83 6781 0.02% 84 7754 0.02% 85 8913 0.03% 86 9352 0.03% 87 10361 0.03% 88 11377 0.03% 89 12316 0.04% 90 13095 0.04% 91 14466 0.04% 92 16044 0.05% 93 17705 0.05% 94 19451 0.06% 95 21124 0.06% 96 22695 0.07% 97 24252 0.07% 98 25874 0.08% 99 27218 0.08% 100 29124 0.09% 101 30617 0.09% 102 32401 0.10% 103 34886 0.11% 104 36832 0.11% 105 39623 0.12% 106 41860 0.13% 107 43734 0.13% 108 45247 0.14% 109 47343 0.14% 110 48469 0.15% 111 49968 0.15% 112 51954 0.16% 113 53671 0.16% 114 56777 0.17% 115 59744 0.18% 116 61578 0.19% 117 63432 0.19% 118 65687 0.20% 119 66939 0.20% 120 68453 0.21% 121 70333 0.21% 122 71120 0.21% 123 73060 0.22% 124 75824 0.23% 125 77361 0.23% 126 79664 0.24% 127 82444 0.25% 128 83630 0.25% 129 84749 0.26% 130 87207 0.26% 131 87547 0.26% 132 89254 0.27% 133 90618 0.27% 134 91700 0.28% 135 93584 0.28% 136 95619 0.29% 137 97798 0.29% 138 99661 0.30% 139 100779 0.30% 140 101322 0.31% 141 102826 0.31% 142 104466 0.31% 143 104895 0.32% 144 106581 0.32% 145 107687 0.32% 146 108717 0.33% 147 109349 0.33% 148 110736 0.33% 149 111125 0.34% 150 112806 0.34% 151 29001343 87.45% 33164315 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=14 prefix-density=0.45 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=363.22 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=35.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=21 prefix-density=0.54 prefix-fanout=3.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=352.27 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.0 sequence=AGAAGAAGAGAGG SRR12161456 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:14:10 Started mapping on | Feb 13 23:14:10 Finished on | Feb 13 23:17:27 Mapping speed, Million of reads per hour | 606.05 Number of input reads | 33164315 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 31605374 Uniquely mapped reads % | 95.30% Average mapped length | 294.73 Number of splices: Total | 33960281 Number of splices: Annotated (sjdb) | 33274433 Number of splices: GT/AG | 33410210 Number of splices: GC/AG | 440649 Number of splices: AT/AC | 28224 Number of splices: Non-canonical | 81198 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 891721 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 47418 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667220 667220 667220 N_multimapping 891721 891721 891721 N_noFeature 758733 31344173 882446 N_ambiguous 296853 1568 158540 UnstrandedReadsAssigned:30549788 PositiveStrandReadsAssigned:259633 NegativeStrandReadsAssigned:30564388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161456-trimmed-pair1.fastq SRR12161456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,164,315 reads, 30,545,924 reads pseudoaligned [quant] estimated average fragment length: 248.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR12161456.ke.tsv 34699 SRR12161456.se.tsv 87100 total ==> SRR12161456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.08 3410 62.3558 Potri.005G024800.1.v4.1 1035 787.084 1029 42.3166 Potri.004G059700.1.v4.1 961 713.229 79 3.58521 Potri.007G009000.2.v4.1 1416 1168.08 0 0 Potri.003G141000.2.v4.1 2943 2695.08 1454.06 17.4633 Potri.016G087400.1.v4.1 270 88.3889 2525 924.656 Potri.015G069301.1.v4.1 564 327.843 0 0 Potri.010G195200.1.v4.1 1773 1525.08 474.839 10.0779 Potri.012G127500.1.v4.1 977 729.18 4131 183.374 ==> SRR12161456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 481 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 692 SRR12161456 completed mapping pipeline successfully