Starting /dee2/code/volunteer_pipeline.sh SRR12161466 current disk space = 3088889278464 free memory = 1582777372 SRR12161466 SRAfilesize 79b2a8ced2f6519c477e49652f022e5e SRR12161466.sra SRR12161466.sra file validated SRR12161466 is paired end SRR12161466 is conventional basespace SRR12161466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2975 37.0 37.0 37.0 37.0 37.0 2 36.131 37.0 37.0 37.0 37.0 37.0 3 36.4395 37.0 37.0 37.0 37.0 37.0 4 36.4555 37.0 37.0 37.0 37.0 37.0 5 36.436 37.0 37.0 37.0 37.0 37.0 6 36.5255 37.0 37.0 37.0 37.0 37.0 7 36.363 37.0 37.0 37.0 37.0 37.0 8 36.3815 37.0 37.0 37.0 37.0 37.0 9 36.4295 37.0 37.0 37.0 37.0 37.0 10-14 36.47520000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4158 37.0 37.0 37.0 37.0 37.0 20-24 36.4185 37.0 37.0 37.0 37.0 37.0 25-29 36.3543 37.0 37.0 37.0 37.0 37.0 30-34 36.2974 37.0 37.0 37.0 37.0 37.0 35-39 36.273399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.2097 37.0 37.0 37.0 37.0 37.0 45-49 36.2139 37.0 37.0 37.0 37.0 37.0 50-54 36.1558 37.0 37.0 37.0 37.0 37.0 55-59 36.0996 37.0 37.0 37.0 37.0 37.0 60-64 36.1366 37.0 37.0 37.0 37.0 37.0 65-69 36.011799999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.005700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0421 37.0 37.0 37.0 37.0 37.0 80-84 35.989 37.0 37.0 37.0 37.0 37.0 85-89 35.961499999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.938399999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.895700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.788 37.0 37.0 37.0 37.0 37.0 105-109 35.8268 37.0 37.0 37.0 37.0 37.0 110-114 35.749100000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8741 37.0 37.0 37.0 37.0 37.0 120-124 35.7971 37.0 37.0 37.0 37.0 37.0 125-129 35.6524 37.0 37.0 37.0 37.0 37.0 130-134 35.66160000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.5015 37.0 37.0 37.0 34.6 37.0 140-144 35.4135 37.0 37.0 37.0 37.0 37.0 145-149 35.446000000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.153 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 3.0 22 1.0 23 1.0 24 8.0 25 8.0 26 4.0 27 13.0 28 15.0 29 27.0 30 35.0 31 48.0 32 69.0 33 107.0 34 169.0 35 432.0 36 2791.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.446115288220554 12.857142857142856 6.616541353383458 32.08020050125313 2 20.325 13.15 33.675 32.85 3 18.0 19.25 29.725 33.025 4 22.275 26.1 24.25 27.375 5 22.475 31.2 25.224999999999998 21.099999999999998 6 20.674999999999997 34.0 25.2 20.125 7 14.499999999999998 28.349999999999998 40.675 16.475 8 15.85 26.55 32.675 24.925 9 17.275 24.349999999999998 35.225 23.150000000000002 10-14 18.745 30.095 28.395 22.765 15-19 19.42 28.115000000000002 28.285 24.18 20-24 19.675 29.054999999999996 27.925 23.345 25-29 19.54 28.925 28.275 23.26 30-34 19.915 28.345 28.215 23.525 35-39 19.68 28.54 28.144999999999996 23.635 40-44 19.535 29.025000000000002 28.125 23.315 45-49 19.77 29.165000000000003 27.51 23.555 50-54 19.63 28.63 28.035 23.705000000000002 55-59 19.345000000000002 28.93 28.139999999999997 23.585 60-64 19.765 28.95 27.355 23.93 65-69 19.509999999999998 28.71 28.01 23.77 70-74 19.595000000000002 28.845 27.965 23.595 75-79 19.67 28.349999999999998 28.060000000000002 23.919999999999998 80-84 19.685 28.794999999999998 28.225 23.294999999999998 85-89 20.235 29.360000000000003 27.13 23.275000000000002 90-94 20.165 29.160000000000004 27.3 23.375 95-99 20.7 28.505000000000003 27.750000000000004 23.044999999999998 100-104 20.34 28.660000000000004 27.455000000000002 23.544999999999998 105-109 20.64 28.565 27.634999999999998 23.16 110-114 20.145 27.63 28.405 23.82 115-119 20.424999999999997 28.395 27.575 23.605 120-124 20.835 28.9 26.584999999999997 23.68 125-129 20.655 28.73 26.924999999999997 23.69 130-134 21.025 28.389999999999997 27.155 23.43 135-139 20.855 28.71 27.42 23.015 140-144 21.415 28.035 27.229999999999997 23.32 145-149 21.025 28.225 26.88 23.87 150-151 20.849999999999998 28.525 27.125 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 2.0 21 1.5 22 0.0 23 2.5 24 6.0 25 6.0 26 4.5 27 4.5 28 9.0 29 11.0 30 13.0 31 26.5 32 36.0 33 39.5 34 56.0 35 76.5 36 101.0 37 115.5 38 123.5 39 154.0 40 201.5 41 235.5 42 254.0 43 273.5 44 272.0 45 286.5 46 288.5 47 256.5 48 244.5 49 209.5 50 165.0 51 133.0 52 101.0 53 85.5 54 67.0 55 42.5 56 27.0 57 15.5 58 12.5 59 11.5 60 5.5 61 4.5 62 3.5 63 1.0 64 0.5 65 0.5 66 0.