Starting /dee2/code/volunteer_pipeline.sh SRR12161459 current disk space = 3089243037696 free memory = 1449999520 SRR12161459 SRAfilesize 5e0a6583e3ef921e7ff2ab0f62f760d2 SRR12161459.sra SRR12161459.sra file validated SRR12161459 is paired end SRR12161459 is conventional basespace SRR12161459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34875 37.0 37.0 37.0 37.0 37.0 2 36.4165 37.0 37.0 37.0 37.0 37.0 3 36.596 37.0 37.0 37.0 37.0 37.0 4 36.5235 37.0 37.0 37.0 37.0 37.0 5 36.5585 37.0 37.0 37.0 37.0 37.0 6 36.606 37.0 37.0 37.0 37.0 37.0 7 36.489 37.0 37.0 37.0 37.0 37.0 8 36.3625 37.0 37.0 37.0 37.0 37.0 9 36.576 37.0 37.0 37.0 37.0 37.0 10-14 36.5406 37.0 37.0 37.0 37.0 37.0 15-19 36.5303 37.0 37.0 37.0 37.0 37.0 20-24 36.501200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4442 37.0 37.0 37.0 37.0 37.0 30-34 36.3752 37.0 37.0 37.0 37.0 37.0 35-39 36.371399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3802 37.0 37.0 37.0 37.0 37.0 45-49 36.386399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.362500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.255199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3106 37.0 37.0 37.0 37.0 37.0 65-69 36.249 37.0 37.0 37.0 37.0 37.0 70-74 36.2642 37.0 37.0 37.0 37.0 37.0 75-79 36.219 37.0 37.0 37.0 37.0 37.0 80-84 36.154700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1031 37.0 37.0 37.0 37.0 37.0 90-94 36.1942 37.0 37.0 37.0 37.0 37.0 95-99 36.172 37.0 37.0 37.0 37.0 37.0 100-104 36.049099999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0395 37.0 37.0 37.0 37.0 37.0 110-114 35.912 37.0 37.0 37.0 37.0 37.0 115-119 35.997499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9917 37.0 37.0 37.0 37.0 37.0 125-129 35.876 37.0 37.0 37.0 37.0 37.0 130-134 35.8186 37.0 37.0 37.0 37.0 37.0 135-139 35.8094 37.0 37.0 37.0 37.0 37.0 140-144 35.736599999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7433 37.0 37.0 37.0 37.0 37.0 150-151 35.52825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 9.0 27 5.0 28 21.0 29 24.0 30 31.0 31 50.0 32 47.0 33 75.0 34 107.0 35 329.0 36 2938.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.42982676374592 12.578458448405724 6.402209389907106 44.589505397941245 2 17.9 13.825000000000001 37.5 30.775000000000002 3 16.400000000000002 15.75 27.125 40.725 4 21.05 23.0 23.775 32.175 5 21.825 30.075000000000003 24.875 23.225 6 20.674999999999997 34.300000000000004 24.4 20.625 7 14.75 28.849999999999998 39.65 16.75 8 17.424999999999997 27.575 31.45 23.549999999999997 9 18.675 23.849999999999998 35.075 22.400000000000002 10-14 19.445 29.959999999999997 27.555000000000003 23.04 15-19 20.09 27.685 28.18 24.044999999999998 20-24 19.41 29.005 27.52 24.065 25-29 19.325 29.659999999999997 27.66 23.355 30-34 19.64 29.354999999999997 27.16 23.845 35-39 19.52 28.67 28.28 23.53 40-44 19.335 28.610000000000003 28.325 23.73 45-49 20.14 28.08 27.675 24.104999999999997 50-54 19.68 28.52 27.900000000000002 23.9 55-59 19.725 28.59 27.700000000000003 23.985 60-64 19.82 28.720000000000002 27.779999999999998 23.68 65-69 20.080000000000002 28.384999999999998 28.565 22.97 70-74 20.455000000000002 28.575 27.52 23.45 75-79 20.21 28.395 27.205000000000002 24.19 80-84 20.48 28.48 27.810000000000002 23.23 85-89 19.93 28.345 28.26 23.465 90-94 20.21 28.15 27.665 23.974999999999998 95-99 19.830000000000002 28.810000000000002 27.534999999999997 23.825 100-104 20.385 28.24 28.275 23.1 105-109 20.64 28.215 27.705000000000002 23.44 110-114 20.455000000000002 28.535 27.495000000000005 23.515 115-119 20.880000000000003 28.42 27.205000000000002 23.494999999999997 120-124 20.294999999999998 28.21 27.63 23.865 125-129 20.575 27.915 27.755000000000003 