Starting /dee2/code/volunteer_pipeline.sh SRR12161457 current disk space = 3089324363776 free memory = 1400530104 SRR12161457 SRAfilesize a8d15a1f5a2857017cb5df04c95f7a25 SRR12161457.sra SRR12161457.sra file validated SRR12161457 is paired end SRR12161457 is conventional basespace SRR12161457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.382 37.0 37.0 37.0 37.0 37.0 2 36.3085 37.0 37.0 37.0 37.0 37.0 3 36.3925 37.0 37.0 37.0 37.0 37.0 4 36.4575 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.58 37.0 37.0 37.0 37.0 37.0 7 36.3955 37.0 37.0 37.0 37.0 37.0 8 36.3725 37.0 37.0 37.0 37.0 37.0 9 36.452 37.0 37.0 37.0 37.0 37.0 10-14 36.498000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.439800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.420500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3653 37.0 37.0 37.0 37.0 37.0 30-34 36.3078 37.0 37.0 37.0 37.0 37.0 35-39 36.2891 37.0 37.0 37.0 37.0 37.0 40-44 36.2774 37.0 37.0 37.0 37.0 37.0 45-49 36.2606 37.0 37.0 37.0 37.0 37.0 50-54 36.271100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.177800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1986 37.0 37.0 37.0 37.0 37.0 65-69 36.1884 37.0 37.0 37.0 37.0 37.0 70-74 36.0461 37.0 37.0 37.0 37.0 37.0 75-79 36.124 37.0 37.0 37.0 37.0 37.0 80-84 36.029900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0497 37.0 37.0 37.0 37.0 37.0 90-94 36.0498 37.0 37.0 37.0 37.0 37.0 95-99 36.0458 37.0 37.0 37.0 37.0 37.0 100-104 35.926 37.0 37.0 37.0 37.0 37.0 105-109 35.916 37.0 37.0 37.0 37.0 37.0 110-114 35.817499999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8755 37.0 37.0 37.0 37.0 37.0 120-124 35.9411 37.0 37.0 37.0 37.0 37.0 125-129 35.8516 37.0 37.0 37.0 37.0 37.0 130-134 35.7459 37.0 37.0 37.0 37.0 37.0 135-139 35.703500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.544200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.586 37.0 37.0 37.0 37.0 37.0 150-151 35.427499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 1.0 25 5.0 26 4.0 27 12.0 28 14.0 29 29.0 30 35.0 31 51.0 32 70.0 33 109.0 34 139.0 35 366.0 36 2847.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.793793793793796 12.787787787787789 7.332332332332332 36.08608608608609 2 20.1 11.875 34.2 33.825 3 17.974999999999998 17.549999999999997 27.55 36.925000000000004 4 21.725 23.549999999999997 24.625 30.099999999999998 5 22.425 30.175 25.5 21.9 6 21.05 33.324999999999996 23.875 21.75 7 15.45 25.374999999999996 42.6 16.575 8 17.474999999999998 25.825 31.5 25.2 9 17.0 23.724999999999998 35.525 23.75 10-14 19.67 29.189999999999998 28.095 23.044999999999998 15-19 19.865 28.475 28.34 23.32 20-24 19.605 28.410000000000004 28.07 23.915 25-29 19.595000000000002 28.599999999999998 27.625 24.18 30-34 19.75 28.48 28.1 23.669999999999998 35-39 20.025000000000002 28.299999999999997 28.134999999999998 23.54 40-44 19.975 28.09 27.88 24.055 45-49 20.43 28.444999999999997 27.534999999999997 23.59 50-54 20.14 28.444999999999997 27.82 23.595 55-59 20.244999999999997 28.660000000000004 28.044999999999998 23.05 60-64 20.255000000000003 28.720000000000002 27.810000000000002 23.215 65-69 20.04 28.875 27.345000000000002 23.74 70-74 20.0 28.485 27.235 24.279999999999998 75-79 20.03 28.389999999999997 27.765 23.815 80-84 20.23 28.645 27.395000000000003 23.73 85-89 20.935000000000002 28.46 27.095000000000002 23.51 90-94 20.349999999999998 28.315 27.405 23.93 95-99 19.79 28.715000000000003 27.91 23.585 100-104 20.275000000000002 28.139999999999997 27.515 24.07 105-109 20.005 28.310000000000002 27.310000000000002 24.375 110-114 20.945 27.445000000000004 27.500000000000004 24.11 115-119 21.01 28.255000000000003 27.644999999999996 23.09 120-124 20.215 29.220000000000002 26.395000000000003 24.169999999999998 125-129 20.26 28.28 27.279999999999998 24.18 130-134 20.68 28.09 26.91 24.32 135-139 20.974999999999998 28.294999999999998 26.57 24.16 140-144 20.79 