Starting /dee2/code/volunteer_pipeline.sh SRR12161458 current disk space = 3089264324608 free memory = 1459575416 SRR12161458 SRAfilesize 5e6cf757fea994aaa775ee49a11b3c71 SRR12161458.sra SRR12161458.sra file validated SRR12161458 is paired end SRR12161458 is conventional basespace SRR12161458 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.473 37.0 37.0 37.0 37.0 37.0 2 36.4095 37.0 37.0 37.0 37.0 37.0 3 36.482 37.0 37.0 37.0 37.0 37.0 4 36.5275 37.0 37.0 37.0 37.0 37.0 5 36.6105 37.0 37.0 37.0 37.0 37.0 6 36.667 37.0 37.0 37.0 37.0 37.0 7 36.446 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.449 37.0 37.0 37.0 37.0 37.0 10-14 36.535199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4738 37.0 37.0 37.0 37.0 37.0 20-24 36.5017 37.0 37.0 37.0 37.0 37.0 25-29 36.402499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.387299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3609 37.0 37.0 37.0 37.0 37.0 40-44 36.3283 37.0 37.0 37.0 37.0 37.0 45-49 36.319900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.33970000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2513 37.0 37.0 37.0 37.0 37.0 60-64 36.248900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.217200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1903 37.0 37.0 37.0 37.0 37.0 75-79 36.1959 37.0 37.0 37.0 37.0 37.0 80-84 36.126 37.0 37.0 37.0 37.0 37.0 85-89 36.0976 37.0 37.0 37.0 37.0 37.0 90-94 36.1117 37.0 37.0 37.0 37.0 37.0 95-99 36.0967 37.0 37.0 37.0 37.0 37.0 100-104 36.0446 37.0 37.0 37.0 37.0 37.0 105-109 36.0381 37.0 37.0 37.0 37.0 37.0 110-114 35.906000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.9255 37.0 37.0 37.0 37.0 37.0 120-124 35.9392 37.0 37.0 37.0 37.0 37.0 125-129 35.8677 37.0 37.0 37.0 37.0 37.0 130-134 35.7557 37.0 37.0 37.0 37.0 37.0 135-139 35.713300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.6456 37.0 37.0 37.0 37.0 37.0 145-149 35.6337 37.0 37.0 37.0 37.0 37.0 150-151 35.471999999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 0.0 26 3.0 27 8.0 28 15.0 29 22.0 30 38.0 31 62.0 32 63.0 33 80.0 34 129.0 35 357.0 36 2899.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.340010015022536 11.542313470205308 6.509764646970456 38.607911867801704 2 19.650000000000002 12.625 36.4 31.324999999999996 3 18.6 17.125 29.25 35.025 4 21.5 23.775 26.900000000000002 27.825 5 23.05 30.2 25.074999999999996 21.675 6 21.4 34.949999999999996 23.275000000000002 20.375 7 15.425 28.349999999999998 39.7 16.525000000000002 8 16.3 26.224999999999998 33.1 24.375 9 16.975 23.575 34.699999999999996 24.75 10-14 18.990000000000002 29.43 28.57 23.01 15-19 19.845 27.845 28.525 23.785 20-24 20.44 27.794999999999998 28.705000000000002 23.06 25-29 20.455000000000002 28.244999999999997 28.139999999999997 23.16 30-34 19.595000000000002 28.485 28.235 23.685000000000002 35-39 19.97 27.900000000000002 28.435 23.695 40-44 20.02 28.435 28.044999999999998 23.5 45-49 19.900000000000002 28.38 28.125 23.595 50-54 20.369999999999997 28.110000000000003 28.17 23.35 55-59 19.845 28.465 27.595 24.095 60-64 20.13 28.515 27.575 23.78 65-69 20.13 28.12 28.34 23.41 70-74 20.055 28.395 27.62 23.93 75-79 20.025000000000002 28.205000000000002 27.944999999999997 23.825 80-84 20.515 28.165000000000003 28.075 23.244999999999997 85-89 20.26 28.835 27.57 23.335 90-94 19.81 28.689999999999998 27.644999999999996 23.855 95-99 20.375 29.020000000000003 27.52 23.085 100-104 20.275000000000002 28.249999999999996 28.125 23.35 105-109 20.27 28.34 27.845 23.544999999999998 110-114 20.865000000000002 28.63 27.229999999999997 23.275000000000002 115-119 21.165 28.4 27.265 23.169999999999998 120-124 20.96 28.38 27.3 23.36 125-129 20.775 27.38 28.000000000000004 23.845 130-134 20.65 28.110000000000003 27.305 23.935000000000002 135-139 20.62 27.725 28.02 23.635 140-144 21.26 28.139999999999997 27.325 23.275000000000002 145-149 20.615 28.26 27.165 23.96 150-151 20.9375 28.262500000000003 27.05 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 2.5 26 5.0 27 7.5 28 9.0 29 9.5 30 16.0 31 21.5 32 21.0 33 28.5 34 44.0 35 61.0 36 73.5 37 87.0 38 129.0 39 169.5 40 198.0 41 227.0 42 255.0 43 288.5 44 289.5 45 296.0 46 301.0 47 263.0 48 232.5 49 207.0 50 176.0 51 150.0 52 120.0 53 86.5 54 65.5 55 51.5 56 35.5 57 21.5 58 14.0 59 13.0 60 7.0 61 2.5 62 1.0 63 0.0 64 0.