Starting /dee2/code/volunteer_pipeline.sh SRR12161460 current disk space = 3088651137024 free memory = 1394821020 SRR12161460 SRAfilesize cd5177a6670b1bf6523ab134a6ae6a5e SRR12161460.sra SRR12161460.sra file validated SRR12161460 is paired end SRR12161460 is conventional basespace SRR12161460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39175 37.0 37.0 37.0 37.0 37.0 2 36.329 37.0 37.0 37.0 37.0 37.0 3 36.4615 37.0 37.0 37.0 37.0 37.0 4 36.4915 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.56 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.444 37.0 37.0 37.0 37.0 37.0 9 36.513 37.0 37.0 37.0 37.0 37.0 10-14 36.5269 37.0 37.0 37.0 37.0 37.0 15-19 36.500699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4901 37.0 37.0 37.0 37.0 37.0 25-29 36.42209999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3955 37.0 37.0 37.0 37.0 37.0 35-39 36.3056 37.0 37.0 37.0 37.0 37.0 40-44 36.3037 37.0 37.0 37.0 37.0 37.0 45-49 36.3329 37.0 37.0 37.0 37.0 37.0 50-54 36.2519 37.0 37.0 37.0 37.0 37.0 55-59 36.281000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.230399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.12 37.0 37.0 37.0 37.0 37.0 70-74 36.079800000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.1452 37.0 37.0 37.0 37.0 37.0 80-84 36.1423 37.0 37.0 37.0 37.0 37.0 85-89 36.052299999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.1178 37.0 37.0 37.0 37.0 37.0 95-99 36.0581 37.0 37.0 37.0 37.0 37.0 100-104 35.953500000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9721 37.0 37.0 37.0 37.0 37.0 110-114 35.93769999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.9765 37.0 37.0 37.0 37.0 37.0 120-124 35.9396 37.0 37.0 37.0 37.0 37.0 125-129 35.837300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.783100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7324 37.0 37.0 37.0 37.0 37.0 140-144 35.7127 37.0 37.0 37.0 37.0 37.0 145-149 35.634800000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.43 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 10.0 27 14.0 28 23.0 29 22.0 30 31.0 31 30.0 32 72.0 33 75.0 34 141.0 35 358.0 36 2943.0 37 276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.71839799749687 12.215269086357948 7.784730913642053 45.28160200250313 2 18.675 12.65 37.8 30.875000000000004 3 16.0 15.25 28.975 39.775 4 21.625 22.125 24.875 31.374999999999996 5 22.325 29.625 25.5 22.55 6 20.349999999999998 33.425 24.725 21.5 7 15.299999999999999 27.250000000000004 40.6 16.85 8 17.1 27.425 32.025 23.45 9 18.15 23.9 35.225 22.725 10-14 19.675 30.014999999999997 28.23 22.08 15-19 18.77 28.749999999999996 28.865000000000002 23.615 20-24 19.54 28.810000000000002 28.225 23.425 25-29 19.265 29.065 28.075 23.595 30-34 19.405 28.345 28.4 23.849999999999998 35-39 19.765 28.74 27.91 23.585 40-44 19.3 28.765 28.325 23.61 45-49 19.814999999999998 28.044999999999998 28.23 23.91 50-54 19.97 28.749999999999996 27.845 23.435 55-59 19.400000000000002 28.425 27.99 24.185000000000002 60-64 19.295 28.27 28.34 24.095 65-69 19.845 28.744999999999997 27.79 23.62 70-74 19.955000000000002 28.95 28.000000000000004 23.095 75-79 19.64 28.77 27.800000000000004 23.79 80-84 19.900000000000002 28.470000000000002 27.834999999999997 23.794999999999998 85-89 20.599999999999998 28.994999999999997 27.334999999999997 23.07 90-94 19.975 28.794999999999998 27.515 23.715 95-99 20.495 28.134999999999998 27.83 23.54 100-104 19.36 28.565 28.465 23.61 105-109 20.285 28.33 27.54 23.845 110-114 20.674999999999997 28.04 27.845 23.44 115-119 20.555 28.455000000000002 27.685 23.305 120-124 20.61 28.315 27.48 23.595 125-129 20.305 28.27 27.93 23.494999999999997 130-134 20.544999999999998 28.610000000000003 27.755000000000003 23.09 135-139 19.935 28.09 27.865000000000002 24.11 140-144 20.724999999999998 28.555000000000003 27.115000000000002 23.605 145-149 20.785 28.605000000000004 26.85 23.76 150-151 20.375 28.487499999999997 27.6375 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 4.0 26 4.0 27 4.0 28 4.5 29 8.5 30 15.0 31 25.5 32 29.5 33 39.5 34 54.0 35 67.0 36 95.0 37 116.0 38 127.5 39 158.5 40 203.0 41 233.5 42 261.0 43 281.0 44 285.5 45 299.0 46 290.0 47 263.5 48 234.0 49 190.0 50 170.5 51 148.5 52 114.5 53 90.0 54 60.5 55 40.0 56 30.5 57 21.0 58 12.0 59 9.0 60 5.0 61 0.5 62 0.0 63 0.0 64 0.