28.33 27.095000000000002 23.785 145-149 21.62 27.955000000000002 27.0 23.425 150-151 20.75 28.4 26.9125 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 2.0 23 2.0 24 0.5 25 2.0 26 5.5 27 5.5 28 6.0 29 10.5 30 17.5 31 20.5 32 23.0 33 29.5 34 39.0 35 57.5 36 79.5 37 98.0 38 127.0 39 157.0 40 180.0 41 214.0 42 234.0 43 255.5 44 289.0 45 320.5 46 312.5 47 271.5 48 246.5 49 212.0 50 180.0 51 147.5 52 106.5 53 85.5 54 69.5 55 56.0 56 45.0 57 28.0 58 17.0 59 15.5 60 11.0 61 3.0 62 1.0 63 0.5 64 2.0 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.28054535920293 90.85 2 4.562139486103828 8.7 3 0.15731515469323545 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.675 0.0 0.0 0.0 0.0 120-121 5.325 0.0 0.0 0.0 0.0 122-123 5.85 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 6.85 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 8.075 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.3625 0.0 0.0 0.0 0.0 136-137 10.0 0.0 0.0 0.0 0.0 138-139 10.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCAT 10 0.006830828 145.0 1 TACATTT 10 0.006830828 145.0 7 >>END_MODULE SRR12161457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.254 37.0 37.0 37.0 37.0 37.0 2 36.012 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.0605 37.0 37.0 37.0 37.0 37.0 5 36.08 37.0 37.0 37.0 37.0 37.0 6 36.1375 37.0 37.0 37.0 37.0 37.0 7 36.204 37.0 37.0 37.0 37.0 37.0 8 36.133 37.0 37.0 37.0 37.0 37.0 9 36.113 37.0 37.0 37.0 37.0 37.0 10-14 36.188599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2077 37.0 37.0 37.0 37.0 37.0 20-24 36.1173 37.0 37.0 37.0 37.0 37.0 25-29 36.0346 37.0 37.0 37.0 37.0 37.0 30-34 35.9965 37.0 37.0 37.0 37.0 37.0 35-39 35.9625 37.0 37.0 37.0 37.0 37.0 40-44 35.888999999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.924899999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.8528 37.0 37.0 37.0 37.0 37.0 55-59 35.882600000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.837500000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.7616 37.0 37.0 37.0 37.0 37.0 70-74 35.763099999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.7423 37.0 37.0 37.0 37.0 37.0 80-84 35.7101 37.0 37.0 37.0 37.0 37.0 85-89 35.7036 37.0 37.0 37.0 37.0 37.0 90-94 35.6346 37.0 37.0 37.0 37.0 37.0 95-99 35.6181 37.0 37.0 37.0 37.0 37.0 100-104 35.5992 37.0 37.0 37.0 37.0 37.0 105-109 35.522800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.4427 37.0 37.0 37.0 37.0 37.0 115-119 35.4836 37.0 37.0 37.0 37.0 37.0 120-124 35.4217 37.0 37.0 37.0 37.0 37.0 125-129 35.281600000000005 37.0 37.0 37.0 34.6 37.0 130-134 35.2447 37.0 37.0 37.0 34.6 37.0 135-139 35.115 37.0 37.0 37.0 27.4 37.0 140-144 34.9971 37.0 37.0 37.0 25.0 37.0 145-149 35.0274 37.0 37.0 37.0 25.0 37.0 150-151 34.58725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 6.0 15 2.0 16 3.0 17 0.0 18 1.0 19 4.0 20 1.0 21 2.0 22 4.0 23 6.0 24 8.0 25 14.0 26 16.0 27 13.0 28 12.0 29 26.0 30 25.0 31 59.0 32 75.0 33 124.0 34 242.0 35 603.0 36 2533.0 37 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.15 25.624999999999996 10.025 22.2 2 28.825 26.75 28.225 16.2 3 22.2 28.749999999999996 30.925000000000004 18.125 4 23.525 33.775 23.575 19.125 5 23.9 37.65 21.75 16.7 6 22.0 38.6 22.55 16.85 7 22.025 21.825 37.65 18.5 8 22.45 26.474999999999998 26.625 24.45 9 21.15 24.975 30.725 23.150000000000002 10-14 23.915 29.195 26.205000000000002 20.685000000000002 15-19 23.65 27.72 27.655 20.974999999999998 20-24 23.605 29.24 27.18 19.975 25-29 23.195 28.74 27.16 20.905 30-34 23.34 28.854999999999997 27.975 19.830000000000002 35-39 22.85 28.225 28.24 20.685000000000002 40-44 23.7 28.27 28.084999999999997 19.945 45-49 23.135 28.310000000000002 27.67 20.885 50-54 22.955000000000002 28.360000000000003 27.810000000000002 20.875 55-59 23.87 28.16 27.750000000000004 20.22 60-64 23.64 27.900000000000002 28.199999999999996 20.26 65-69 24.245 27.495000000000005 27.894999999999996 