Starting /dee2/code/volunteer_pipeline.sh SRR12161462 current disk space = 3088958636032 free memory = 1578831664 SRR12161462 SRAfilesize b0e2316aaa688257a2bb0b62d7a0014b SRR12161462.sra SRR12161462.sra file validated SRR12161462 is paired end SRR12161462 is conventional basespace SRR12161462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.487 37.0 37.0 37.0 37.0 37.0 2 36.4005 37.0 37.0 37.0 37.0 37.0 3 36.511 37.0 37.0 37.0 37.0 37.0 4 36.4975 37.0 37.0 37.0 37.0 37.0 5 36.5685 37.0 37.0 37.0 37.0 37.0 6 36.567 37.0 37.0 37.0 37.0 37.0 7 36.5475 37.0 37.0 37.0 37.0 37.0 8 36.4615 37.0 37.0 37.0 37.0 37.0 9 36.4685 37.0 37.0 37.0 37.0 37.0 10-14 36.5384 37.0 37.0 37.0 37.0 37.0 15-19 36.476299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4816 37.0 37.0 37.0 37.0 37.0 25-29 36.41629999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.373200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.33969999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.2538 37.0 37.0 37.0 37.0 37.0 45-49 36.313900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2821 37.0 37.0 37.0 37.0 37.0 55-59 36.2666 37.0 37.0 37.0 37.0 37.0 60-64 36.212599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.16760000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1574 37.0 37.0 37.0 37.0 37.0 75-79 36.1137 37.0 37.0 37.0 37.0 37.0 80-84 36.1323 37.0 37.0 37.0 37.0 37.0 85-89 36.059400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0831 37.0 37.0 37.0 37.0 37.0 95-99 36.117000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0226 37.0 37.0 37.0 37.0 37.0 105-109 36.022800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.89399999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.952 37.0 37.0 37.0 37.0 37.0 120-124 35.9173 37.0 37.0 37.0 37.0 37.0 125-129 35.9111 37.0 37.0 37.0 37.0 37.0 130-134 35.871500000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8119 37.0 37.0 37.0 37.0 37.0 140-144 35.785799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7407 37.0 37.0 37.0 37.0 37.0 150-151 35.4305 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.0 25 1.0 26 4.0 27 8.0 28 10.0 29 37.0 30 29.0 31 46.0 32 58.0 33 83.0 34 142.0 35 330.0 36 2889.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.357715430861724 12.625250501002002 6.187374749498998 39.829659318637276 2 19.675 13.05 34.975 32.300000000000004 3 17.275 15.625 28.625 38.475 4 20.674999999999997 23.9 25.95 29.475 5 21.75 31.275 25.05 21.925 6 20.225 34.449999999999996 24.575 20.75 7 15.75 26.875 39.875 17.5 8 17.125 27.1 32.2 23.575 9 17.275 24.925 35.575 22.225 10-14 19.985 30.2 27.689999999999998 22.125 15-19 19.830000000000002 28.63 28.205000000000002 23.335 20-24 19.305 29.470000000000002 27.779999999999998 23.445 25-29 19.705000000000002 28.54 28.249999999999996 23.505000000000003 30-34 19.62 28.694999999999997 28.244999999999997 23.44 35-39 19.84 28.625 28.15 23.385 40-44 19.33 28.299999999999997 28.439999999999998 23.93 45-49 19.755 28.494999999999997 27.900000000000002 23.849999999999998 50-54 19.845 29.01 27.894999999999996 23.25 55-59 19.63 28.74 28.275 23.355 60-64 19.77 28.32 28.560000000000002 23.35 65-69 20.18 28.185 28.035 23.599999999999998 70-74 19.97 28.465 28.01 23.555 75-79 20.215 28.57 28.084999999999997 23.13 80-84 20.345 28.035 27.800000000000004 23.82 85-89 20.3 28.48 28.485 22.735 90-94 20.0 28.875 27.644999999999996 23.48 95-99 20.349999999999998 28.754999999999995 27.565 23.330000000000002 100-104 20.365 28.34 28.035 23.26 105-109 20.685000000000002 28.305000000000003 27.725 23.285 110-114 20.215 28.87 27.950000000000003 22.965 115-119 20.080000000000002 28.98 27.644999999999996 23.294999999999998 120-124 20.995 28.23 27.560000000000002 23.215 125-129 20.97 28.585 27.105 23.34 130-134 20.52 28.29 27.534999999999997 23.655 135-139 20.685000000000002 28.249999999999996 27.195000000000004 23.87 140-144 20.865000000000002 28.384999999999998 27.05 23.7 145-149 21.325 28.310000000000002 26.889999999999997 23.474999999999998 150-151 21.725 27.6875 26.5375 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 2.5 23 3.0 24 5.0 25 7.0 26 6.0 27 6.5 28 7.0 29 9.5 30 12.0 31 20.5 32 36.5 33 42.5 34 46.0 35 63.5 36 78.5 37 96.0 38 129.5 39 158.5 40 187.0 41 224.0 42 269.0 43 301.0 44 312.0 45 301.0 46 291.5 47 266.0 48 218.0 49 193.5 50 171.5 51 139.0 52 116.0 53 85.5 54 55.0 55 37.0 56 27.0 57 27.5 58 18.5 59 7.5 60 3.5 61 4.5 62 2.5 63 1.0 64 0.