Starting /dee2/code/volunteer_pipeline.sh SRR12161464 current disk space = 3089235402752 free memory = 1426087084 SRR12161464 SRAfilesize a22bead38e26fed6a7e398e2e6d2a096 SRR12161464.sra SRR12161464.sra file validated SRR12161464 is paired end SRR12161464 is conventional basespace SRR12161464 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.574 37.0 37.0 37.0 37.0 37.0 2 36.3375 37.0 37.0 37.0 37.0 37.0 3 36.4795 37.0 37.0 37.0 37.0 37.0 4 36.5325 37.0 37.0 37.0 37.0 37.0 5 36.613 37.0 37.0 37.0 37.0 37.0 6 36.609 37.0 37.0 37.0 37.0 37.0 7 36.4245 37.0 37.0 37.0 37.0 37.0 8 36.5225 37.0 37.0 37.0 37.0 37.0 9 36.504 37.0 37.0 37.0 37.0 37.0 10-14 36.5423 37.0 37.0 37.0 37.0 37.0 15-19 36.525400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.497 37.0 37.0 37.0 37.0 37.0 25-29 36.431400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.391299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.38119999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3785 37.0 37.0 37.0 37.0 37.0 45-49 36.3815 37.0 37.0 37.0 37.0 37.0 50-54 36.307900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2915 37.0 37.0 37.0 37.0 37.0 60-64 36.270799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2896 37.0 37.0 37.0 37.0 37.0 70-74 36.2581 37.0 37.0 37.0 37.0 37.0 75-79 36.20790000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.175599999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.162 37.0 37.0 37.0 37.0 37.0 90-94 36.1577 37.0 37.0 37.0 37.0 37.0 95-99 36.1473 37.0 37.0 37.0 37.0 37.0 100-104 36.1207 37.0 37.0 37.0 37.0 37.0 105-109 36.077 37.0 37.0 37.0 37.0 37.0 110-114 35.9809 37.0 37.0 37.0 37.0 37.0 115-119 36.0591 37.0 37.0 37.0 37.0 37.0 120-124 36.0524 37.0 37.0 37.0 37.0 37.0 125-129 35.9497 37.0 37.0 37.0 37.0 37.0 130-134 35.894 37.0 37.0 37.0 37.0 37.0 135-139 35.8777 37.0 37.0 37.0 37.0 37.0 140-144 35.81660000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.814 37.0 37.0 37.0 37.0 37.0 150-151 35.6165 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 0.0 26 3.0 27 8.0 28 14.0 29 16.0 30 29.0 31 45.0 32 65.0 33 80.0 34 122.0 35 333.0 36 2927.0 37 353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.328657314629254 11.24749498997996 7.18937875751503 42.234468937875754 2 19.400000000000002 14.075 36.625 29.9 3 17.375 16.725 28.7 37.2 4 20.65 24.625 25.424999999999997 29.299999999999997 5 23.775 29.75 24.625 21.85 6 18.875 34.35 24.4 22.375 7 14.625 26.85 41.65 16.875 8 18.224999999999998 25.900000000000002 31.75 24.125 9 15.7 25.624999999999996 34.575 24.099999999999998 10-14 19.25 29.520000000000003 28.199999999999996 23.03 15-19 19.02 28.849999999999998 28.24 23.89 20-24 19.6 28.705000000000002 28.78 22.915 25-29 19.485 29.060000000000002 27.625 23.830000000000002 30-34 19.555 28.835 28.42 23.189999999999998 35-39 18.735 28.625 28.744999999999997 23.895 40-44 19.445 28.365000000000002 28.275 23.915 45-49 19.794999999999998 28.77 27.644999999999996 23.79 50-54 19.61 28.82 27.794999999999998 23.775 55-59 19.37 29.044999999999998 27.82 23.765 60-64 19.67 28.51 28.185 23.635 65-69 20.035 28.625 27.83 23.51 70-74 20.635 28.865000000000002 27.91 22.59 75-79 20.47 27.595 28.37 23.565 80-84 19.675 28.565 28.4 23.36 85-89 19.415 29.215000000000003 27.884999999999998 23.485 90-94 20.1 28.89 28.24 22.770000000000003 95-99 19.89 28.395 28.43 23.285 100-104 19.845 28.65 28.185 23.32 105-109 19.985 28.415000000000003 28.095 23.505000000000003 110-114 19.585 29.544999999999998 27.634999999999998 23.235 115-119 20.505000000000003 28.720000000000002 27.584999999999997 23.189999999999998 120-124 20.365 29.349999999999998 27.055 23.23 125-129 