Starting /dee2/code/volunteer_pipeline.sh SRR12161465 current disk space = 3088948961280 free memory = 1582757404 SRR12161465 SRAfilesize 686d8a4bc547bfd02ae3298fddcea9e2 SRR12161465.sra SRR12161465.sra file validated SRR12161465 is paired end SRR12161465 is conventional basespace SRR12161465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32075 37.0 37.0 37.0 37.0 37.0 2 36.2755 37.0 37.0 37.0 37.0 37.0 3 36.471 37.0 37.0 37.0 37.0 37.0 4 36.46 37.0 37.0 37.0 37.0 37.0 5 36.5185 37.0 37.0 37.0 37.0 37.0 6 36.5925 37.0 37.0 37.0 37.0 37.0 7 36.4005 37.0 37.0 37.0 37.0 37.0 8 36.383 37.0 37.0 37.0 37.0 37.0 9 36.4675 37.0 37.0 37.0 37.0 37.0 10-14 36.5025 37.0 37.0 37.0 37.0 37.0 15-19 36.471199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.42959999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.383300000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3364 37.0 37.0 37.0 37.0 37.0 35-39 36.3009 37.0 37.0 37.0 37.0 37.0 40-44 36.2861 37.0 37.0 37.0 37.0 37.0 45-49 36.288 37.0 37.0 37.0 37.0 37.0 50-54 36.238099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1561 37.0 37.0 37.0 37.0 37.0 60-64 36.1937 37.0 37.0 37.0 37.0 37.0 65-69 36.185199999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1317 37.0 37.0 37.0 37.0 37.0 75-79 36.1366 37.0 37.0 37.0 37.0 37.0 80-84 36.1582 37.0 37.0 37.0 37.0 37.0 85-89 36.0866 37.0 37.0 37.0 37.0 37.0 90-94 36.1252 37.0 37.0 37.0 37.0 37.0 95-99 36.0464 37.0 37.0 37.0 37.0 37.0 100-104 35.9868 37.0 37.0 37.0 37.0 37.0 105-109 35.9174 37.0 37.0 37.0 37.0 37.0 110-114 35.8556 37.0 37.0 37.0 37.0 37.0 115-119 35.893 37.0 37.0 37.0 37.0 37.0 120-124 35.94 37.0 37.0 37.0 37.0 37.0 125-129 35.8737 37.0 37.0 37.0 37.0 37.0 130-134 35.7765 37.0 37.0 37.0 37.0 37.0 135-139 35.724399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6375 37.0 37.0 37.0 37.0 37.0 145-149 35.5801 37.0 37.0 37.0 37.0 37.0 150-151 35.425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 1.0 25 5.0 26 5.0 27 13.0 28 12.0 29 30.0 30 31.0 31 58.0 32 65.0 33 89.0 34 145.0 35 343.0 36 2876.0 37 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.40215484840892 12.352793786018541 6.539714357303934 35.70533700826861 2 21.025 12.5 35.125 31.35 3 17.125 17.625 28.749999999999996 36.5 4 21.025 24.15 24.975 29.849999999999998 5 20.974999999999998 32.074999999999996 25.025 21.925 6 21.025 34.725 23.625 20.625 7 14.274999999999999 27.55 41.425 16.75 8 17.75 27.900000000000002 30.475 23.875 9 16.825000000000003 25.124999999999996 34.150000000000006 23.9 10-14 18.790000000000003 30.115 27.87 23.225 15-19 19.205 29.020000000000003 27.63 24.145 20-24 19.634999999999998 28.360000000000003 28.565 23.44 25-29 19.71 28.57 28.28 23.44 30-34 19.645000000000003 28.58 28.04 23.735 35-39 20.275000000000002 28.205000000000002 27.765 23.755000000000003 40-44 19.265 28.910000000000004 27.994999999999997 23.830000000000002 45-49 19.335 28.410000000000004 28.305000000000003 23.95 50-54 19.035 28.785 28.465 23.715 55-59 19.29 28.134999999999998 28.555000000000003 24.02 60-64 20.225 28.38 28.115000000000002 23.28 65-69 19.605 28.01 28.449999999999996 23.935000000000002 70-74 19.805 28.51 28.065 23.62 75-79 20.215 28.73 27.389999999999997 23.665 80-84 20.105 28.02 27.860000000000003 24.015 85-89 20.395 28.415000000000003 27.485 23.705000000000002 90-94 20.119999999999997 28.48 27.51 23.89 95-99 19.384999999999998 28.67 27.77 24.175 100-104 20.015 28.384999999999998 27.845 23.755000000000003 105-109 20.24 28.215 27.485 24.060000000000002 110-114 20.78 28.065 27.534999999999997 23.62 115-119 19.950000000000003 28.345 27.634999999999998 24.07 120-124 20.315 28.075 27.48 24.13 125-129 20.415 28.384999999999998 27.794999999999998 23.405 130-134 21.08 28.865000000000002 27.22 22.835 135-139 20.560000000000002 28.73 27.18 23.53 140-144 20.905 28.425 26.685 23.985 145-149 20.94 28.315 26.97 23.775 150-151 20.5375 28.962500000000002 26.900000000000002 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.5 26 4.0 27 8.5 28 12.0 29 9.5 30 10.5 31 19.5 32 27.0 33 32.5 34 47.5 35 63.0 36 87.0 37 109.5 38 131.5 39 167.5 40 189.0 41 223.0 42 263.0 43 279.0 44 313.5 45 303.0 46 272.0 47 256.5 48 242.5 49 220.0 50 177.5 51 138.5 52 97.0 53 73.0 54 51.5 55 45.0 56 42.5 57 29.5 58 14.0 59 9.5 60 10.5 61 5.0 62 0.5 63 1.0 64 2.