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4752841660058 89.35 2 5.313243457573354 10.05 3 0.21147237642083003 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 4.95 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.9875 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.8375 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161458 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4125 37.0 37.0 37.0 37.0 37.0 2 36.085 37.0 37.0 37.0 37.0 37.0 3 36.1015 37.0 37.0 37.0 37.0 37.0 4 36.323 37.0 37.0 37.0 37.0 37.0 5 36.289 37.0 37.0 37.0 37.0 37.0 6 36.1825 37.0 37.0 37.0 37.0 37.0 7 36.294 37.0 37.0 37.0 37.0 37.0 8 36.3105 37.0 37.0 37.0 37.0 37.0 9 36.282 37.0 37.0 37.0 37.0 37.0 10-14 36.273300000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.3077 37.0 37.0 37.0 37.0 37.0 20-24 36.202999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1509 37.0 37.0 37.0 37.0 37.0 30-34 36.1359 37.0 37.0 37.0 37.0 37.0 35-39 36.1489 37.0 37.0 37.0 37.0 37.0 40-44 36.054 37.0 37.0 37.0 37.0 37.0 45-49 36.1005 37.0 37.0 37.0 37.0 37.0 50-54 36.0329 37.0 37.0 37.0 37.0 37.0 55-59 36.02329999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.9441 37.0 37.0 37.0 37.0 37.0 65-69 35.8685 37.0 37.0 37.0 37.0 37.0 70-74 35.8981 37.0 37.0 37.0 37.0 37.0 75-79 35.8746 37.0 37.0 37.0 37.0 37.0 80-84 35.84490000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.7637 37.0 37.0 37.0 37.0 37.0 90-94 35.7583 37.0 37.0 37.0 37.0 37.0 95-99 35.7502 37.0 37.0 37.0 37.0 37.0 100-104 35.8087 37.0 37.0 37.0 37.0 37.0 105-109 35.5985 37.0 37.0 37.0 37.0 37.0 110-114 35.6281 37.0 37.0 37.0 37.0 37.0 115-119 35.5862 37.0 37.0 37.0 37.0 37.0 120-124 35.513999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5098 37.0 37.0 37.0 37.0 37.0 130-134 35.46 37.0 37.0 37.0 37.0 37.0 135-139 35.374199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.2604 37.0 37.0 37.0 34.6 37.0 145-149 35.1827 37.0 37.0 37.0 29.8 37.0 150-151 34.879999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 3.0 16 2.0 17 3.0 18 1.0 19 2.0 20 0.0 21 2.0 22 4.0 23 3.0 24 14.0 25 14.0 26 11.0 27 5.0 28 20.0 29 20.0 30 28.0 31 38.0 32 61.0 33 100.0 34 190.0 35 533.0 36 2674.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.25 26.6 9.525 24.625 2 28.549999999999997 26.450000000000003 27.975 17.025000000000002 3 19.8 28.299999999999997 33.125 18.775 4 22.575 35.05 24.0 18.375 5 24.9 37.0 21.125 16.975 6 20.225 40.25 21.65 17.875 7 21.0 23.724999999999998 36.825 18.45 8 19.475 25.3 28.575 26.650000000000002 9 21.75 26.05 29.825000000000003 22.375 10-14 23.135 30.099999999999998 26.06 20.705000000000002 15-19 23.225 28.415000000000003 27.315 21.044999999999998 20-24 22.235 29.365000000000002 27.700000000000003 20.7 25-29 22.59 28.599999999999998 27.900000000000002 20.91 30-34 23.09 28.310000000000002 27.665 20.935000000000002 35-39 22.625 28.27 27.88 21.224999999999998 40-44 23.39 27.779999999999998 27.985 20.845 45-49 22.705000000000002 27.655 28.535 21.105 50-54 22.835 28.055000000000003 28.235 20.875 55-59 22.655 28.175 28.12 21.05 60-64 22.97 28.084999999999997 28.415000000000003 20.53 65-69 23.189999999999998 28.125 27.71 20.974999999999998 70-74 23.25 28.235 27.55 20.965 75-79 23.77 28.555000000000003 27.644999999999996 20.03 80-84 23.775 28.115000000000002 27.675 20.435 85-89 