Starting /dee2/code/volunteer_pipeline.sh SRR12161461 current disk space = 3088669704192 free memory = 1383562952 SRR12161461 SRAfilesize 5157dc759e4673de55108eaae0fd3574 SRR12161461.sra SRR12161461.sra file validated SRR12161461 is paired end SRR12161461 is conventional basespace SRR12161461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.40675 37.0 37.0 37.0 37.0 37.0 2 36.424 37.0 37.0 37.0 37.0 37.0 3 36.4555 37.0 37.0 37.0 37.0 37.0 4 36.52 37.0 37.0 37.0 37.0 37.0 5 36.597 37.0 37.0 37.0 37.0 37.0 6 36.654 37.0 37.0 37.0 37.0 37.0 7 36.447 37.0 37.0 37.0 37.0 37.0 8 36.378 37.0 37.0 37.0 37.0 37.0 9 36.481 37.0 37.0 37.0 37.0 37.0 10-14 36.522800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.458800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4739 37.0 37.0 37.0 37.0 37.0 25-29 36.4091 37.0 37.0 37.0 37.0 37.0 30-34 36.3626 37.0 37.0 37.0 37.0 37.0 35-39 36.3283 37.0 37.0 37.0 37.0 37.0 40-44 36.3687 37.0 37.0 37.0 37.0 37.0 45-49 36.3889 37.0 37.0 37.0 37.0 37.0 50-54 36.3219 37.0 37.0 37.0 37.0 37.0 55-59 36.2562 37.0 37.0 37.0 37.0 37.0 60-64 36.2901 37.0 37.0 37.0 37.0 37.0 65-69 36.2354 37.0 37.0 37.0 37.0 37.0 70-74 36.2124 37.0 37.0 37.0 37.0 37.0 75-79 36.13549999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0945 37.0 37.0 37.0 37.0 37.0 85-89 36.0827 37.0 37.0 37.0 37.0 37.0 90-94 36.1054 37.0 37.0 37.0 37.0 37.0 95-99 36.0994 37.0 37.0 37.0 37.0 37.0 100-104 36.0029 37.0 37.0 37.0 37.0 37.0 105-109 36.00790000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9679 37.0 37.0 37.0 37.0 37.0 115-119 35.9944 37.0 37.0 37.0 37.0 37.0 120-124 35.9257 37.0 37.0 37.0 37.0 37.0 125-129 35.896 37.0 37.0 37.0 37.0 37.0 130-134 35.83239999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.680099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.7104 37.0 37.0 37.0 37.0 37.0 145-149 35.7413 37.0 37.0 37.0 37.0 37.0 150-151 35.4785 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 3.0 26 5.0 27 7.0 28 19.0 29 17.0 30 22.0 31 62.0 32 69.0 33 93.0 34 133.0 35 324.0 36 2927.0 37 316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.216879539193584 12.772351615326821 8.289506636614075 40.72126220886552 2 18.925 13.575000000000001 35.9 31.6 3 16.475 16.725 28.349999999999998 38.45 4 20.075000000000003 24.525 24.125 31.275 5 22.075 31.025000000000002 24.875 22.025 6 21.25 33.324999999999996 24.925 20.5 7 15.7 28.425 39.6 16.275000000000002 8 16.775000000000002 27.025 31.85 24.349999999999998 9 16.0 24.825 35.9 23.275000000000002 10-14 19.0 30.220000000000002 27.985 22.795 15-19 19.56 28.365000000000002 28.294999999999998 23.78 20-24 19.485 28.720000000000002 28.499999999999996 23.294999999999998 25-29 19.275000000000002 29.735 27.92 23.07 30-34 19.35 28.910000000000004 28.395 23.345 35-39 19.545 28.95 27.73 23.775 40-44 19.38 29.21 27.845 23.565 45-49 19.43 28.77 27.98 23.82 50-54 19.88 28.975 27.884999999999998 23.26 55-59 20.235 28.299999999999997 28.384999999999998 23.080000000000002 60-64 19.1 29.409999999999997 27.985 23.505000000000003 65-69 19.28 29.065 28.065 23.59 70-74 19.155 29.09 27.860000000000003 23.895 75-79 20.330000000000002 28.16 27.860000000000003 23.65 80-84 19.98 28.83 27.79 23.400000000000002 85-89 19.81 28.405 28.410000000000004 23.375 90-94 19.189999999999998 29.085 27.845 23.880000000000003 95-99 19.915 28.410000000000004 27.965 23.71 100-104 20.064999999999998 29.115000000000002 27.245 23.575 105-109 19.715 28.99 28.125 23.169999999999998 110-114 20.095 28.694999999999997 28.22 22.99 115-119 20.39 28.939999999999998 27.779999999999998 22.89 120-124 20.07 28.985 27.905 23.04 125-129 20.07 29.03 27.134999999999998 23.765 130-134 20.68 29.2 26.77 23.35 135-139 20.32 29.04 27.37 23.27 140-144 20.36 28.88 27.045 23.715 145-149 20.380000000000003 29.099999999999998 26.889999999999997 23.630000000000003 150-151 19.875 28.6875 27.1625 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 4.0 27 5.5 28 8.0 29 14.0 30 12.5 31 15.0 32 33.5 33 44.0 34 60.5 35 76.0 36 98.5 37 122.0 38 153.0 39 171.0 40 173.0 41 222.0 42 262.5 43 281.5 44 305.0 45 316.5 46 293.5 47 254.5 48 230.0 49 207.0 50 167.5 51 125.0 52 99.0 53 77.5 54 56.0 55 37.0 56 25.0 57 18.0 58 9.5 59 5.5 60 2.0 61 2.0 62 2.0 63 1.0 64 0.