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.5940204563336 91.125 2 4.012588512981904 7.6499999999999995 3 0.3147128245476003 0.8999999999999999 4 0.05245213742460005 0.2 5 0.026226068712300026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACTGACCACCTGGTTTACTATAGGCCACAATAACTACTTTGTTGGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 5.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0895 37.0 37.0 37.0 37.0 37.0 2 35.6945 37.0 37.0 37.0 37.0 37.0 3 35.859 37.0 37.0 37.0 37.0 37.0 4 35.8895 37.0 37.0 37.0 37.0 37.0 5 36.0045 37.0 37.0 37.0 37.0 37.0 6 35.929 37.0 37.0 37.0 37.0 37.0 7 35.959 37.0 37.0 37.0 37.0 37.0 8 36.097 37.0 37.0 37.0 37.0 37.0 9 35.9395 37.0 37.0 37.0 37.0 37.0 10-14 36.0406 37.0 37.0 37.0 37.0 37.0 15-19 36.04899999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.9508 37.0 37.0 37.0 37.0 37.0 25-29 35.901599999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.881899999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.8721 37.0 37.0 37.0 37.0 37.0 40-44 35.7718 37.0 37.0 37.0 37.0 37.0 45-49 35.82940000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.7275 37.0 37.0 37.0 37.0 37.0 55-59 35.7718 37.0 37.0 37.0 37.0 37.0 60-64 35.69840000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.6857 37.0 37.0 37.0 37.0 37.0 70-74 35.5574 37.0 37.0 37.0 37.0 37.0 75-79 35.644400000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.572 37.0 37.0 37.0 37.0 37.0 85-89 35.5964 37.0 37.0 37.0 37.0 37.0 90-94 35.4928 37.0 37.0 37.0 37.0 37.0 95-99 35.4346 37.0 37.0 37.0 37.0 37.0 100-104 35.4933 37.0 37.0 37.0 37.0 37.0 105-109 35.4253 37.0 37.0 37.0 37.0 37.0 110-114 35.3363 37.0 37.0 37.0 37.0 37.0 115-119 35.3557 37.0 37.0 37.0 34.6 37.0 120-124 35.254200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.2478 37.0 37.0 37.0 32.2 37.0 130-134 35.2067 37.0 37.0 37.0 32.2 37.0 135-139 35.1754 37.0 37.0 37.0 27.4 37.0 140-144 34.9792 37.0 37.0 37.0 25.0 37.0 145-149 35.054700000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.505 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 6.0 16 2.0 17 5.0 18 2.0 19 3.0 20 2.0 21 3.0 22 7.0 23 5.0 24 9.0 25 12.0 26 17.0 27 12.0 28 20.0 29 24.0 30 43.0 31 56.0 32 82.0 33 123.0 34 253.0 35 611.0 36 2505.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 24.2 10.65 23.35 2 27.175 27.325 28.875 16.625 3 21.6 27.474999999999998 31.825 19.1 4 23.875 36.175000000000004 22.525000000000002 17.424999999999997 5 24.275 39.25 21.025 15.45 6 22.425 39.324999999999996 21.175 17.075000000000003 7 20.724999999999998 23.875 37.625 17.775 8 21.975 25.174999999999997 28.549999999999997 24.3 9 22.85 24.7 30.075000000000003 22.375 10-14 23.46 29.685 26.224999999999998 20.630000000000003 15-19 23.07 28.439999999999998 28.025 20.465 20-24 23.61 28.694999999999997 27.650000000000002 20.044999999999998 25-29 23.48 28.499999999999996 27.465 20.555 30-34 23.055 28.92 28.165000000000003 19.86 35-39 23.135 27.79 28.555000000000003 20.52 40-44 22.865 28.689999999999998 28.34 20.105 45-49 23.27 28.42 28.12 20.19 50-54 22.75 28.59 28.225 20.435 55-59 23.305 28.205000000000002 28.549999999999997 19.939999999999998 60-64 23.549999999999997 28.415000000000003 27.485 20.549999999999997 65-69 23.974999999999998 27.915 28.115000000000002 19.994999999999997 70-74 23.69 28.395 27.61 20.305 75-79 24.295 27.61 27.994999999999997 20.1 80-84 23.895 28.585 27.415 20.105 85-89 23.89 27.76 