Starting /dee2/code/volunteer_pipeline.sh SRR12161463 current disk space = 3089290964992 free memory = 1449980512 SRR12161463 SRAfilesize 1eedf9bc2a366a3f0066b069af5b3227 SRR12161463.sra SRR12161463.sra file validated SRR12161463 is paired end SRR12161463 is conventional basespace SRR12161463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47025 37.0 37.0 37.0 37.0 37.0 2 36.4155 37.0 37.0 37.0 37.0 37.0 3 36.438 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.5105 37.0 37.0 37.0 37.0 37.0 6 36.552 37.0 37.0 37.0 37.0 37.0 7 36.4535 37.0 37.0 37.0 37.0 37.0 8 36.4825 37.0 37.0 37.0 37.0 37.0 9 36.413 37.0 37.0 37.0 37.0 37.0 10-14 36.52239999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.49380000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4423 37.0 37.0 37.0 37.0 37.0 25-29 36.3899 37.0 37.0 37.0 37.0 37.0 30-34 36.29730000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3288 37.0 37.0 37.0 37.0 37.0 40-44 36.2818 37.0 37.0 37.0 37.0 37.0 45-49 36.2885 37.0 37.0 37.0 37.0 37.0 50-54 36.276599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2067 37.0 37.0 37.0 37.0 37.0 60-64 36.2281 37.0 37.0 37.0 37.0 37.0 65-69 36.1984 37.0 37.0 37.0 37.0 37.0 70-74 36.1723 37.0 37.0 37.0 37.0 37.0 75-79 36.1348 37.0 37.0 37.0 37.0 37.0 80-84 36.150800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0102 37.0 37.0 37.0 37.0 37.0 90-94 36.086 37.0 37.0 37.0 37.0 37.0 95-99 36.080799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0151 37.0 37.0 37.0 37.0 37.0 105-109 36.024 37.0 37.0 37.0 37.0 37.0 110-114 35.9193 37.0 37.0 37.0 37.0 37.0 115-119 35.922399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.97090000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.843599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.838499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.72430000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.7353 37.0 37.0 37.0 37.0 37.0 145-149 35.7042 37.0 37.0 37.0 37.0 37.0 150-151 35.44825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 5.0 24 1.0 25 4.0 26 6.0 27 5.0 28 7.0 29 22.0 30 34.0 31 52.0 32 66.0 33 90.0 34 150.0 35 368.0 36 2876.0 37 313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.11670423240671 11.995992987728526 8.014024542950162 41.8732782369146 2 18.725 12.525 36.5 32.25 3 17.275 15.9 27.775 39.050000000000004 4 20.3 23.65 25.224999999999998 30.825000000000003 5 22.475 29.725 25.724999999999998 22.075 6 22.35 32.550000000000004 23.974999999999998 21.125 7 15.125 27.0 41.125 16.75 8 18.075 27.474999999999998 31.65 22.8 9 18.125 25.424999999999997 34.150000000000006 22.3 10-14 19.220000000000002 29.84 28.285 22.655 15-19 20.115 27.855 28.615000000000002 23.415 20-24 19.96 28.810000000000002 28.299999999999997 22.93 25-29 19.744999999999997 28.345 28.255000000000003 23.655 30-34 19.950000000000003 28.915000000000003 27.92 23.215 35-39 19.67 29.085 27.63 23.615 40-44 19.775000000000002 28.04 28.694999999999997 23.49 45-49 19.185 28.575 28.444999999999997 23.794999999999998 50-54 20.335 27.805000000000003 28.185 23.674999999999997 55-59 19.325 28.38 28.075 24.22 60-64 19.245 27.994999999999997 28.93 23.830000000000002 65-69 19.759999999999998 28.225 28.4 23.615 70-74 19.67 28.689999999999998 27.405 24.235 75-79 19.42 28.749999999999996 28.035 23.794999999999998 80-84 20.135 27.85 28.610000000000003 23.405 85-89 20.32 28.325 27.955000000000002 23.400000000000002 90-94 20.26 28.299999999999997 27.810000000000002 23.630000000000003 95-99 20.485 28.349999999999998 27.839999999999996 23.325000000000003 100-104 19.759999999999998 28.050000000000004 28.835 23.355 105-109 20.044999999999998 28.18 28.275 23.5 110-114 20.830000000000002 28.33 27.839999999999996 23.0 115-119 20.49 28.215 27.62 23.674999999999997 120-124 21.085 28.275 26.900000000000002 23.74 125-129 20.885 28.194999999999997 27.57 23.35 130-134 20.669999999999998 28.685 27.04 23.605 135-139 20.8 28.255000000000003 27.215 23.73 140-144 20.935000000000002 28.04 27.12 23.905 145-149 20.580000000000002 28.64 27.139999999999997 23.64 150-151 20.5125 29.025000000000002 27.175 23.