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 96.01458713206564 92.15 2 3.7770252669966133 7.249999999999999 3 0.20838760093774422 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0125 0.0 112-113 1.6375 0.0 0.0 0.025 0.0 114-115 1.95 0.0 0.0 0.025 0.0 116-117 2.2125000000000004 0.0 0.0 0.025 0.0 118-119 2.4000000000000004 0.0 0.0 0.025 0.0 120-121 2.75 0.0 0.0 0.025 0.0 122-123 2.9875 0.0 0.0 0.025 0.0 124-125 3.3625 0.0 0.0 0.025 0.0 126-127 3.625 0.0 0.0 0.025 0.0 128-129 4.125 0.0 0.0 0.025 0.0 130-131 4.5625 0.0 0.0 0.025 0.0 132-133 4.9875 0.0 0.0 0.025 0.0 134-135 5.5875 0.0 0.0 0.025 0.0 136-137 6.0625 0.0 0.0 0.025 0.0 138-139 6.637499999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTAT 10 0.006830828 145.0 8 CCCGCAC 10 0.006830828 145.0 1 TTCCATC 10 0.006830828 145.0 2 >>END_MODULE SRR12161460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 35.925 37.0 37.0 37.0 37.0 37.0 3 36.0385 37.0 37.0 37.0 37.0 37.0 4 36.023 37.0 37.0 37.0 37.0 37.0 5 36.1005 37.0 37.0 37.0 37.0 37.0 6 36.115 37.0 37.0 37.0 37.0 37.0 7 36.0965 37.0 37.0 37.0 37.0 37.0 8 36.1355 37.0 37.0 37.0 37.0 37.0 9 36.126 37.0 37.0 37.0 37.0 37.0 10-14 36.1558 37.0 37.0 37.0 37.0 37.0 15-19 36.091699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1527 37.0 37.0 37.0 37.0 37.0 25-29 36.0269 37.0 37.0 37.0 37.0 37.0 30-34 36.063 37.0 37.0 37.0 37.0 37.0 35-39 36.0657 37.0 37.0 37.0 37.0 37.0 40-44 35.9563 37.0 37.0 37.0 37.0 37.0 45-49 35.975699999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.942099999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9082 37.0 37.0 37.0 37.0 37.0 60-64 35.8481 37.0 37.0 37.0 37.0 37.0 65-69 35.8906 37.0 37.0 37.0 37.0 37.0 70-74 35.8174 37.0 37.0 37.0 37.0 37.0 75-79 35.8093 37.0 37.0 37.0 37.0 37.0 80-84 35.7668 37.0 37.0 37.0 37.0 37.0 85-89 35.771300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7162 37.0 37.0 37.0 37.0 37.0 95-99 35.677299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.657 37.0 37.0 37.0 37.0 37.0 105-109 35.6225 37.0 37.0 37.0 37.0 37.0 110-114 35.5303 37.0 37.0 37.0 37.0 37.0 115-119 35.5107 37.0 37.0 37.0 37.0 37.0 120-124 35.575300000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.503 37.0 37.0 37.0 37.0 37.0 130-134 35.4409 37.0 37.0 37.0 37.0 37.0 135-139 35.3523 37.0 37.0 37.0 34.6 37.0 140-144 35.2308 37.0 37.0 37.0 29.8 37.0 145-149 35.2132 37.0 37.0 37.0 27.4 37.0 150-151 34.89575000000001 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 2.0 16 0.0 17 1.0 18 2.0 19 2.0 20 1.0 21 1.0 22 3.0 23 9.0 24 14.0 25 10.0 26 17.0 27 10.0 28 13.0 29 22.0 30 36.0 31 39.0 32 78.0 33 115.0 34 212.0 35 562.0 36 2624.0 37 221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.425000000000004 22.575 11.275 28.725 2 27.200000000000003 26.85 30.475 15.475 3 19.575 29.375 32.375 18.675 4 24.075 33.275 24.525 18.125 5 25.074999999999996 37.075 22.0 15.85 6 19.8 38.725 22.775000000000002 18.7 7 19.525000000000002 23.175 38.224999999999994 19.075 8 20.875 25.650000000000002 29.799999999999997 23.674999999999997 9 22.0 25.1 31.15 21.75 10-14 23.255 29.695 26.314999999999998 20.735 15-19 23.150000000000002 28.660000000000004 27.334999999999997 20.855 20-24 22.925 29.25 27.48 20.345 25-29 23.145 28.244999999999997 27.665 20.945 