23.755000000000003 130-134 20.32 28.444999999999997 27.46 23.775 135-139 20.715 28.02 27.47 23.794999999999998 140-144 20.880000000000003 28.095 27.525 23.5 145-149 21.055 28.384999999999998 26.715 23.845 150-151 20.75 28.449999999999996 26.6 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 0.5 24 1.0 25 2.5 26 3.5 27 7.0 28 10.0 29 10.0 30 11.5 31 14.5 32 23.0 33 34.0 34 45.0 35 65.5 36 77.0 37 97.0 38 130.0 39 149.5 40 190.0 41 238.5 42 267.5 43 292.5 44 289.0 45 269.0 46 282.0 47 280.5 48 243.5 49 215.0 50 190.0 51 156.0 52 118.5 53 90.5 54 67.5 55 41.5 56 27.0 57 20.0 58 13.0 59 10.5 60 6.5 61 2.5 62 1.0 63 0.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.32930989241669 90.825 2 4.382051954867489 8.35 3 0.2886381527158226 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.475 0.0 0.0 0.0 0.0 126-127 3.8499999999999996 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.637499999999999 0.0 0.0 0.0 0.0 132-133 5.012499999999999 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.452 37.0 37.0 37.0 37.0 37.0 2 36.2175 37.0 37.0 37.0 37.0 37.0 3 36.3955 37.0 37.0 37.0 37.0 37.0 4 36.223 37.0 37.0 37.0 37.0 37.0 5 36.3515 37.0 37.0 37.0 37.0 37.0 6 36.3755 37.0 37.0 37.0 37.0 37.0 7 36.261 37.0 37.0 37.0 37.0 37.0 8 36.336 37.0 37.0 37.0 37.0 37.0 9 36.308 37.0 37.0 37.0 37.0 37.0 10-14 36.3623 37.0 37.0 37.0 37.0 37.0 15-19 36.3557 37.0 37.0 37.0 37.0 37.0 20-24 36.308899999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2241 37.0 37.0 37.0 37.0 37.0 30-34 36.262600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.217200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.176 37.0 37.0 37.0 37.0 37.0 45-49 36.1649 37.0 37.0 37.0 37.0 37.0 50-54 36.114 37.0 37.0 37.0 37.0 37.0 55-59 36.0745 37.0 37.0 37.0 37.0 37.0 60-64 36.0693 37.0 37.0 37.0 37.0 37.0 65-69 36.0304 37.0 37.0 37.0 37.0 37.0 70-74 36.0037 37.0 37.0 37.0 37.0 37.0 75-79 35.9518 37.0 37.0 37.0 37.0 37.0 80-84 35.9383 37.0 37.0 37.0 37.0 37.0 85-89 35.97330000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.897800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.869699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.858 37.0 37.0 37.0 37.0 37.0 105-109 35.84 37.0 37.0 37.0 37.0 37.0 110-114 35.7233 37.0 37.0 37.0 37.0 37.0 115-119 35.7216 37.0 37.0 37.0 37.0 37.0 120-124 35.6748 37.0 37.0 37.0 37.0 37.0 125-129 35.6559 37.0 37.0 37.0 37.0 37.0 130-134 35.5858 37.0 37.0 37.0 37.0 37.0 135-139 35.5148 37.0 37.0 37.0 37.0 37.0 140-144 35.352199999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.443299999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.1235 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 3.0 23 12.0 24 5.0 25 6.0 26 8.0 27 11.0 28 16.0 29 19.0 30 27.0 31 46.0 32 54.0 33 73.0 34 192.0 35 494.0 36 2759.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.6 24.025 10.025 30.349999999999998 2 26.775 27.175 31.3 14.75 3 20.05 28.4 30.125 21.425 4 23.225 33.725 24.725 18.325 5 24.625 36.525 21.675 17.175 6 20.45 39.574999999999996 22.400000000000002 17.575 7 18.625 23.674999999999997 37.974999999999994 19.725 8 20.200000000000003 26.025 28.625 25.15 9 21.175 24.675 31.724999999999998 22.425 10-14 22.96 29.494999999999997 26.295 21.25 15-19 23.01 28.084999999999997 28.21 20.695 20-24 22.869999999999997 28.22 27.865000000000002 21.044999999999998 25-29 22.945 29.15 27.065 20.84 30-34 22.725 29.244999999999997 27.650000000000002 20.380000000000003 35-39 22.525000000000002 28.32 28.134999999999998 21.02 40-44 23.155 28.485 27.955000000000002 20.405 45-49 22.57 28.58 27.925 20.925 50-54 22.965 28.065 28.025 20.945 55-59 22.785 28.439999999999998 27.91 20.865000000000002 60-64 23.02 28.28 