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 3.0 25 4.5 26 3.0 27 3.5 28 5.5 29 10.0 30 21.0 31 26.0 32 28.0 33 38.5 34 44.5 35 61.5 36 88.5 37 102.5 38 124.0 39 165.5 40 200.5 41 228.5 42 281.0 43 309.5 44 286.5 45 266.0 46 254.5 47 255.0 48 258.5 49 218.0 50 161.0 51 138.0 52 118.0 53 91.0 54 61.5 55 46.5 56 35.0 57 18.0 58 12.5 59 5.5 60 4.0 61 4.5 62 2.5 63 1.5 64 2.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.54882243979888 89.325 2 5.107171209314633 9.65 3 0.2910822969039428 0.8250000000000001 4 0.05292405398253506 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.35 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.875 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 6.862500000000001 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 7.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAATC 10 0.006830828 145.0 4 >>END_MODULE SRR12161463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.782 37.0 37.0 37.0 37.0 37.0 2 35.5625 37.0 37.0 37.0 37.0 37.0 3 35.5855 37.0 37.0 37.0 37.0 37.0 4 35.7625 37.0 37.0 37.0 37.0 37.0 5 35.7285 37.0 37.0 37.0 37.0 37.0 6 35.744 37.0 37.0 37.0 37.0 37.0 7 35.864 37.0 37.0 37.0 37.0 37.0 8 35.82 37.0 37.0 37.0 37.0 37.0 9 35.7155 37.0 37.0 37.0 37.0 37.0 10-14 35.9007 37.0 37.0 37.0 37.0 37.0 15-19 35.8474 37.0 37.0 37.0 37.0 37.0 20-24 35.851099999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.714000000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.746399999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.724199999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.7081 37.0 37.0 37.0 37.0 37.0 45-49 35.6534 37.0 37.0 37.0 37.0 37.0 50-54 35.5541 37.0 37.0 37.0 37.0 37.0 55-59 35.5964 37.0 37.0 37.0 37.0 37.0 60-64 35.4794 37.0 37.0 37.0 37.0 37.0 65-69 35.5345 37.0 37.0 37.0 37.0 37.0 70-74 35.4765 37.0 37.0 37.0 37.0 37.0 75-79 35.4702 37.0 37.0 37.0 37.0 37.0 80-84 35.4086 37.0 37.0 37.0 37.0 37.0 85-89 35.438 37.0 37.0 37.0 37.0 37.0 90-94 35.3748 37.0 37.0 37.0 34.6 37.0 95-99 35.367599999999996 37.0 37.0 37.0 34.6 37.0 100-104 35.3923 37.0 37.0 37.0 37.0 37.0 105-109 35.263799999999996 37.0 37.0 37.0 34.6 37.0 110-114 35.1537 37.0 37.0 37.0 27.4 37.0 115-119 35.196600000000004 37.0 37.0 37.0 29.8 37.0 120-124 35.1717 37.0 37.0 37.0 27.4 37.0 125-129 35.117900000000006 37.0 37.0 37.0 25.0 37.0 130-134 35.070800000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.8843 37.0 37.0 37.0 25.0 37.0 140-144 34.80160000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.841499999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.35225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 7.0 15 1.0 16 2.0 17 3.0 18 2.0 19 0.0 20 4.0 21 7.0 22 4.0 23 7.0 24 8.0 25 10.0 26 14.0 27 20.0 28 29.0 29 34.0 30 42.0 31 74.0 32 104.0 33 165.0 34 301.0 35 725.0 36 2293.0 37 140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.4 24.575 10.725 27.3 2 27.875 26.950000000000003 29.825000000000003 15.35 3 20.925 29.075 30.599999999999998 19.400000000000002 4 21.65 35.925000000000004 23.575 18.85 5 23.175 37.025000000000006 21.625 18.175 6 21.275 38.35 22.6 17.775 7 19.900000000000002 23.425 38.074999999999996 18.6 8 21.6 24.675 28.449999999999996 25.275 9 22.675 25.75 29.299999999999997 22.275 10-14 23.799999999999997 29.42 26.33 20.45 15-19 23.425 29.03 26.745 20.8 20-24 23.905 28.360000000000003 27.095000000000002 20.64 25-29 23.03 28.78 27.615000000000002 20.575 30-34 23.665 29.14 26.735 20.46 35-39 22.6 28.854999999999997 