30-34 23.365 28.435 27.765 20.435 35-39 22.755 28.549999999999997 27.93 20.765 40-44 23.305 28.22 27.915 20.560000000000002 45-49 23.115 28.32 27.589999999999996 20.974999999999998 50-54 22.805 28.455000000000002 27.715 21.025 55-59 22.865 28.355000000000004 28.155 20.625 60-64 23.080000000000002 28.349999999999998 27.79 20.78 65-69 23.380000000000003 28.585 27.725 20.31 70-74 23.810000000000002 28.18 28.125 19.885 75-79 23.055 28.025 28.549999999999997 20.369999999999997 80-84 23.72 27.950000000000003 27.755000000000003 20.575 85-89 23.835 28.34 27.689999999999998 20.135 90-94 23.974999999999998 28.035 27.79 20.200000000000003 95-99 23.9 28.48 27.495000000000005 20.125 100-104 23.325000000000003 28.365000000000002 27.900000000000002 20.41 105-109 23.62 28.82 27.68 19.88 110-114 24.29 28.999999999999996 26.724999999999998 19.985 115-119 24.065 28.34 27.750000000000004 19.845 120-124 24.27 28.74 27.33 19.66 125-129 24.779999999999998 28.79 27.18 19.25 130-134 24.94 28.439999999999998 26.815 19.805 135-139 25.27 28.294999999999998 27.029999999999998 19.405 140-144 24.82 28.610000000000003 27.21 19.36 145-149 25.785000000000004 27.965 26.85 19.400000000000002 150-151 24.9875 28.512500000000003 26.937499999999996 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 1.0 27 1.0 28 2.5 29 7.5 30 11.0 31 17.5 32 23.0 33 29.0 34 41.0 35 54.5 36 79.5 37 121.0 38 146.5 39 183.0 40 226.5 41 260.5 42 276.0 43 283.0 44 293.0 45 278.0 46 282.0 47 262.0 48 231.0 49 204.5 50 157.5 51 136.5 52 115.5 53 83.0 54 58.5 55 42.0 56 29.5 57 15.0 58 9.0 59 8.5 60 5.5 61 4.0 62 2.5 63 1.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82027168234065 91.7 2 3.8923719958202714 7.449999999999999 3 0.2612330198537095 0.75 4 0.026123301985370953 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.550000000000001 0.0 0.0 0.0 0.0 132-133 5.0125 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737826 spots for SRR12161460.sra Written 1737826 spots for SRR12161460.sra Read 1737833 spots for SRR12161460.sra Written 1737833 spots for SRR12161460.sra SRR ids: ['SRR12161460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oa7hnz0k SRR12161460.sra spots: 34756527 blocks: [[1, 1737826], [1737827, 3475652], [3475653, 5213478], [5213479, 6951304], [6951305, 8689130], [8689131, 10426956], [10426957, 12164782], [12164783, 13902608], [13902609, 15640434], [15640435, 17378260], [17378261, 19116086], [19116087, 20853912], [20853913, 22591738], [22591739, 24329564], [24329565, 26067390], [26067391, 27805216], [27805217, 29543042], [29543043, 31280868], [31280869, 33018694], [33018695, 34756527]] SRR12161460 file size 11790088 SRR12161460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161460 SRR12161460_1.fastq SRR12161460_2.fastq Input file: SRR12161460_1.fastq Paired file: SRR12161460_2.fastq trimmed: SRR12161460-trimmed-pair1.fastq, SRR12161460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:11:22 2025 >> started Thu Feb 13 17:12:02 2025 >> done (40.142s) 34756527 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 9567 ( 0.03%) empty read pairs filtered out after trimming by size control 34746915 (99.97%) read pairs available; of these: 3562764 (10.25%) trimmed read pairs available after processing 31184151 (89.