20.365 70-74 23.505000000000003 27.825 27.779999999999998 20.89 75-79 23.695 28.255000000000003 27.779999999999998 20.27 80-84 24.12 28.634999999999998 27.275 19.97 85-89 24.83 27.450000000000003 27.6 20.119999999999997 90-94 23.335 28.535 27.750000000000004 20.380000000000003 95-99 24.18 28.775000000000002 27.21 19.835 100-104 24.435000000000002 28.33 27.325 19.91 105-109 24.85 27.52 27.555000000000003 20.075000000000003 110-114 24.625 27.560000000000002 27.26 20.555 115-119 24.95 28.51 26.41 20.13 120-124 24.529999999999998 28.249999999999996 27.150000000000002 20.07 125-129 25.575 28.555000000000003 26.58 19.29 130-134 25.924999999999997 27.99 26.745 19.34 135-139 26.615 28.32 26.1 18.965 140-144 26.590000000000003 27.839999999999996 26.5 19.07 145-149 27.529999999999998 28.000000000000004 25.985000000000003 18.485 150-151 28.787499999999998 26.937499999999996 25.55 18.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.0 25 0.5 26 3.5 27 6.5 28 4.0 29 4.5 30 10.0 31 14.5 32 19.5 33 26.5 34 40.5 35 60.0 36 74.0 37 93.5 38 131.0 39 184.5 40 220.5 41 249.5 42 278.5 43 286.5 44 305.0 45 285.0 46 247.5 47 249.5 48 251.0 49 215.0 50 165.0 51 140.0 52 118.0 53 86.5 54 57.5 55 39.0 56 28.5 57 24.5 58 15.5 59 9.0 60 10.0 61 7.0 62 2.5 63 1.5 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 1.0 83 1.5 84 0.5 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10268562401264 90.3 2 4.660347551342812 8.85 3 0.18430753027909424 0.525 4 0.0 0.0 5 0.0 0.0 6 0.02632964718272775 0.15 7 0.02632964718272775 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.9124999999999996 0.0 0.0 0.0 0.0 112-113 3.3625 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.7 0.0 0.0 0.0 0.0 120-121 5.387499999999999 0.0 0.0 0.0 0.0 122-123 5.9 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.425 0.0 0.0 0.0 0.0 130-131 8.1625 0.0 0.0 0.0 0.0 132-133 8.8375 0.0 0.0 0.0 0.0 134-135 9.475000000000001 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCATT 10 0.006830828 145.0 9 CTTGAGT 10 0.006830828 145.0 4 GGGGGGG 105 5.384163E-6 20.714285 145 >>END_MODULE Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187913 spots for SRR12161457.sra Written 1187913 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra Read 1187904 spots for SRR12161457.sra Written 1187904 spots for SRR12161457.sra SRR ids: ['SRR12161457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_unk9blkm SRR12161457.sra spots: 23758089 blocks: [[1, 1187904], [1187905, 2375808], [2375809, 3563712], [3563713, 4751616], [4751617, 5939520], [5939521, 7127424], [7127425, 8315328], [8315329, 9503232], [9503233, 10691136], [10691137, 11879040], [11879041, 13066944], [13066945, 14254848], [14254849, 15442752], [15442753, 16630656], [16630657, 17818560], [17818561, 19006464], [19006465, 20194368], [20194369, 21382272], [21382273, 22570176], [22570177, 23758089]] SRR12161457 file size 8052337 SRR12161457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161457 SRR12161457_1.fastq SRR12161457_2.fastq Input file: SRR12161457_1.fastq Paired file: SRR12161457_2.fastq trimmed: SRR12161457-trimmed-pair1.fastq, SRR12161457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:13:56 2025 >> started Thu Feb 13 23:14:26 2025 >> done (29.998s) 23758089 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 24656 ( 0.10%) empty read pairs filtered out after trimming by size control 23733358 (99.90%) read pairs available; of these: 3285583 (13.84%) trimmed read pairs available after processing 20447775 (86.