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91302055877702 90.025 2 4.797047970479705 9.1 3 0.23721665788086455 0.675 4 0.05271481286241434 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.737500000000001 0.0 0.0 0.0 0.0 128-129 5.3625 0.0 0.0 0.0 0.0 130-131 5.975 0.0 0.0 0.0 0.0 132-133 6.512499999999999 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAACA 10 0.006830828 145.0 9 TCTTTCA 10 0.006830828 145.0 3 TTTTTTT 155 0.0030531995 8.419354 20-24 >>END_MODULE SRR12161466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3445 37.0 37.0 37.0 37.0 37.0 2 35.9245 37.0 37.0 37.0 37.0 37.0 3 36.1415 37.0 37.0 37.0 37.0 37.0 4 36.1635 37.0 37.0 37.0 37.0 37.0 5 36.1235 37.0 37.0 37.0 37.0 37.0 6 36.128 37.0 37.0 37.0 37.0 37.0 7 36.045 37.0 37.0 37.0 37.0 37.0 8 36.1575 37.0 37.0 37.0 37.0 37.0 9 36.123 37.0 37.0 37.0 37.0 37.0 10-14 36.181200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1177 37.0 37.0 37.0 37.0 37.0 20-24 36.11110000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0141 37.0 37.0 37.0 37.0 37.0 30-34 35.9691 37.0 37.0 37.0 37.0 37.0 35-39 35.981500000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.936899999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9231 37.0 37.0 37.0 37.0 37.0 50-54 35.8901 37.0 37.0 37.0 37.0 37.0 55-59 35.871 37.0 37.0 37.0 37.0 37.0 60-64 35.8094 37.0 37.0 37.0 37.0 37.0 65-69 35.7365 37.0 37.0 37.0 37.0 37.0 70-74 35.7418 37.0 37.0 37.0 37.0 37.0 75-79 35.6894 37.0 37.0 37.0 37.0 37.0 80-84 35.68300000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.6997 37.0 37.0 37.0 37.0 37.0 90-94 35.6426 37.0 37.0 37.0 37.0 37.0 95-99 35.5872 37.0 37.0 37.0 37.0 37.0 100-104 35.6321 37.0 37.0 37.0 37.0 37.0 105-109 35.6084 37.0 37.0 37.0 37.0 37.0 110-114 35.544 37.0 37.0 37.0 37.0 37.0 115-119 35.45739999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.4563 37.0 37.0 37.0 37.0 37.0 125-129 35.4703 37.0 37.0 37.0 37.0 37.0 130-134 35.3497 37.0 37.0 37.0 34.6 37.0 135-139 35.2152 37.0 37.0 37.0 29.8 37.0 140-144 35.1062 37.0 37.0 37.0 27.4 37.0 145-149 35.056400000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.60425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 4.0 16 4.0 17 2.0 18 1.0 19 2.0 20 1.0 21 4.0 22 9.0 23 8.0 24 5.0 25 10.0 26 8.0 27 11.0 28 19.0 29 26.0 30 35.0 31 41.0 32 74.0 33 127.0 34 213.0 35 603.0 36 2598.0 37 188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.875 24.075 8.375 20.674999999999997 2 27.375 26.6 27.725 18.3 3 22.025 28.549999999999997 31.574999999999996 17.849999999999998 4 24.025 34.625 23.150000000000002 18.2 5 24.9 36.975 22.0 16.125 6 21.875 38.875 21.349999999999998 17.9 7 20.375 22.95 37.85 18.825 8 21.45 25.8 27.35 25.4 9 22.650000000000002 26.1 28.775000000000002 22.475 10-14 24.05 29.565 26.445 19.939999999999998 15-19 23.425 28.42 27.715 20.44 20-24 23.305 28.515 27.67 20.51 25-29 23.56 28.470000000000002 27.715 20.255000000000003 30-34 23.28 28.494999999999997 27.965 20.26 35-39 23.044999999999998 28.439999999999998 27.894999999999996 20.62 40-44 23.724999999999998 28.299999999999997 27.689999999999998 20.285 45-49 24.145 27.534999999999997 28.294999999999998 20.025000000000002 50-54 22.895 28.189999999999998 28.115000000000002 20.8 55-59 22.905 28.625 27.834999999999997 20.635 60-64 23.175 28.044999999999998 28.050000000000004 20.73 65-69 23.805 28.810000000000002 27.205000000000002 20.18 70-74 24.310000000000002 28.64 27.639999999999997 19.41 75-79 24.085 