28.04 20.66 65-69 23.175 27.825 27.915 21.085 70-74 23.355 27.950000000000003 28.415000000000003 20.28 75-79 23.59 27.565 27.595 21.25 80-84 23.665 28.199999999999996 27.845 20.29 85-89 23.04 28.08 28.63 20.25 90-94 23.435 28.065 28.08 20.419999999999998 95-99 23.169999999999998 28.975 27.015 20.84 100-104 23.68 28.42 27.755000000000003 20.145 105-109 23.82 27.810000000000002 28.015 20.355 110-114 24.035 28.360000000000003 27.575 20.03 115-119 24.19 28.785 26.905 20.119999999999997 120-124 23.945 28.24 27.735 20.080000000000002 125-129 24.52 28.29 27.544999999999998 19.645000000000003 130-134 25.105 28.144999999999996 26.915 19.835 135-139 24.535 28.565 27.634999999999998 19.265 140-144 25.169999999999998 28.325 26.815 19.689999999999998 145-149 25.365 28.09 26.919999999999998 19.625 150-151 26.025 28.4125 26.200000000000003 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.5 26 3.0 27 3.5 28 7.5 29 10.0 30 8.0 31 10.0 32 17.0 33 36.0 34 47.0 35 59.0 36 87.0 37 107.5 38 141.5 39 179.0 40 224.5 41 248.0 42 264.0 43 293.5 44 308.0 45 311.0 46 278.0 47 240.5 48 221.5 49 192.5 50 158.0 51 136.5 52 111.0 53 89.0 54 64.5 55 43.5 56 31.0 57 17.0 58 13.5 59 8.0 60 1.5 61 3.5 62 4.0 63 1.5 64 2.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40561827251247 90.85 2 4.226831189288527 8.05 3 0.31504331845628775 0.8999999999999999 4 0.05250721974271463 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.637499999999999 0.0 0.0 0.0 0.0 132-133 5.012499999999999 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGAAG 10 0.006830828 145.0 145 GAGATTG 10 0.006830828 145.0 3 >>END_MODULE Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865968 spots for SRR12161459.sra Written 1865968 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra Read 1865952 spots for SRR12161459.sra Written 1865952 spots for SRR12161459.sra SRR ids: ['SRR12161459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dsyv8yjw SRR12161459.sra spots: 37319056 blocks: [[1, 1865952], [1865953, 3731904], [3731905, 5597856], [5597857, 7463808], [7463809, 9329760], [9329761, 11195712], [11195713, 13061664], [13061665, 14927616], [14927617, 16793568], [16793569, 18659520], [18659521, 20525472], [20525473, 22391424], [22391425, 24257376], [24257377, 26123328], [26123329, 27989280], [27989281, 29855232], [29855233, 31721184], [31721185, 33587136], [33587137, 35453088], [35453089, 37319056]] SRR12161459 file size 12660947 SRR12161459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161459 SRR12161459_1.fastq SRR12161459_2.fastq Input file: SRR12161459_1.fastq Paired file: SRR12161459_2.fastq trimmed: SRR12161459-trimmed-pair1.fastq, SRR12161459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:29:25 2025 >> started Thu Feb 13 23:30:25 2025 >> done (60.464s) 37319056 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 2595 ( 0.01%) empty read pairs filtered out after trimming by size control 37316399 (99.99%) read pairs available; of these: 3453598 ( 9.25%) trimmed read pairs available after processing 33862801 (90.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 7 0.00% 21 10 0.00% 22 16 0.00% 23 21 0.00% 24 17 0.00% 25 11 0.00% 26 27 0.00% 27 22 0.00% 28 29 0.00% 29 25 0.00% 30 37 0.00% 31 36 0.00% 32 43 0.00% 33 31 0.00% 34 29 0.00% 35 51 0.00% 36 51 0.00% 37 61 0.00% 38 52 0.00% 39 64 0.00% 40 57 0.00% 41 54 0.00% 42 61 0.00% 43 69 0.00% 44 71 0.00% 45 75 0.00% 46 102 0.00% 47 86 0.00% 48 127 0.00% 49 130 0.00% 50 103 0.00% 51 118 0.00% 52 132 0.00% 53 131 0.00% 54 151 0.00% 55 157 0.00% 56 169 0.00% 57 177 0.00% 58 229 0.00% 59 271 0.00% 60 289 0.00% 61 298 0.00% 62 393 0.00% 63 385 0.00% 64 456 0.00% 65 461 0.00% 66 488 0.00% 67 592 0.00% 