23.84 27.889999999999997 27.985 20.285 90-94 23.849999999999998 29.225 26.71 20.215 95-99 23.5 28.875 27.045 20.580000000000002 100-104 24.805 27.950000000000003 27.3 19.945 105-109 23.400000000000002 28.93 27.485 20.185 110-114 24.855 28.185 27.105 19.855 115-119 24.165 28.565 27.245 20.025000000000002 120-124 24.93 28.785 26.384999999999998 19.900000000000002 125-129 24.295 28.610000000000003 26.985 20.11 130-134 24.72 28.549999999999997 27.24 19.49 135-139 25.255 28.07 27.339999999999996 19.335 140-144 25.264999999999997 27.71 27.76 19.265 145-149 25.840000000000003 28.035 26.955000000000002 19.17 150-151 27.325 26.787499999999998 26.637499999999996 19.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.0 19 1.0 20 0.0 21 1.5 22 3.0 23 2.0 24 2.5 25 5.0 26 4.5 27 6.5 28 6.0 29 7.0 30 14.5 31 16.0 32 22.5 33 32.0 34 37.0 35 61.5 36 87.5 37 110.0 38 131.0 39 156.0 40 195.0 41 230.5 42 259.0 43 297.5 44 310.0 45 306.5 46 284.5 47 259.5 48 246.0 49 205.0 50 160.0 51 118.0 52 99.0 53 79.5 54 58.5 55 47.0 56 36.5 57 24.0 58 18.0 59 13.0 60 7.5 61 6.0 62 4.5 63 3.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 1.0 86 1.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.41489361702128 88.75 2 5.212765957446808 9.8 3 0.2925531914893617 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.05319148936170213 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026595744680851064 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 13 0.325 No Hit GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.4875 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.4875 0.0 0.0 0.0 0.0 136-137 6.9375 0.0 0.0 0.0 0.0 138-139 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCC 10 0.006830828 145.0 145 >>END_MODULE Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862255 spots for SRR12161458.sra Written 1862255 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra Read 1862251 spots for SRR12161458.sra Written 1862251 spots for SRR12161458.sra SRR ids: ['SRR12161458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uurbl4qg SRR12161458.sra spots: 37245024 blocks: [[1, 1862251], [1862252, 3724502], [3724503, 5586753], [5586754, 7449004], [7449005, 9311255], [9311256, 11173506], [11173507, 13035757], [13035758, 14898008], [14898009, 16760259], [16760260, 18622510], [18622511, 20484761], [20484762, 22347012], [22347013, 24209263], [24209264, 26071514], [26071515, 27933765], [27933766, 29796016], [29796017, 31658267], [31658268, 33520518], [33520519, 35382769], [35382770, 37245024]] SRR12161458 file size 12635788 SRR12161458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161458 SRR12161458_1.fastq SRR12161458_2.fastq Input file: SRR12161458_1.fastq Paired file: SRR12161458_2.fastq trimmed: SRR12161458-trimmed-pair1.fastq, SRR12161458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:35:05 2025 >> started Thu Feb 13 23:35:51 2025 >> done (45.821s) 37245024 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 8780 ( 0.02%) empty read pairs filtered out after trimming by size control 37236146 (99.98%) read pairs available; of these: 4239984 (11.39%) trimmed read pairs available after processing 32996162 (88.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 13 0.00% 21 18 0.00% 22 30 0.00% 23 38 0.00% 24 36 0.00% 25 53 0.00% 26 44 0.00% 27 52 0.00% 28 60 0.00% 29 62 0.00% 30 63 0.00% 31 55 0.00% 32 70 0.00% 33 75 0.00% 34 65 0.00% 35 77 0.00% 36 73 0.00% 37 80 0.00% 38 91 0.00% 39 96 0.00% 40 92 0.00% 41 91 0.00% 42 108 0.00% 43 106 0.00% 44 102 0.00% 45 109 0.00% 46 111 0.00% 47 140 0.00% 48 133 0.00% 49 175 0.00% 50 184 0.00% 51 217 0.00% 52 213 0.00% 53 231 0.00% 54 259 0.00% 55 266 0.00% 56 292 0.00% 57 344 0.00% 58 340 0.00% 59 422 0.00% 60 408 0.00% 61 536 0.00% 62 520 0.00% 63 631 0.00% 64 674 0.00% 65 736 0.00% 66 820 0.00% 67 