27.750000000000004 20.599999999999998 90-94 23.880000000000003 28.634999999999998 27.375 20.11 95-99 23.89 28.444999999999997 27.73 19.935 100-104 23.955000000000002 28.215 27.515 20.315 105-109 24.315 28.335 27.839999999999996 19.509999999999998 110-114 24.16 28.005000000000003 28.04 19.794999999999998 115-119 23.845 28.43 27.76 19.965 120-124 23.990000000000002 28.095 28.110000000000003 19.805 125-129 24.86 28.144999999999996 27.47 19.525000000000002 130-134 24.505 28.310000000000002 26.91 20.275000000000002 135-139 24.59 27.925 27.83 19.655 140-144 25.0 28.7 27.125 19.175 145-149 25.83 27.915 26.634999999999998 19.62 150-151 26.187500000000004 28.225 26.1 19.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.5 14 2.5 15 2.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 2.5 26 1.0 27 2.0 28 5.5 29 10.5 30 19.5 31 21.5 32 18.5 33 33.5 34 55.0 35 64.5 36 91.5 37 125.0 38 141.0 39 163.5 40 200.5 41 252.0 42 274.0 43 284.5 44 298.5 45 292.0 46 276.0 47 253.0 48 237.5 49 209.0 50 160.0 51 114.5 52 92.0 53 75.0 54 60.0 55 45.0 56 28.0 57 22.5 58 15.5 59 7.5 60 3.0 61 2.5 62 1.5 63 0.0 64 0.0 65 0.5 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.0 86 0.0 87 0.5 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.5 98 1.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54324894514767 90.575 2 4.061181434599156 7.7 3 0.290084388185654 0.8250000000000001 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026371308016877634 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05274261603375527 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 12 0.3 No Hit ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 4.0625 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.675000000000001 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTAG 10 0.006830828 145.0 4 >>END_MODULE Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200559 spots for SRR12161465.sra Written 2200559 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra Read 2200541 spots for SRR12161465.sra Written 2200541 spots for SRR12161465.sra SRR ids: ['SRR12161465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mfe0gs1s SRR12161465.sra spots: 44010838 blocks: [[1, 2200541], [2200542, 4401082], [4401083, 6601623], [6601624, 8802164], [8802165, 11002705], [11002706, 13203246], [13203247, 15403787], [15403788, 17604328], [17604329, 19804869], [19804870, 22005410], [22005411, 24205951], [24205952, 26406492], [26406493, 28607033], [28607034, 30807574], [30807575, 33008115], [33008116, 35208656], [35208657, 37409197], [37409198, 39609738], [39609739, 41810279], [41810280, 44010838]] SRR12161465 file size 14935107 SRR12161465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161465 SRR12161465_1.fastq SRR12161465_2.fastq Input file: SRR12161465_1.fastq Paired file: SRR12161465_2.fastq trimmed: SRR12161465-trimmed-pair1.fastq, SRR12161465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:33:07 2025 >> started Fri Feb 14 01:33:55 2025 >> done (48.561s) 44010838 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 10060 ( 0.02%) empty read pairs filtered out after trimming by size control 44000692 (99.98%) read pairs available; of these: 4196649 ( 9.54%) trimmed read pairs available after processing 39804043 (90.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 13 0.00% 21 18 0.00% 22 20 0.00% 23 29 0.00% 24 35 0.00% 25 37 0.00% 26 48 0.00% 27 33 0.00% 28 38 0.00% 29 53 0.00% 30 49 0.00% 31 50 0.00% 32 53 0.00% 33 57 0.00% 34 58 0.00% 35 35 0.00% 36 71 0.00% 37 66 0.00% 38 64 0.00% 39 80 0.00% 40 80 0.00% 41 63 0.00% 42 96 0.00% 43 97 0.00% 44 82 0.00% 45 88 0.00% 46 106 0.00% 47 128 0.00% 48 106 0.00% 49 130 0.00% 50 178 0.00% 51 179 0.00% 52 174 0.00% 53 182 0.00% 54 182 0.00% 55 229 0.00% 56 250 0.00% 57 293 0.00% 58 292 0.00% 59 330 0.00% 60 411 0.00% 61 441 0.00% 62 464 0.00% 63 521 0.00% 64 578 