27.700000000000003 20.845 40-44 23.145 29.104999999999997 27.534999999999997 20.215 45-49 23.150000000000002 29.12 27.395000000000003 20.335 50-54 23.61 28.035 27.950000000000003 20.405 55-59 23.385 27.875 28.215 20.525 60-64 23.53 28.294999999999998 28.28 19.895 65-69 24.08 28.110000000000003 27.765 20.044999999999998 70-74 23.544999999999998 28.01 28.005000000000003 20.44 75-79 23.51 28.37 27.66 20.46 80-84 23.630000000000003 28.165000000000003 27.405 20.8 85-89 23.66 28.335 27.529999999999998 20.474999999999998 90-94 23.919999999999998 28.055000000000003 28.18 19.845 95-99 24.135 27.71 27.92 20.235 100-104 23.73 28.110000000000003 28.27 19.89 105-109 24.34 27.794999999999998 28.04 19.825 110-114 23.93 28.455000000000002 27.345000000000002 20.27 115-119 24.2 28.360000000000003 27.51 19.93 120-124 24.165 28.939999999999998 27.435 19.46 125-129 24.32 28.215 27.765 19.7 130-134 25.324999999999996 28.38 26.645000000000003 19.650000000000002 135-139 25.629999999999995 28.185 27.01 19.175 140-144 24.84 28.57 26.950000000000003 19.64 145-149 25.95 28.375 26.484999999999996 19.189999999999998 150-151 27.0125 27.750000000000004 26.400000000000002 18.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.5 21 2.0 22 1.5 23 0.5 24 0.5 25 1.0 26 1.5 27 3.0 28 5.0 29 6.5 30 10.5 31 11.5 32 19.0 33 35.5 34 49.0 35 56.0 36 83.0 37 125.0 38 155.5 39 176.5 40 204.5 41 238.0 42 250.5 43 276.5 44 298.5 45 308.0 46 286.5 47 249.5 48 228.0 49 204.5 50 180.0 51 141.0 52 105.5 53 78.5 54 56.5 55 43.5 56 36.5 57 21.5 58 8.0 59 5.0 60 4.0 61 2.5 62 2.5 63 1.0 64 1.0 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.5 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 1.5 98 1.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.80073898126155 89.8 2 4.85616257587754 9.2 3 0.3167062549485352 0.8999999999999999 4 0.026392187912377938 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.575 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.9875 0.0 0.0 0.0 0.0 132-133 6.425 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 70-74 >>END_MODULE Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra Read 1528297 spots for SRR12161463.sra Written 1528297 spots for SRR12161463.sra SRR ids: ['SRR12161463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rgrw1uy SRR12161463.sra spots: 30565940 blocks: [[1, 1528297], [1528298, 3056594], [3056595, 4584891], [4584892, 6113188], [6113189, 7641485], [7641486, 9169782], [9169783, 10698079], [10698080, 12226376], [12226377, 13754673], [13754674, 15282970], [15282971, 16811267], [16811268, 18339564], [18339565, 19867861], [19867862, 21396158], [21396159, 22924455], [22924456, 24452752], [24452753, 25981049], [25981050, 27509346], [27509347, 29037643], [29037644, 30565940]] SRR12161463 file size 10365943 SRR12161463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161463 SRR12161463_1.fastq SRR12161463_2.fastq Input file: SRR12161463_1.fastq Paired file: SRR12161463_2.fastq trimmed: SRR12161463-trimmed-pair1.fastq, SRR12161463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:55:29 2025 >> started Thu Feb 13 23:56:02 2025 >> done (33.250s) 30565940 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 15776 ( 0.05%) empty read pairs filtered out after trimming by size control 30550115 (99.95%) read pairs available; of these: 3648972 (11.94%) trimmed read pairs available after processing 26901143 (88.