19.99 29.29 27.02 23.7 130-134 19.825 29.12 27.555000000000003 23.5 135-139 20.625 28.535 27.169999999999998 23.669999999999998 140-144 20.65 28.449999999999996 27.195000000000004 23.705000000000002 145-149 20.155 28.405 27.655 23.785 150-151 20.125 28.9375 27.037499999999998 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.5 26 3.5 27 5.5 28 7.0 29 8.0 30 14.5 31 24.5 32 31.0 33 36.5 34 45.0 35 65.0 36 94.5 37 119.5 38 141.0 39 170.5 40 198.0 41 236.0 42 273.0 43 287.0 44 295.5 45 306.5 46 291.5 47 253.5 48 232.0 49 210.0 50 181.5 51 144.5 52 99.5 53 68.5 54 54.0 55 36.5 56 18.0 57 11.5 58 9.5 59 6.5 60 3.5 61 2.5 62 2.5 63 1.5 64 0.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.71598414795245 89.625 2 4.887714663143989 9.25 3 0.3963011889035667 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0999999999999996 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.5250000000000004 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATGA 10 0.006830828 145.0 8 >>END_MODULE SRR12161464 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34 37.0 37.0 37.0 37.0 37.0 2 36.1385 37.0 37.0 37.0 37.0 37.0 3 36.134 37.0 37.0 37.0 37.0 37.0 4 36.148 37.0 37.0 37.0 37.0 37.0 5 36.1585 37.0 37.0 37.0 37.0 37.0 6 36.1355 37.0 37.0 37.0 37.0 37.0 7 36.2315 37.0 37.0 37.0 37.0 37.0 8 36.176 37.0 37.0 37.0 37.0 37.0 9 36.173 37.0 37.0 37.0 37.0 37.0 10-14 36.3 37.0 37.0 37.0 37.0 37.0 15-19 36.244600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.25 37.0 37.0 37.0 37.0 37.0 25-29 36.13720000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1103 37.0 37.0 37.0 37.0 37.0 35-39 36.0816 37.0 37.0 37.0 37.0 37.0 40-44 36.0322 37.0 37.0 37.0 37.0 37.0 45-49 35.9988 37.0 37.0 37.0 37.0 37.0 50-54 35.9641 37.0 37.0 37.0 37.0 37.0 55-59 36.0022 37.0 37.0 37.0 37.0 37.0 60-64 35.9135 37.0 37.0 37.0 37.0 37.0 65-69 35.918000000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.942600000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8889 37.0 37.0 37.0 37.0 37.0 80-84 35.8124 37.0 37.0 37.0 37.0 37.0 85-89 35.7922 37.0 37.0 37.0 37.0 37.0 90-94 35.8026 37.0 37.0 37.0 37.0 37.0 95-99 35.706500000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.716699999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.692099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.62089999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.653800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5811 37.0 37.0 37.0 37.0 37.0 125-129 35.4741 37.0 37.0 37.0 37.0 37.0 130-134 35.456100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.346199999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.248400000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.2671 37.0 37.0 37.0 27.4 37.0 150-151 34.89525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 2.0 16 1.0 17 1.0 18 1.0 19 2.0 20 0.0 21 3.0 22 3.0 23 3.0 24 7.0 25 7.0 26 10.0 27 11.0 28 19.0 29 22.0 30 29.0 31 49.0 32 67.0 33 123.0 34 203.0 35 565.0 36 2651.0 37 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.65 23.125 12.3 26.924999999999997 2 28.775000000000002 27.375 29.725 14.124999999999998 3 20.9 29.599999999999998 30.925000000000004 18.575 4 23.150000000000002 34.175 24.15 18.525 5 23.775 38.1 22.075 16.05 6 19.125 38.824999999999996 24.4 17.65 7 19.35 22.725 38.2 19.725 8 23.525 26.650000000000002 27.1 22.725 9 22.025 24.349999999999998 31.075000000000003 22.55 10-14 23.1 29.665000000000003 26.479999999999997 20.755000000000003 15-19 22.57 28.384999999999998 28.09 20.955 20-24 22.575 28.610000000000003 28.48 20.335 25-29 23.02 28.27 28.01 20.7 30-34 22.35 28.794999999999998 27.925 20.93 35-39 