28.005000000000003 27.675 20.235 80-84 23.474999999999998 28.955 27.525 20.044999999999998 85-89 24.16 28.165000000000003 27.6 20.075000000000003 90-94 24.37 28.110000000000003 27.66 19.86 95-99 24.104999999999997 28.71 27.500000000000004 19.685 100-104 24.895 28.255000000000003 27.05 19.8 105-109 24.345 28.175 27.355 20.125 110-114 24.4 28.01 27.73 19.86 115-119 24.365000000000002 28.9 26.97 19.765 120-124 24.215 28.1 27.68 20.005 125-129 25.365 28.24 26.51 19.885 130-134 25.245 27.805000000000003 27.165 19.785 135-139 25.385 27.950000000000003 27.250000000000004 19.415 140-144 25.855 27.855 26.83 19.46 145-149 26.115 27.195000000000004 27.750000000000004 18.94 150-151 26.4625 28.1125 26.375 19.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 2.0 22 3.5 23 2.0 24 2.0 25 2.0 26 2.5 27 2.5 28 6.5 29 10.0 30 9.0 31 16.0 32 28.5 33 38.5 34 46.5 35 68.5 36 95.0 37 113.0 38 132.0 39 168.0 40 204.5 41 240.0 42 279.5 43 280.0 44 276.0 45 287.5 46 286.0 47 256.0 48 217.0 49 196.0 50 177.0 51 136.0 52 99.5 53 78.0 54 55.5 55 41.5 56 28.0 57 21.5 58 18.5 59 15.5 60 12.5 61 5.5 62 2.0 63 3.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 2.0 92 2.0 93 0.5 94 1.0 95 1.0 96 0.5 97 1.0 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.08066649034646 89.875 2 4.549061094948426 8.6 3 0.26448029621793173 0.75 4 0.026448029621793177 0.1 5 0.026448029621793177 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026448029621793177 0.22499999999999998 >10 0.026448029621793177 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 13 0.325 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.762499999999999 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 7.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAAAT 10 0.006830828 145.0 8 CTTGAGC 10 0.006830828 145.0 6 TGTGTTC 10 0.006830828 145.0 8 >>END_MODULE Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956723 spots for SRR12161466.sra Written 1956723 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra Read 1956721 spots for SRR12161466.sra Written 1956721 spots for SRR12161466.sra SRR ids: ['SRR12161466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5csmunnb SRR12161466.sra spots: 39134422 blocks: [[1, 1956721], [1956722, 3913442], [3913443, 5870163], [5870164, 7826884], [7826885, 9783605], [9783606, 11740326], [11740327, 13697047], [13697048, 15653768], [15653769, 17610489], [17610490, 19567210], [19567211, 21523931], [21523932, 23480652], [23480653, 25437373], [25437374, 27394094], [27394095, 29350815], [29350816, 31307536], [31307537, 33264257], [33264258, 35220978], [35220979, 37177699], [37177700, 39134422]] SRR12161466 file size 13277888 SRR12161466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161466 SRR12161466_1.fastq SRR12161466_2.fastq Input file: SRR12161466_1.fastq Paired file: SRR12161466_2.fastq trimmed: SRR12161466-trimmed-pair1.fastq, SRR12161466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:46:09 2025 >> started Fri Feb 14 01:46:50 2025 >> done (40.590s) 39134422 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 22431 ( 0.06%) empty read pairs filtered out after trimming by size control 39111900 (99.94%) read pairs available; of these: 4695188 (12.00%) trimmed read pairs available after processing 34416712 (88.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 8 0.00% 21 21 0.00% 22 28 0.00% 23 28 0.00% 24 31 0.00% 25 41 0.00% 26 48 0.00% 27 41 0.00% 28 44 0.00% 29 38 0.00% 30 35 0.00% 31 45 0.00% 32 58 0.00% 33 47 0.00% 34 60 0.00% 35 73 0.00% 36 61 0.00% 37 80 0.00% 38 82 0.00% 39 78 0.00% 40 69 0.00% 41 96 0.00% 42 84 0.00% 43 100 0.00% 44 102 0.00% 45 106 0.00% 46 122 0.00% 47 112 0.00% 48 139 0.00% 49 152 0.00% 50 165 0.00% 51 190 0.00% 52 192 0.00% 53 219 0.00% 54 235 0.00% 55 256 0.00% 56 291 0.00% 57 330 0.00% 58 357 0.00% 59 433 0.00% 60 515 0.00% 61 567 0.00% 62 617 0.00% 63 688 0.00% 64 723 0.00% 65 793 0.00% 66 946 0.00% 67 965 0.00% 