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 6 0.00% 22 14 0.00% 23 11 0.00% 24 15 0.00% 25 11 0.00% 26 24 0.00% 27 24 0.00% 28 24 0.00% 29 24 0.00% 30 30 0.00% 31 24 0.00% 32 31 0.00% 33 34 0.00% 34 28 0.00% 35 40 0.00% 36 41 0.00% 37 49 0.00% 38 45 0.00% 39 76 0.00% 40 59 0.00% 41 70 0.00% 42 74 0.00% 43 82 0.00% 44 67 0.00% 45 80 0.00% 46 82 0.00% 47 91 0.00% 48 104 0.00% 49 107 0.00% 50 115 0.00% 51 151 0.00% 52 164 0.00% 53 183 0.00% 54 194 0.00% 55 170 0.00% 56 263 0.00% 57 243 0.00% 58 262 0.00% 59 306 0.00% 60 390 0.00% 61 448 0.00% 62 476 0.00% 63 524 0.00% 64 590 0.00% 65 615 0.00% 66 652 0.00% 67 730 0.00% 68 876 0.00% 69 948 0.00% 70 1150 0.00% 71 1249 0.00% 72 1559 0.01% 73 1725 0.01% 74 1939 0.01% 75 2150 0.01% 76 2477 0.01% 77 2627 0.01% 78 2948 0.01% 79 3227 0.01% 80 3629 0.01% 81 4178 0.01% 82 4797 0.02% 83 5618 0.02% 84 6057 0.02% 85 6955 0.02% 86 7697 0.03% 87 8240 0.03% 88 9259 0.03% 89 9769 0.03% 90 10781 0.04% 91 11934 0.04% 92 13051 0.04% 93 14299 0.05% 94 16183 0.05% 95 17593 0.06% 96 18633 0.06% 97 19983 0.07% 98 21278 0.07% 99 22403 0.07% 100 23929 0.08% 101 25338 0.08% 102 27394 0.09% 103 29522 0.10% 104 31060 0.10% 105 33186 0.11% 106 35319 0.12% 107 36536 0.12% 108 38229 0.13% 109 39801 0.13% 110 40721 0.13% 111 42906 0.14% 112 44938 0.15% 113 46384 0.15% 114 48630 0.16% 115 51089 0.17% 116 52869 0.17% 117 54475 0.18% 118 56087 0.18% 119 57755 0.19% 120 59385 0.19% 121 60491 0.20% 122 61754 0.20% 123 64497 0.21% 124 66306 0.22% 125 68420 0.22% 126 70634 0.23% 127 72025 0.24% 128 74117 0.24% 129 74931 0.25% 130 76983 0.25% 131 77006 0.25% 132 78524 0.26% 133 80919 0.26% 134 82478 0.27% 135 83226 0.27% 136 85604 0.28% 137 86492 0.28% 138 88548 0.29% 139 90832 0.30% 140 90795 0.30% 141 92466 0.30% 142 93516 0.31% 143 94580 0.31% 144 95587 0.31% 145 98007 0.32% 146 98254 0.32% 147 99640 0.33% 148 100475 0.33% 149 100473 0.33% 150 102767 0.34% 151 26901143 88.06% 30550115 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=418.43 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=36.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=337.42 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=32.5 sequence=GAAGAAGAAGAAA SRR12161463 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:56:47 Started mapping on | Feb 13 23:56:47 Finished on | Feb 14 00:00:19 Mapping speed, Million of reads per hour | 518.78 Number of input reads | 30550115 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28856834 Uniquely mapped reads % | 94.46% Average mapped length | 294.96 Number of splices: Total | 30774592 Number of splices: Annotated (sjdb) | 30159922 Number of splices: GT/AG | 30273476 Number of splices: GC/AG | 399690 Number of splices: AT/AC | 25327 Number of splices: Non-canonical | 76099 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 794044 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 31197 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 899237 899237 899237 N_multimapping 794044 794044 794044 N_noFeature 677554 28625260 782077 N_ambiguous 274546 1260 146855 UnstrandedReadsAssigned:27904734 PositiveStrandReadsAssigned:230314 NegativeStrandReadsAssigned:27927902 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161463-trimmed-pair1.fastq SRR12161463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,550,115 reads, 28,036,802 reads pseudoaligned [quant] estimated average fragment length: 251.841 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR12161463.ke.tsv 34699 SRR12161463.se.tsv 87100 total ==> SRR12161463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.16 2488 50.9506 Potri.005G024800.1.v4.1 1035 784.159 508 23.4441 Potri.004G059700.1.v4.1 961 710.327 68 3.46438 Potri.007G009000.2.v4.1 1416 1165.16 0 0 Potri.003G141000.2.v4.1 2943 2692.16 1344.65 18.0752 Potri.016G087400.1.v4.1 270 87.1871 1970 817.69 Potri.015G069301.1.v4.1 564 325.52 0 0 Potri.010G195200.1.v4.1 1773 1522.16 367 8.7253 Potri.012G127500.1.v4.1 977 726.234 5034 250.848 ==> SRR12161463.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 511 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 917 SRR12161463 completed mapping pipeline successfully