68 606 0.00% 69 710 0.00% 70 800 0.00% 71 961 0.00% 72 1049 0.00% 73 1247 0.00% 74 1284 0.00% 75 1538 0.00% 76 1689 0.00% 77 1809 0.00% 78 2134 0.01% 79 2267 0.01% 80 2480 0.01% 81 2951 0.01% 82 3369 0.01% 83 3792 0.01% 84 4306 0.01% 85 5116 0.01% 86 5402 0.01% 87 5787 0.02% 88 6521 0.02% 89 7040 0.02% 90 7840 0.02% 91 8649 0.02% 92 9612 0.03% 93 10594 0.03% 94 11684 0.03% 95 12856 0.03% 96 14006 0.04% 97 15173 0.04% 98 16267 0.04% 99 17537 0.05% 100 18444 0.05% 101 19657 0.05% 102 21053 0.06% 103 23075 0.06% 104 24510 0.07% 105 26498 0.07% 106 28392 0.08% 107 30090 0.08% 108 31240 0.08% 109 32896 0.09% 110 34187 0.09% 111 35814 0.10% 112 37968 0.10% 113 39359 0.11% 114 41501 0.11% 115 44428 0.12% 116 45589 0.12% 117 47620 0.13% 118 49744 0.13% 119 51502 0.14% 120 52888 0.14% 121 55576 0.15% 122 56744 0.15% 123 58589 0.16% 124 61184 0.16% 125 63113 0.17% 126 65496 0.18% 127 67928 0.18% 128 69448 0.19% 129 72025 0.19% 130 73727 0.20% 131 74882 0.20% 132 76618 0.21% 133 79160 0.21% 134 81883 0.22% 135 82562 0.22% 136 85538 0.23% 137 87737 0.24% 138 89638 0.24% 139 92235 0.25% 140 93746 0.25% 141 95142 0.25% 142 97533 0.26% 143 98992 0.27% 144 101430 0.27% 145 103628 0.28% 146 103797 0.28% 147 105980 0.28% 148 108098 0.29% 149 109089 0.29% 150 112064 0.30% 151 33862801 90.75% 37316399 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=67.28 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.9 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.53 fanout-score-rank=17 prefix-density=0.43 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=342.87 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=32.1 sequence=GAAGAAGAAGAAA SRR12161459 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:31:13 Started mapping on | Feb 13 23:31:13 Finished on | Feb 13 23:35:12 Mapping speed, Million of reads per hour | 562.09 Number of input reads | 37316399 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 35575135 Uniquely mapped reads % | 95.33% Average mapped length | 296.81 Number of splices: Total | 37903916 Number of splices: Annotated (sjdb) | 37171551 Number of splices: GT/AG | 37294810 Number of splices: GC/AG | 484558 Number of splices: AT/AC | 30929 Number of splices: Non-canonical | 93619 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1001272 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 45229 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 739992 739992 739992 N_multimapping 1001272 1001272 1001272 N_noFeature 824907 35289335 955802 N_ambiguous 338153 1694 182301 UnstrandedReadsAssigned:34412075 PositiveStrandReadsAssigned:284106 NegativeStrandReadsAssigned:34437032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161459-trimmed-pair1.fastq SRR12161459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,316,399 reads, 34,373,655 reads pseudoaligned [quant] estimated average fragment length: 253.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR12161459.ke.tsv 34699 SRR12161459.se.tsv 87100 total ==> SRR12161459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.08 3365 55.7049 Potri.005G024800.1.v4.1 1035 782.082 643 24.0233 Potri.004G059700.1.v4.1 961 708.2 112 4.62099 Potri.007G009000.2.v4.1 1416 1163.08 0 0 Potri.003G141000.2.v4.1 2943 2690.08 1592.65 17.2992 Potri.016G087400.1.v4.1 270 80.6803 2455 889.115 Potri.015G069301.1.v4.1 564 320.842 0 0 Potri.010G195200.1.v4.1 1773 1520.08 377.81 7.2624 Potri.012G127500.1.v4.1 977 724.15 5540 223.54 ==> SRR12161459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 84 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 629 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1168 SRR12161459 completed mapping pipeline successfully