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15825809877855 88.64999999999999 2 5.469994689325544 10.299999999999999 3 0.37174721189591076 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGTGA 10 0.006830828 145.0 2 CCCTAGT 10 0.006830828 145.0 1 >>END_MODULE SRR12161461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.225 37.0 37.0 37.0 37.0 37.0 2 36.1275 37.0 37.0 37.0 37.0 37.0 3 36.206 37.0 37.0 37.0 37.0 37.0 4 36.186 37.0 37.0 37.0 37.0 37.0 5 36.2875 37.0 37.0 37.0 37.0 37.0 6 36.1715 37.0 37.0 37.0 37.0 37.0 7 36.246 37.0 37.0 37.0 37.0 37.0 8 36.2325 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-14 36.2428 37.0 37.0 37.0 37.0 37.0 15-19 36.2805 37.0 37.0 37.0 37.0 37.0 20-24 36.2173 37.0 37.0 37.0 37.0 37.0 25-29 36.165699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.144000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.0983 37.0 37.0 37.0 37.0 37.0 40-44 36.128699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0712 37.0 37.0 37.0 37.0 37.0 50-54 36.0284 37.0 37.0 37.0 37.0 37.0 55-59 36.0155 37.0 37.0 37.0 37.0 37.0 60-64 35.93 37.0 37.0 37.0 37.0 37.0 65-69 35.9323 37.0 37.0 37.0 37.0 37.0 70-74 35.9249 37.0 37.0 37.0 37.0 37.0 75-79 35.89149999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.848 37.0 37.0 37.0 37.0 37.0 85-89 35.8471 37.0 37.0 37.0 37.0 37.0 90-94 35.7808 37.0 37.0 37.0 37.0 37.0 95-99 35.756899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.764300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.708800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6188 37.0 37.0 37.0 37.0 37.0 115-119 35.6225 37.0 37.0 37.0 37.0 37.0 120-124 35.5844 37.0 37.0 37.0 37.0 37.0 125-129 35.574200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.4844 37.0 37.0 37.0 37.0 37.0 135-139 35.406 37.0 37.0 37.0 34.6 37.0 140-144 35.330400000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.322500000000005 37.0 37.0 37.0 37.0 37.0 150-151 34.995000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 1.0 16 3.0 17 1.0 18 1.0 19 5.0 20 1.0 21 1.0 22 5.0 23 5.0 24 8.0 25 6.0 26 9.0 27 8.0 28 17.0 29 13.0 30 30.0 31 45.0 32 65.0 33 109.0 34 191.0 35 555.0 36 2678.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 23.275000000000002 11.575000000000001 28.775000000000002 2 26.650000000000002 26.674999999999997 31.574999999999996 15.1 3 21.675 28.15 32.15 18.025 4 22.85 35.15 23.474999999999998 18.525 5 23.7 36.325 23.875 16.1 6 20.424999999999997 39.7 23.0 16.875 7 19.225 22.425 39.275 19.075 8 22.0 25.4 28.425 24.175 9 21.9 24.75 30.7 22.650000000000002 10-14 22.35 29.054999999999996 27.525 21.07 15-19 22.585 29.115000000000002 27.725 20.575 20-24 22.275 28.63 28.46 20.635 25-29 22.655 28.625 27.99 20.73 30-34 22.29 28.625 28.645 20.44 35-39 23.119999999999997 29.154999999999998 27.435 20.29 40-44 22.67 28.694999999999997 28.000000000000004 20.635 45-49 22.39 28.610000000000003 28.08 20.919999999999998 50-54 22.98 28.675 28.335 20.01 55-59 23.69 28.555000000000003 27.665 20.09 60-64 23.044999999999998 28.24 28.84 19.875 65-69 23.62 28.005000000000003 28.175 20.200000000000003 70-74 23.119999999999997 