883 0.00% 68 1031 0.00% 69 1176 0.00% 70 1304 0.00% 71 1553 0.00% 72 1760 0.00% 73 2000 0.01% 74 2233 0.01% 75 2405 0.01% 76 2774 0.01% 77 2850 0.01% 78 3149 0.01% 79 3687 0.01% 80 4315 0.01% 81 4699 0.01% 82 5459 0.01% 83 6151 0.02% 84 6901 0.02% 85 7704 0.02% 86 8288 0.02% 87 8981 0.02% 88 9732 0.03% 89 10694 0.03% 90 11702 0.03% 91 13147 0.04% 92 14469 0.04% 93 15819 0.04% 94 17722 0.05% 95 18778 0.05% 96 20322 0.05% 97 21637 0.06% 98 23167 0.06% 99 24514 0.07% 100 25898 0.07% 101 28125 0.08% 102 30681 0.08% 103 32894 0.09% 104 34448 0.09% 105 36894 0.10% 106 38750 0.10% 107 40519 0.11% 108 41897 0.11% 109 43273 0.12% 110 45900 0.12% 111 47886 0.13% 112 50456 0.14% 113 52922 0.14% 114 55406 0.15% 115 58166 0.16% 116 60292 0.16% 117 61515 0.17% 118 63329 0.17% 119 65105 0.17% 120 67116 0.18% 121 69573 0.19% 122 71230 0.19% 123 74793 0.20% 124 77610 0.21% 125 79462 0.21% 126 82183 0.22% 127 83633 0.22% 128 87205 0.23% 129 85570 0.23% 130 87768 0.24% 131 89776 0.24% 132 91232 0.25% 133 95285 0.26% 134 98601 0.26% 135 101104 0.27% 136 101449 0.27% 137 103664 0.28% 138 105178 0.28% 139 105477 0.28% 140 108186 0.29% 141 108209 0.29% 142 110584 0.30% 143 112598 0.30% 144 116117 0.31% 145 118726 0.32% 146 118806 0.32% 147 120591 0.32% 148 120293 0.32% 149 120313 0.32% 150 122858 0.33% 151 32996162 88.61% 37236146 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=15 prefix-density=1.04 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=28.31 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.5 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=17 prefix-density=1.15 prefix-fanout=2.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=77.14 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.4 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATAT SRR12161458 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:37:25 Started mapping on | Feb 13 23:37:26 Finished on | Feb 13 23:41:29 Mapping speed, Million of reads per hour | 551.65 Number of input reads | 37236146 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 32086379 Uniquely mapped reads % | 86.17% Average mapped length | 288.67 Number of splices: Total | 33195661 Number of splices: Annotated (sjdb) | 32492042 Number of splices: GT/AG | 32653154 Number of splices: GC/AG | 420053 Number of splices: AT/AC | 27924 Number of splices: Non-canonical | 94530 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 918089 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 53691 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.10% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4231679 4231679 4231679 N_multimapping 918089 918089 918089 N_noFeature 821978 31837977 933822 N_ambiguous 527670 2924 389586 UnstrandedReadsAssigned:30736731 PositiveStrandReadsAssigned:245478 NegativeStrandReadsAssigned:30762971 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161458-trimmed-pair1.fastq SRR12161458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,236,146 reads, 33,683,034 reads pseudoaligned [quant] estimated average fragment length: 241.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12161458.ke.tsv 34699 SRR12161458.se.tsv 87100 total ==> SRR12161458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.57 4281 70.8337 Potri.005G024800.1.v4.1 1035 794.572 904 33.4624 Potri.004G059700.1.v4.1 961 720.676 88 3.59141 Potri.007G009000.2.v4.1 1416 1175.57 0 0 Potri.003G141000.2.v4.1 2943 2702.57 1587.9 17.281 Potri.016G087400.1.v4.1 270 90.5294 1488 483.432 Potri.015G069301.1.v4.1 564 333.587 0 0 Potri.010G195200.1.v4.1 1773 1532.57 639 12.2631 Potri.012G127500.1.v4.1 977 736.633 9973 398.196 ==> SRR12161458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 760 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2068 SRR12161458 completed mapping pipeline successfully