22.515 28.595 27.925 20.965 40-44 22.945 28.804999999999996 28.439999999999998 19.81 45-49 22.634999999999998 28.79 28.110000000000003 20.465 50-54 22.855 28.4 28.43 20.315 55-59 22.985 28.99 27.894999999999996 20.13 60-64 22.475 28.845 28.660000000000004 20.02 65-69 23.189999999999998 28.199999999999996 28.505000000000003 20.105 70-74 23.525 28.499999999999996 27.815 20.16 75-79 23.3 28.555000000000003 28.335 19.81 80-84 23.06 28.560000000000002 28.37 20.01 85-89 23.825 28.025 28.084999999999997 20.064999999999998 90-94 23.51 28.415000000000003 28.04 20.035 95-99 23.56 29.085 28.1 19.255 100-104 23.855 28.4 28.515 19.23 105-109 23.25 28.410000000000004 28.215 20.125 110-114 23.45 28.215 28.355000000000004 19.98 115-119 23.62 29.360000000000003 27.58 19.439999999999998 120-124 23.195 28.54 28.37 19.895 125-129 23.51 28.67 27.505000000000003 20.315 130-134 24.035 28.48 28.215 19.27 135-139 23.995 27.889999999999997 27.99 20.125 140-144 24.355 28.660000000000004 27.315 19.67 145-149 24.82 28.465 27.694999999999997 19.02 150-151 25.1875 28.199999999999996 26.924999999999997 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 2.0 25 2.5 26 4.5 27 5.0 28 9.5 29 12.0 30 16.5 31 25.5 32 27.5 33 32.0 34 45.5 35 69.5 36 100.5 37 125.5 38 151.5 39 173.0 40 212.5 41 262.0 42 297.5 43 304.5 44 289.5 45 280.5 46 275.0 47 264.0 48 238.5 49 198.0 50 142.5 51 110.0 52 93.5 53 66.5 54 48.5 55 39.5 56 24.0 57 12.0 58 7.5 59 6.0 60 5.5 61 2.5 62 0.0 63 0.0 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.73823373876256 89.575 2 4.812268640930725 9.1 3 0.39661554732945536 1.125 4 0.052882072977260705 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.074999999999999 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563758 spots for SRR12161464.sra Written 1563758 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra Read 1563751 spots for SRR12161464.sra Written 1563751 spots for SRR12161464.sra SRR ids: ['SRR12161464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__u5uqbl8 SRR12161464.sra spots: 31275027 blocks: [[1, 1563751], [1563752, 3127502], [3127503, 4691253], [4691254, 6255004], [6255005, 7818755], [7818756, 9382506], [9382507, 10946257], [10946258, 12510008], [12510009, 14073759], [14073760, 15637510], [15637511, 17201261], [17201262, 18765012], [18765013, 20328763], [20328764, 21892514], [21892515, 23456265], [23456266, 25020016], [25020017, 26583767], [26583768, 28147518], [28147519, 29711269], [29711270, 31275027]] SRR12161464 file size 10606922 SRR12161464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161464 SRR12161464_1.fastq SRR12161464_2.fastq Input file: SRR12161464_1.fastq Paired file: SRR12161464_2.fastq trimmed: SRR12161464-trimmed-pair1.fastq, SRR12161464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:01:15 2025 >> started Fri Feb 14 00:01:53 2025 >> done (37.808s) 31275027 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 3098 ( 0.01%) empty read pairs filtered out after trimming by size control 31271885 (99.99%) read pairs available; of these: 2259442 ( 7.23%) trimmed read pairs available after processing 29012443 (92.