28.005000000000003 28.465 20.41 75-79 23.655 28.48 27.700000000000003 20.165 80-84 23.59 28.694999999999997 27.87 19.845 85-89 23.68 28.73 28.165000000000003 19.425 90-94 23.044999999999998 28.455000000000002 28.449999999999996 20.05 95-99 23.89 28.425 28.155 19.53 100-104 23.25 28.96 28.189999999999998 19.6 105-109 23.630000000000003 28.73 27.965 19.675 110-114 23.985 29.13 27.49 19.395 115-119 23.97 28.265 27.834999999999997 19.93 120-124 24.195 28.994999999999997 27.865000000000002 18.945 125-129 24.925 29.015 27.495000000000005 18.565 130-134 24.515 29.015 26.979999999999997 19.49 135-139 24.52 28.694999999999997 27.42 19.365 140-144 25.785000000000004 28.015 27.29 18.91 145-149 25.52 28.694999999999997 27.345000000000002 18.44 150-151 25.837500000000002 27.6125 27.962500000000002 18.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.5 18 1.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.0 24 3.0 25 5.0 26 4.5 27 6.0 28 8.0 29 8.0 30 13.0 31 23.5 32 30.5 33 33.0 34 50.5 35 76.5 36 89.0 37 128.5 38 161.0 39 194.0 40 230.5 41 250.5 42 275.0 43 284.5 44 289.0 45 297.5 46 280.5 47 251.0 48 233.0 49 187.5 50 137.5 51 113.5 52 96.0 53 64.5 54 44.0 55 36.5 56 25.0 57 15.5 58 9.0 59 6.0 60 6.0 61 4.5 62 2.5 63 0.5 64 0.0 65 1.0 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.34713375796179 88.875 2 5.17515923566879 9.75 3 0.45116772823779194 1.275 4 0.02653927813163482 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.3625 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.425000000000001 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTAA 10 0.006830828 145.0 4 TCTCTTA 10 0.006830828 145.0 3 >>END_MODULE Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra Read 1644499 spots for SRR12161461.sra Written 1644499 spots for SRR12161461.sra Read 1644487 spots for SRR12161461.sra Written 1644487 spots for SRR12161461.sra SRR ids: ['SRR12161461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_huwk7bf3 SRR12161461.sra spots: 32889752 blocks: [[1, 1644487], [1644488, 3288974], [3288975, 4933461], [4933462, 6577948], [6577949, 8222435], [8222436, 9866922], [9866923, 11511409], [11511410, 13155896], [13155897, 14800383], [14800384, 16444870], [16444871, 18089357], [18089358, 19733844], [19733845, 21378331], [21378332, 23022818], [23022819, 24667305], [24667306, 26311792], [26311793, 27956279], [27956280, 29600766], [29600767, 31245253], [31245254, 32889752]] SRR12161461 file size 11155676 SRR12161461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161461 SRR12161461_1.fastq SRR12161461_2.fastq Input file: SRR12161461_1.fastq Paired file: SRR12161461_2.fastq trimmed: SRR12161461-trimmed-pair1.fastq, SRR12161461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:17:32 2025 >> started Thu Feb 13 17:18:10 2025 >> done (37.366s) 32889752 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 8934 ( 0.03%) empty read pairs filtered out after trimming by size control 32880756 (99.97%) read pairs available; of these: 3315876 (10.08%) trimmed read pairs available after processing 29564880 (89.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 8 0.00% 21 8 0.00% 22 4 0.00% 23 12 0.00% 24 11 0.00% 25 14 0.00% 26 22 0.00% 27 14 0.00% 28 24 0.00% 29 20 0.00% 30 31 0.00% 31 28 0.00% 32 35 0.00% 33 31 0.00% 34 35 0.00% 35 40 0.00% 36 37 0.00% 37 47 0.00% 38 57 0.00% 39 56 0.00% 40 58 0.00% 41 65 0.00% 42 65 0.00% 43 62 0.00% 44 62 0.00% 45 70 0.00% 46 71 0.00% 47 76 0.00% 48 85 0.00% 49 99 0.00% 50 124 0.00% 51 141 0.00% 52 135 0.00% 53 138 0.00% 54 165 0.00% 55 169 0.00% 56 180 0.00% 57 199 0.00% 58 230 0.00% 59 279 0.00% 60 312 0.00% 61 358 0.00% 62 388 0.00% 63 419 0.00% 64 505 0.00% 65 502 0.00% 66 524 0.00% 