0.00% 65 592 0.00% 66 697 0.00% 67 745 0.00% 68 802 0.00% 69 929 0.00% 70 1019 0.00% 71 1199 0.00% 72 1426 0.00% 73 1523 0.00% 74 1800 0.00% 75 1992 0.00% 76 2135 0.00% 77 2291 0.01% 78 2638 0.01% 79 2892 0.01% 80 3369 0.01% 81 3688 0.01% 82 4378 0.01% 83 4986 0.01% 84 5540 0.01% 85 6250 0.01% 86 6809 0.02% 87 7182 0.02% 88 7933 0.02% 89 8661 0.02% 90 9704 0.02% 91 10929 0.02% 92 12092 0.03% 93 13290 0.03% 94 14909 0.03% 95 15915 0.04% 96 17287 0.04% 97 18481 0.04% 98 19888 0.05% 99 21523 0.05% 100 22488 0.05% 101 25007 0.06% 102 26894 0.06% 103 29607 0.07% 104 31337 0.07% 105 33592 0.08% 106 35476 0.08% 107 37168 0.08% 108 38675 0.09% 109 41009 0.09% 110 42389 0.10% 111 45033 0.10% 112 47852 0.11% 113 49785 0.11% 114 53007 0.12% 115 55752 0.13% 116 57961 0.13% 117 59657 0.14% 118 61356 0.14% 119 63229 0.14% 120 65168 0.15% 121 68327 0.16% 122 69843 0.16% 123 73382 0.17% 124 77098 0.18% 125 78703 0.18% 126 81434 0.19% 127 83534 0.19% 128 86814 0.20% 129 86762 0.20% 130 88190 0.20% 131 90280 0.21% 132 93591 0.21% 133 95871 0.22% 134 99299 0.23% 135 102937 0.23% 136 104779 0.24% 137 106148 0.24% 138 107300 0.24% 139 108152 0.25% 140 111293 0.25% 141 111538 0.25% 142 114719 0.26% 143 116683 0.27% 144 121400 0.28% 145 123199 0.28% 146 123427 0.28% 147 125899 0.29% 148 126360 0.29% 149 127181 0.29% 150 127961 0.29% 151 39804043 90.46% 44000692 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=14 prefix-density=1.01 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=37.72 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.7 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=19 prefix-density=1.13 prefix-fanout=2.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=398.88 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.1 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGT SRR12161465 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:35:31 Started mapping on | Feb 14 01:35:31 Finished on | Feb 14 01:39:45 Mapping speed, Million of reads per hour | 623.63 Number of input reads | 44000692 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 41480286 Uniquely mapped reads % | 94.27% Average mapped length | 296.35 Number of splices: Total | 42103379 Number of splices: Annotated (sjdb) | 41139778 Number of splices: GT/AG | 41416384 Number of splices: GC/AG | 535060 Number of splices: AT/AC | 37840 Number of splices: Non-canonical | 114095 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1051665 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 50247 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1468741 1468741 1468741 N_multimapping 1051665 1051665 1051665 N_noFeature 1290156 41113743 1472440 N_ambiguous 427222 2630 241352 UnstrandedReadsAssigned:39762908 PositiveStrandReadsAssigned:363913 NegativeStrandReadsAssigned:39766494 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161465-trimmed-pair1.fastq SRR12161465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,000,692 reads, 39,669,731 reads pseudoaligned [quant] estimated average fragment length: 259.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12161465.ke.tsv 34699 SRR12161465.se.tsv 87100 total ==> SRR12161465.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.52 7587 105.94 Potri.005G024800.1.v4.1 1035 776.521 911 28.8236 Potri.004G059700.1.v4.1 961 702.623 132 4.61567 Potri.007G009000.2.v4.1 1416 1157.52 0 0 Potri.003G141000.2.v4.1 2943 2684.52 1855.43 16.981 Potri.016G087400.1.v4.1 270 82.4347 1781 530.808 Potri.015G069301.1.v4.1 564 318.756 0 0 Potri.010G195200.1.v4.1 1773 1514.52 973 15.7841 Potri.012G127500.1.v4.1 977 718.583 12421 424.681 ==> SRR12161465.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 74 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 973 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2302 SRR12161465 completed mapping pipeline successfully