68 1088 0.00% 69 1321 0.00% 70 1481 0.00% 71 1757 0.00% 72 2046 0.01% 73 2246 0.01% 74 2579 0.01% 75 2833 0.01% 76 3025 0.01% 77 3351 0.01% 78 3802 0.01% 79 4323 0.01% 80 4781 0.01% 81 5747 0.01% 82 6582 0.02% 83 7356 0.02% 84 7980 0.02% 85 8895 0.02% 86 9479 0.02% 87 10242 0.03% 88 11315 0.03% 89 12372 0.03% 90 13839 0.04% 91 15465 0.04% 92 17346 0.04% 93 19261 0.05% 94 20874 0.05% 95 22729 0.06% 96 23954 0.06% 97 25189 0.06% 98 26815 0.07% 99 28408 0.07% 100 31101 0.08% 101 33484 0.09% 102 36238 0.09% 103 39474 0.10% 104 41494 0.11% 105 44318 0.11% 106 45766 0.12% 107 47119 0.12% 108 48816 0.12% 109 50475 0.13% 110 53128 0.14% 111 55995 0.14% 112 59216 0.15% 113 61805 0.16% 114 66641 0.17% 115 68418 0.17% 116 70120 0.18% 117 71678 0.18% 118 72609 0.19% 119 73946 0.19% 120 76071 0.19% 121 79112 0.20% 122 81991 0.21% 123 85581 0.22% 124 89886 0.23% 125 91163 0.23% 126 92978 0.24% 127 93224 0.24% 128 96662 0.25% 129 94978 0.24% 130 96832 0.25% 131 98080 0.25% 132 102066 0.26% 133 104764 0.27% 134 107793 0.28% 135 111109 0.28% 136 111427 0.28% 137 112479 0.29% 138 112428 0.29% 139 112511 0.29% 140 114294 0.29% 141 113723 0.29% 142 116549 0.30% 143 118566 0.30% 144 122369 0.31% 145 124559 0.32% 146 124253 0.32% 147 125460 0.32% 148 124401 0.32% 149 123982 0.32% 150 125047 0.32% 151 34416712 88.00% 39111900 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=22 prefix-density=1.11 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=37.36 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=29 prefix-density=1.04 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=50.55 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.6 sequence=AGAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCGTATTCGCGAAACCAAATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGATATAAAACCAGCAAAAGATAAGTCCTTCTCGAAAGATGTCCACCCAAACTCTCAGTTGTTCCTTTACAATGATGGTGTC SRR12161466 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:47:31 Started mapping on | Feb 14 01:47:32 Finished on | Feb 14 01:51:34 Mapping speed, Million of reads per hour | 581.83 Number of input reads | 39111900 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 36123610 Uniquely mapped reads % | 92.36% Average mapped length | 294.72 Number of splices: Total | 37109193 Number of splices: Annotated (sjdb) | 36276669 Number of splices: GT/AG | 36506658 Number of splices: GC/AG | 463360 Number of splices: AT/AC | 33531 Number of splices: Non-canonical | 105644 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1013246 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 40026 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1975044 1975044 1975044 N_multimapping 1013246 1013246 1013246 N_noFeature 1047689 35819099 1173497 N_ambiguous 398147 1817 218677 UnstrandedReadsAssigned:34677774 PositiveStrandReadsAssigned:302694 NegativeStrandReadsAssigned:34731436 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161466-trimmed-pair1.fastq SRR12161466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,111,900 reads, 34,716,680 reads pseudoaligned [quant] estimated average fragment length: 252.815 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR12161466.ke.tsv 34699 SRR12161466.se.tsv 87100 total ==> SRR12161466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.19 4575 70.2793 Potri.005G024800.1.v4.1 1035 783.185 995 34.4692 Potri.004G059700.1.v4.1 961 709.302 109 4.16934 Potri.007G009000.2.v4.1 1416 1164.19 0 0 Potri.003G141000.2.v4.1 2943 2691.19 1848.73 18.6381 Potri.016G087400.1.v4.1 270 88.3524 1893 581.306 Potri.015G069301.1.v4.1 564 322.984 0 0 Potri.010G195200.1.v4.1 1773 1521.19 867 15.4636 Potri.012G127500.1.v4.1 977 725.257 8945 334.627 ==> SRR12161466.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 889 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 62 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1821 SRR12161466 completed mapping pipeline successfully