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58288770053476 87.5 2 5.935828877005347 11.1 3 0.42780748663101603 1.2 4 0.053475935828877004 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.2875 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.225 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 45 6.5511256E-4 19.333332 35-39 >>END_MODULE SRR12161462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4145 37.0 37.0 37.0 37.0 37.0 2 36.0865 37.0 37.0 37.0 37.0 37.0 3 36.227 37.0 37.0 37.0 37.0 37.0 4 36.3045 37.0 37.0 37.0 37.0 37.0 5 36.2555 37.0 37.0 37.0 37.0 37.0 6 36.254 37.0 37.0 37.0 37.0 37.0 7 36.312 37.0 37.0 37.0 37.0 37.0 8 36.242 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.2992 37.0 37.0 37.0 37.0 37.0 15-19 36.2401 37.0 37.0 37.0 37.0 37.0 20-24 36.185 37.0 37.0 37.0 37.0 37.0 25-29 36.1081 37.0 37.0 37.0 37.0 37.0 30-34 36.1194 37.0 37.0 37.0 37.0 37.0 35-39 36.162099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0555 37.0 37.0 37.0 37.0 37.0 45-49 36.0439 37.0 37.0 37.0 37.0 37.0 50-54 35.9846 37.0 37.0 37.0 37.0 37.0 55-59 36.0092 37.0 37.0 37.0 37.0 37.0 60-64 35.9824 37.0 37.0 37.0 37.0 37.0 65-69 35.9517 37.0 37.0 37.0 37.0 37.0 70-74 35.9338 37.0 37.0 37.0 37.0 37.0 75-79 35.9 37.0 37.0 37.0 37.0 37.0 80-84 35.8347 37.0 37.0 37.0 37.0 37.0 85-89 35.8451 37.0 37.0 37.0 37.0 37.0 90-94 35.8024 37.0 37.0 37.0 37.0 37.0 95-99 35.807900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7992 37.0 37.0 37.0 37.0 37.0 105-109 35.687400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.656400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.726299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6317 37.0 37.0 37.0 37.0 37.0 125-129 35.5706 37.0 37.0 37.0 37.0 37.0 130-134 35.5586 37.0 37.0 37.0 37.0 37.0 135-139 35.4653 37.0 37.0 37.0 37.0 37.0 140-144 35.28620000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.26180000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.944500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 2.0 16 4.0 17 0.0 18 3.0 19 1.0 20 3.0 21 4.0 22 5.0 23 5.0 24 8.0 25 10.0 26 10.0 27 14.0 28 17.0 29 17.0 30 23.0 31 36.0 32 58.0 33 97.0 34 183.0 35 521.0 36 2732.0 37 241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 25.474999999999998 9.975000000000001 24.775 2 27.175 28.375 28.999999999999996 15.45 3 21.5 27.675 31.324999999999996 19.5 4 23.575 34.2 22.55 19.675 5 25.025 36.85 22.0 16.125 6 21.5 39.35 21.8 17.349999999999998 7 20.325 24.675 37.0 18.0 8 21.475 25.124999999999996 28.975 24.425 9 22.525000000000002 24.025 30.15 23.3 10-14 23.49 29.360000000000003 26.724999999999998 20.424999999999997 15-19 23.580000000000002 28.105000000000004 27.495000000000005 20.82 20-24 22.965 29.23 27.005000000000003 20.8 25-29 23.165 29.099999999999998 27.27 20.465 30-34 22.915 28.54 27.805000000000003 20.74 35-39 23.275000000000002 28.285 27.345000000000002 21.095 40-44 23.47 28.605000000000004 27.279999999999998 20.645 45-49 23.380000000000003 28.04 28.23 20.349999999999998 50-54 23.025000000000002 28.360000000000003 27.83 20.785 55-59 23.41 28.42 28.000000000000004 20.169999999999998 60-64 23.005 28.749999999999996 27.515 20.73 65-69 23.5 28.615000000000002 27.465 20.419999999999998 70-74 23.43 29.015 27.675 19.88 75-79 24.08 28.000000000000004 