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 8 0.00% 23 11 0.00% 24 9 0.00% 25 13 0.00% 26 8 0.00% 27 14 0.00% 28 20 0.00% 29 20 0.00% 30 13 0.00% 31 23 0.00% 32 19 0.00% 33 16 0.00% 34 14 0.00% 35 17 0.00% 36 17 0.00% 37 17 0.00% 38 37 0.00% 39 27 0.00% 40 37 0.00% 41 34 0.00% 42 37 0.00% 43 43 0.00% 44 33 0.00% 45 36 0.00% 46 53 0.00% 47 35 0.00% 48 51 0.00% 49 61 0.00% 50 70 0.00% 51 79 0.00% 52 88 0.00% 53 72 0.00% 54 73 0.00% 55 89 0.00% 56 111 0.00% 57 128 0.00% 58 131 0.00% 59 164 0.00% 60 178 0.00% 61 197 0.00% 62 240 0.00% 63 262 0.00% 64 236 0.00% 65 289 0.00% 66 327 0.00% 67 361 0.00% 68 423 0.00% 69 454 0.00% 70 515 0.00% 71 660 0.00% 72 706 0.00% 73 875 0.00% 74 918 0.00% 75 1058 0.00% 76 1167 0.00% 77 1216 0.00% 78 1430 0.00% 79 1575 0.01% 80 1743 0.01% 81 1988 0.01% 82 2315 0.01% 83 2638 0.01% 84 3005 0.01% 85 3343 0.01% 86 3672 0.01% 87 3952 0.01% 88 4411 0.01% 89 4673 0.01% 90 5277 0.02% 91 5858 0.02% 92 6377 0.02% 93 7172 0.02% 94 8002 0.03% 95 8633 0.03% 96 9163 0.03% 97 10034 0.03% 98 10572 0.03% 99 11214 0.04% 100 12195 0.04% 101 13184 0.04% 102 14067 0.04% 103 15541 0.05% 104 16149 0.05% 105 17435 0.06% 106 18219 0.06% 107 19437 0.06% 108 20394 0.07% 109 21212 0.07% 110 22220 0.07% 111 23324 0.07% 112 24512 0.08% 113 26035 0.08% 114 27171 0.09% 115 28449 0.09% 116 29765 0.10% 117 30747 0.10% 118 31749 0.10% 119 32981 0.11% 120 34255 0.11% 121 35371 0.11% 122 36849 0.12% 123 37977 0.12% 124 39932 0.13% 125 41147 0.13% 126 42723 0.14% 127 43473 0.14% 128 44849 0.14% 129 45759 0.15% 130 47031 0.15% 131 47891 0.15% 132 50156 0.16% 133 51563 0.16% 134 53035 0.17% 135 54720 0.17% 136 56225 0.18% 137 57285 0.18% 138 58225 0.19% 139 59583 0.19% 140 60529 0.19% 141 61980 0.20% 142 64326 0.21% 143 65083 0.21% 144 67007 0.21% 145 68748 0.22% 146 69944 0.22% 147 70521 0.23% 148 72401 0.23% 149 72979 0.23% 150 74210 0.24% 151 29012443 92.77% 31271885 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=252.54 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=28.8 sequence=TCTTCATCATCA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=413.68 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=32.8 sequence=AAGAAGAAGATG SRR12161464 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:02:40 Started mapping on | Feb 14 00:02:40 Finished on | Feb 14 00:06:06 Mapping speed, Million of reads per hour | 546.50 Number of input reads | 31271885 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29585879 Uniquely mapped reads % | 94.61% Average mapped length | 297.59 Number of splices: Total | 31124736 Number of splices: Annotated (sjdb) | 30448573 Number of splices: GT/AG | 30621083 Number of splices: GC/AG | 398622 Number of splices: AT/AC | 25934 Number of splices: Non-canonical | 79097 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 699071 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 29449 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 986935 986935 986935 N_multimapping 699071 699071 699071 N_noFeature 992227 29337150 1104239 N_ambiguous 307130 1523 169547 UnstrandedReadsAssigned:28286522 PositiveStrandReadsAssigned:247206 NegativeStrandReadsAssigned:28312093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161464-trimmed-pair1.fastq SRR12161464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,271,885 reads, 28,251,701 reads pseudoaligned [quant] estimated average fragment length: 265.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR12161464.ke.tsv 34699 SRR12161464.se.tsv 87100 total ==> SRR12161464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.43 2521 52.7487 Potri.005G024800.1.v4.1 1035 770.433 368 17.5243 Potri.004G059700.1.v4.1 961 696.569 155 8.16386 Potri.007G009000.2.v4.1 1416 1151.43 0 0 Potri.003G141000.2.v4.1 2943 2678.43 1066.15 14.6038 Potri.016G087400.1.v4.1 270 76.8502 1488 710.373 Potri.015G069301.1.v4.1 564 311.168 0 0 Potri.010G195200.1.v4.1 1773 1508.43 245 5.95893 Potri.012G127500.1.v4.1 977 712.492 4673 240.627 ==> SRR12161464.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 652 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 405 SRR12161464 completed mapping pipeline successfully