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 10 0.00% 21 3 0.00% 22 12 0.00% 23 5 0.00% 24 15 0.00% 25 17 0.00% 26 14 0.00% 27 12 0.00% 28 20 0.00% 29 20 0.00% 30 37 0.00% 31 25 0.00% 32 29 0.00% 33 27 0.00% 34 38 0.00% 35 34 0.00% 36 40 0.00% 37 32 0.00% 38 52 0.00% 39 47 0.00% 40 48 0.00% 41 56 0.00% 42 53 0.00% 43 68 0.00% 44 57 0.00% 45 69 0.00% 46 92 0.00% 47 79 0.00% 48 91 0.00% 49 102 0.00% 50 92 0.00% 51 120 0.00% 52 142 0.00% 53 142 0.00% 54 144 0.00% 55 143 0.00% 56 172 0.00% 57 166 0.00% 58 229 0.00% 59 280 0.00% 60 355 0.00% 61 327 0.00% 62 427 0.00% 63 428 0.00% 64 499 0.00% 65 510 0.00% 66 540 0.00% 67 645 0.00% 68 681 0.00% 69 836 0.00% 70 976 0.00% 71 1135 0.00% 72 1306 0.00% 73 1461 0.00% 74 1622 0.00% 75 1931 0.01% 76 2145 0.01% 77 2227 0.01% 78 2477 0.01% 79 2803 0.01% 80 3271 0.01% 81 3615 0.01% 82 4206 0.01% 83 4765 0.01% 84 5321 0.02% 85 5973 0.02% 86 6705 0.02% 87 7295 0.02% 88 8005 0.02% 89 8487 0.02% 90 9378 0.03% 91 10438 0.03% 92 11431 0.03% 93 12894 0.04% 94 14094 0.04% 95 15476 0.04% 96 16522 0.05% 97 17902 0.05% 98 19182 0.06% 99 20212 0.06% 100 21466 0.06% 101 22540 0.06% 102 24073 0.07% 103 25916 0.07% 104 27938 0.08% 105 29525 0.08% 106 31987 0.09% 107 33397 0.10% 108 34766 0.10% 109 36254 0.10% 110 37203 0.11% 111 39127 0.11% 112 40616 0.12% 113 42133 0.12% 114 44676 0.13% 115 47178 0.14% 116 49385 0.14% 117 51236 0.15% 118 53636 0.15% 119 54480 0.16% 120 56068 0.16% 121 57804 0.17% 122 58597 0.17% 123 61126 0.18% 124 63087 0.18% 125 65395 0.19% 126 67992 0.20% 127 70125 0.20% 128 71905 0.21% 129 73422 0.21% 130 75358 0.22% 131 76742 0.22% 132 77909 0.22% 133 80370 0.23% 134 80936 0.23% 135 82839 0.24% 136 85842 0.25% 137 87226 0.25% 138 90010 0.26% 139 92546 0.27% 140 93847 0.27% 141 94628 0.27% 142 96110 0.28% 143 97229 0.28% 144 99155 0.29% 145 101268 0.29% 146 101879 0.29% 147 103982 0.30% 148 104959 0.30% 149 106706 0.31% 150 108828 0.31% 151 31184151 89.75% 34746915 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=395.80 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=35.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=22 prefix-density=0.45 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=321.91 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=31.5 sequence=GAAGAAGAAGAAA SRR12161460 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:12:50 Started mapping on | Feb 13 17:12:50 Finished on | Feb 13 17:16:37 Mapping speed, Million of reads per hour | 551.05 Number of input reads | 34746915 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 33131500 Uniquely mapped reads % | 95.35% Average mapped length | 296.12 Number of splices: Total | 35587401 Number of splices: Annotated (sjdb) | 34849293 Number of splices: GT/AG | 35004912 Number of splices: GC/AG | 464878 Number of splices: AT/AC | 28766 Number of splices: Non-canonical | 88845 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 929454 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 39482 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685961 685961 685961 N_multimapping 929454 929454 929454 N_noFeature 867073 32878560 970787 N_ambiguous 324326 1584 174396 UnstrandedReadsAssigned:31940101 PositiveStrandReadsAssigned:251356 NegativeStrandReadsAssigned:31986317 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161460-trimmed-pair1.fastq SRR12161460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,746,915 reads, 31,970,117 reads pseudoaligned [quant] estimated average fragment length: 253.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR12161460.ke.tsv 34699 SRR12161460.se.tsv 87100 total ==> SRR12161460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.16 3762 66.1032 Potri.005G024800.1.v4.1 1035 782.158 1082 42.9062 Potri.004G059700.1.v4.1 961 708.299 61 2.67116 Potri.007G009000.2.v4.1 1416 1163.16 0 0 Potri.003G141000.2.v4.1 2943 2690.16 1528.21 17.6195 Potri.016G087400.1.v4.1 270 84.01 2286 843.98 Potri.015G069301.1.v4.1 564 322.234 0 0 Potri.010G195200.1.v4.1 1773 1520.16 542 11.0585 Potri.012G127500.1.v4.1 977 724.244 5397 231.129 ==> SRR12161460.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 604 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 57 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 727 SRR12161460 completed mapping pipeline successfully