27.384999999999998 20.535 80-84 23.294999999999998 28.994999999999997 27.389999999999997 20.32 85-89 23.69 28.794999999999998 27.750000000000004 19.765 90-94 23.56 28.665000000000003 27.565 20.21 95-99 23.845 28.525 27.994999999999997 19.634999999999998 100-104 24.035 29.255 26.779999999999998 19.93 105-109 23.73 28.665000000000003 27.715 19.89 110-114 24.060000000000002 28.03 27.825 20.085 115-119 24.22 28.89 27.04 19.85 120-124 23.815 28.37 27.41 20.405 125-129 24.665 28.549999999999997 26.935 19.85 130-134 25.645 28.285 26.52 19.55 135-139 24.955 28.975 26.61 19.46 140-144 24.959999999999997 28.92 26.245 19.875 145-149 25.5 28.225 26.810000000000002 19.465 150-151 26.224999999999998 27.075 26.650000000000002 20.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.5 21 1.5 22 2.0 23 2.0 24 0.0 25 1.5 26 3.0 27 6.5 28 8.0 29 10.5 30 12.5 31 12.5 32 23.5 33 31.5 34 37.5 35 56.5 36 80.5 37 94.5 38 137.0 39 197.5 40 228.5 41 241.5 42 256.0 43 293.0 44 312.0 45 295.5 46 289.5 47 269.0 48 221.5 49 193.5 50 164.5 51 126.5 52 100.5 53 79.5 54 59.5 55 39.5 56 29.0 57 19.5 58 8.0 59 4.5 60 4.5 61 5.0 62 3.5 63 2.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.5 99 1.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.82022471910112 87.675 2 5.644729802033173 10.549999999999999 3 0.4280363830925628 1.2 4 0.08025682182985554 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026752273943285176 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4625000000000004 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.2375 0.0 0.0 0.0 0.0 130-131 5.737500000000001 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 6.8375 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGCA 20 0.00593511 29.0 105-109 >>END_MODULE Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661858 spots for SRR12161462.sra Written 1661858 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra Read 1661846 spots for SRR12161462.sra Written 1661846 spots for SRR12161462.sra SRR ids: ['SRR12161462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bdy40gg3 SRR12161462.sra spots: 33236932 blocks: [[1, 1661846], [1661847, 3323692], [3323693, 4985538], [4985539, 6647384], [6647385, 8309230], [8309231, 9971076], [9971077, 11632922], [11632923, 13294768], [13294769, 14956614], [14956615, 16618460], [16618461, 18280306], [18280307, 19942152], [19942153, 21603998], [21603999, 23265844], [23265845, 24927690], [24927691, 26589536], [26589537, 28251382], [28251383, 29913228], [29913229, 31575074], [31575075, 33236932]] SRR12161462 file size 11273663 SRR12161462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161462 SRR12161462_1.fastq SRR12161462_2.fastq Input file: SRR12161462_1.fastq Paired file: SRR12161462_2.fastq trimmed: SRR12161462-trimmed-pair1.fastq, SRR12161462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:29:50 2025 >> started Fri Feb 14 01:30:26 2025 >> done (35.885s) 33236932 read pairs processed; of these: 83 ( 0.00%) short read pairs filtered out after trimming by size control 19599 ( 0.06%) empty read pairs filtered out after trimming by size control 33217250 (99.94%) read pairs available; of these: 4236102 (12.75%) trimmed read pairs available after processing 28981148 (87.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 16 0.00% 21 16 0.00% 22 29 0.00% 23 26 0.00% 24 25 0.00% 25 26 0.00% 26 18 0.00% 27 39 0.00% 28 40 0.00% 29 48 0.00% 30 59 0.00% 31 36 0.00% 32 50 0.00% 33 56 0.00% 34 60 0.00% 35 68 0.00% 36 74 0.00% 37 96 0.00% 38 99 0.00% 39 82 0.00% 40 89 0.00% 41 85 0.00% 42 112 0.00% 43 104 0.00% 44 112 0.00% 45 147 0.00% 46 130 0.00% 47 134 0.00% 48 136 0.00% 49 180 0.00% 50 208 0.00% 51 231 0.00% 52 218 0.00% 53 216 0.00% 54 248 0.00% 55 261 0.00% 56 314 0.00% 57 348 0.00% 58 387 0.00% 59 444 0.00% 60 474 0.00% 61 538 0.00% 62 638 0.00% 63 710 0.00% 64 746 0.00% 65 825 0.00% 66 