67 629 0.00% 68 650 0.00% 69 798 0.00% 70 894 0.00% 71 1102 0.00% 72 1217 0.00% 73 1410 0.00% 74 1575 0.00% 75 1708 0.01% 76 1918 0.01% 77 2057 0.01% 78 2331 0.01% 79 2645 0.01% 80 3000 0.01% 81 3372 0.01% 82 3755 0.01% 83 4449 0.01% 84 4925 0.01% 85 5439 0.02% 86 6101 0.02% 87 6549 0.02% 88 7034 0.02% 89 7657 0.02% 90 8517 0.03% 91 9568 0.03% 92 10591 0.03% 93 11634 0.04% 94 13061 0.04% 95 13965 0.04% 96 15274 0.05% 97 16401 0.05% 98 17361 0.05% 99 18463 0.06% 100 19714 0.06% 101 20872 0.06% 102 22825 0.07% 103 24346 0.07% 104 26344 0.08% 105 27976 0.09% 106 29369 0.09% 107 30591 0.09% 108 31994 0.10% 109 33642 0.10% 110 34488 0.10% 111 36472 0.11% 112 38632 0.12% 113 40271 0.12% 114 42898 0.13% 115 44603 0.14% 116 45911 0.14% 117 48234 0.15% 118 49372 0.15% 119 50731 0.15% 120 52177 0.16% 121 54321 0.17% 122 55671 0.17% 123 57773 0.18% 124 60014 0.18% 125 61549 0.19% 126 63676 0.19% 127 65951 0.20% 128 66884 0.20% 129 67728 0.21% 130 69674 0.21% 131 71124 0.22% 132 72618 0.22% 133 74978 0.23% 134 76098 0.23% 135 78718 0.24% 136 80632 0.25% 137 81981 0.25% 138 83682 0.25% 139 85073 0.26% 140 85639 0.26% 141 86821 0.26% 142 88715 0.27% 143 89740 0.27% 144 91978 0.28% 145 94433 0.29% 146 94599 0.29% 147 96335 0.29% 148 97935 0.30% 149 97721 0.30% 150 100275 0.30% 151 29564880 89.92% 32880756 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=21 prefix-density=0.47 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=110.34 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.3 sequence=CCATCTTCAAGCTGCTTCCCAGCAAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=357.27 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=33.6 sequence=AAGAAGAAGAAA SRR12161461 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:18:52 Started mapping on | Feb 13 17:18:53 Finished on | Feb 13 17:22:40 Mapping speed, Million of reads per hour | 521.46 Number of input reads | 32880756 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31122276 Uniquely mapped reads % | 94.65% Average mapped length | 296.18 Number of splices: Total | 32297663 Number of splices: Annotated (sjdb) | 31605749 Number of splices: GT/AG | 31760698 Number of splices: GC/AG | 425621 Number of splices: AT/AC | 24489 Number of splices: Non-canonical | 86855 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 901684 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 33886 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 856796 856796 856796 N_multimapping 901684 901684 901684 N_noFeature 920095 30866417 1033161 N_ambiguous 316078 1487 172659 UnstrandedReadsAssigned:29886103 PositiveStrandReadsAssigned:254372 NegativeStrandReadsAssigned:29916456 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161461-trimmed-pair1.fastq SRR12161461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,880,756 reads, 29,882,041 reads pseudoaligned [quant] estimated average fragment length: 255.939 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,337 rounds 52401 SRR12161461.ke.tsv 34699 SRR12161461.se.tsv 87100 total ==> SRR12161461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.06 3390 66.8721 Potri.005G024800.1.v4.1 1035 780.061 684 30.4958 Potri.004G059700.1.v4.1 961 706.18 65 3.20118 Potri.007G009000.2.v4.1 1416 1161.06 0 0 Potri.003G141000.2.v4.1 2943 2688.06 1402.62 18.1473 Potri.016G087400.1.v4.1 270 83.3278 2167.6 904.694 Potri.015G069301.1.v4.1 564 319.516 0 0 Potri.010G195200.1.v4.1 1773 1518.06 567.883 13.0102 Potri.012G127500.1.v4.1 977 722.116 4210 202.763 ==> SRR12161461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 630 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 980 SRR12161461 completed mapping pipeline successfully