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 8 0.00% 21 12 0.00% 22 16 0.00% 23 23 0.00% 24 25 0.00% 25 27 0.00% 26 32 0.00% 27 26 0.00% 28 36 0.00% 29 27 0.00% 30 41 0.00% 31 59 0.00% 32 44 0.00% 33 39 0.00% 34 36 0.00% 35 46 0.00% 36 43 0.00% 37 54 0.00% 38 58 0.00% 39 56 0.00% 40 57 0.00% 41 74 0.00% 42 76 0.00% 43 87 0.00% 44 98 0.00% 45 88 0.00% 46 124 0.00% 47 115 0.00% 48 111 0.00% 49 137 0.00% 50 147 0.00% 51 193 0.00% 52 187 0.00% 53 218 0.00% 54 210 0.00% 55 251 0.00% 56 248 0.00% 57 289 0.00% 58 336 0.00% 59 403 0.00% 60 424 0.00% 61 455 0.00% 62 585 0.00% 63 676 0.00% 64 697 0.00% 65 769 0.00% 66 825 0.00% 67 918 0.00% 68 1120 0.00% 69 1273 0.01% 70 1353 0.01% 71 1607 0.01% 72 1892 0.01% 73 2228 0.01% 74 2463 0.01% 75 2677 0.01% 76 2980 0.01% 77 3312 0.01% 78 3647 0.02% 79 4084 0.02% 80 4749 0.02% 81 5300 0.02% 82 5965 0.03% 83 6775 0.03% 84 7533 0.03% 85 8418 0.04% 86 9062 0.04% 87 9645 0.04% 88 10489 0.04% 89 11355 0.05% 90 12276 0.05% 91 13803 0.06% 92 14907 0.06% 93 16355 0.07% 94 17898 0.08% 95 19096 0.08% 96 20563 0.09% 97 21562 0.09% 98 22461 0.09% 99 23786 0.10% 100 25043 0.11% 101 26598 0.11% 102 28579 0.12% 103 30638 0.13% 104 32153 0.14% 105 33697 0.14% 106 35229 0.15% 107 36036 0.15% 108 36696 0.15% 109 37982 0.16% 110 39332 0.17% 111 40665 0.17% 112 43091 0.18% 113 43951 0.19% 114 46215 0.19% 115 48137 0.20% 116 49232 0.21% 117 50419 0.21% 118 51463 0.22% 119 52201 0.22% 120 53741 0.23% 121 55140 0.23% 122 56378 0.24% 123 58185 0.25% 124 60290 0.25% 125 61088 0.26% 126 62663 0.26% 127 63425 0.27% 128 64737 0.27% 129 65043 0.27% 130 65779 0.28% 131 66669 0.28% 132 68229 0.29% 133 69792 0.29% 134 71916 0.30% 135 73402 0.31% 136 73974 0.31% 137 73953 0.31% 138 74520 0.31% 139 74851 0.32% 140 75692 0.32% 141 76782 0.32% 142 77717 0.33% 143 78413 0.33% 144 80543 0.34% 145 81707 0.34% 146 82164 0.35% 147 82864 0.35% 148 82867 0.35% 149 82002 0.35% 150 83542 0.35% 151 20447775 86.16% 23733358 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=31 prefix-density=0.37 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=11.54 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=4.0 sequence=TCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=557.87 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=14.8 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGT SRR12161457 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:15:09 Started mapping on | Feb 13 23:15:09 Finished on | Feb 13 23:18:15 Mapping speed, Million of reads per hour | 459.36 Number of input reads | 23733358 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22104905 Uniquely mapped reads % | 93.14% Average mapped length | 293.60 Number of splices: Total | 22541594 Number of splices: Annotated (sjdb) | 22064839 Number of splices: GT/AG | 22177013 Number of splices: GC/AG | 274796 Number of splices: AT/AC | 18174 Number of splices: Non-canonical | 71611 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 739128 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 41564 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 889325 889325 889325 N_multimapping 739128 739128 739128 N_noFeature 524475 21885229 628701 N_ambiguous 241023 1871 124814 UnstrandedReadsAssigned:21339407 PositiveStrandReadsAssigned:217805 NegativeStrandReadsAssigned:21351390 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161457-trimmed-pair1.fastq SRR12161457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,733,358 reads, 21,499,386 reads pseudoaligned [quant] estimated average fragment length: 247.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR12161457.ke.tsv 34699 SRR12161457.se.tsv 87100 total ==> SRR12161457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.96 4398 110.485 Potri.005G024800.1.v4.1 1035 788.955 960 54.1653 Potri.004G059700.1.v4.1 961 715.034 461 28.6996 Potri.007G009000.2.v4.1 1416 1169.96 0 0 Potri.003G141000.2.v4.1 2943 2696.96 868 14.3268 Potri.016G087400.1.v4.1 270 90.0963 1174.18 580.137 Potri.015G069301.1.v4.1 564 329.702 0 0 Potri.010G195200.1.v4.1 1773 1526.96 213 6.20948 Potri.012G127500.1.v4.1 977 730.998 10147 617.907 ==> SRR12161457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 513 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4405 SRR12161457 completed mapping pipeline successfully