929 0.00% 67 975 0.00% 68 1052 0.00% 69 1235 0.00% 70 1442 0.00% 71 1663 0.01% 72 1981 0.01% 73 2062 0.01% 74 2460 0.01% 75 2720 0.01% 76 2956 0.01% 77 3269 0.01% 78 3633 0.01% 79 4142 0.01% 80 4605 0.01% 81 5304 0.02% 82 6154 0.02% 83 6759 0.02% 84 7487 0.02% 85 8448 0.03% 86 9353 0.03% 87 10000 0.03% 88 10807 0.03% 89 11611 0.03% 90 12735 0.04% 91 14064 0.04% 92 16209 0.05% 93 17523 0.05% 94 19306 0.06% 95 20960 0.06% 96 22282 0.07% 97 23804 0.07% 98 24879 0.07% 99 26683 0.08% 100 28245 0.09% 101 29974 0.09% 102 32539 0.10% 103 35323 0.11% 104 37145 0.11% 105 39513 0.12% 106 41408 0.12% 107 43567 0.13% 108 45303 0.14% 109 46241 0.14% 110 47877 0.14% 111 49913 0.15% 112 52688 0.16% 113 55061 0.17% 114 57906 0.17% 115 60410 0.18% 116 61954 0.19% 117 64303 0.19% 118 65558 0.20% 119 66738 0.20% 120 68385 0.21% 121 71543 0.22% 122 72382 0.22% 123 75117 0.23% 124 77993 0.23% 125 79555 0.24% 126 81931 0.25% 127 83483 0.25% 128 84890 0.26% 129 85229 0.26% 130 87360 0.26% 131 88683 0.27% 132 91185 0.27% 133 93924 0.28% 134 95238 0.29% 135 97498 0.29% 136 99261 0.30% 137 100451 0.30% 138 101807 0.31% 139 102183 0.31% 140 103698 0.31% 141 104714 0.32% 142 106608 0.32% 143 107353 0.32% 144 111055 0.33% 145 112450 0.34% 146 112630 0.34% 147 113754 0.34% 148 114665 0.35% 149 114638 0.35% 150 116264 0.35% 151 28981148 87.25% 33217250 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.33 fanout-score-rank=17 prefix-density=0.18 prefix-fanout=4.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=125.91 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=20.9 sequence=TCCTTCTTCTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=18 prefix-density=0.36 prefix-fanout=3.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=358.84 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=32.7 sequence=AAGAAGAAGAAA SRR12161462 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:31:45 Started mapping on | Feb 14 01:31:45 Finished on | Feb 14 01:34:23 Mapping speed, Million of reads per hour | 756.85 Number of input reads | 33217250 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 28134705 Uniquely mapped reads % | 84.70% Average mapped length | 288.06 Number of splices: Total | 29112265 Number of splices: Annotated (sjdb) | 28544887 Number of splices: GT/AG | 28639430 Number of splices: GC/AG | 372334 Number of splices: AT/AC | 23410 Number of splices: Non-canonical | 77091 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 736088 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 51755 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.79% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4346457 4346457 4346457 N_multimapping 736088 736088 736088 N_noFeature 658547 27888712 761896 N_ambiguous 454777 2672 310657 UnstrandedReadsAssigned:27021381 PositiveStrandReadsAssigned:243321 NegativeStrandReadsAssigned:27062152 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161462-trimmed-pair1.fastq SRR12161462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,217,250 reads, 30,161,285 reads pseudoaligned [quant] estimated average fragment length: 234.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR12161462.ke.tsv 34699 SRR12161462.se.tsv 87100 total ==> SRR12161462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.56 2118 41.7926 Potri.005G024800.1.v4.1 1035 801.555 388 17.0452 Potri.004G059700.1.v4.1 961 727.667 154 7.45232 Potri.007G009000.2.v4.1 1416 1182.56 0 0 Potri.003G141000.2.v4.1 2943 2709.56 1267 16.4658 Potri.016G087400.1.v4.1 270 93.5778 1762.46 663.207 Potri.015G069301.1.v4.1 564 339.139 0 0 Potri.010G195200.1.v4.1 1773 1539.56 200 4.57444 Potri.012G127500.1.v4.1 977 743.628 6370 301.639 ==> SRR12161462.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 692 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1053 SRR12161462 completed mapping pipeline successfully