Starting /dee2/code/volunteer_pipeline.sh SRR12161467 current disk space = 3088176816128 free memory = 1582567420 SRR12161467 SRAfilesize 5479669f1c880e45d556bec782df8171 SRR12161467.sra SRR12161467.sra file validated SRR12161467 is paired end SRR12161467 is conventional basespace SRR12161467 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.414 37.0 37.0 37.0 37.0 37.0 2 36.2655 37.0 37.0 37.0 37.0 37.0 3 36.4425 37.0 37.0 37.0 37.0 37.0 4 36.4905 37.0 37.0 37.0 37.0 37.0 5 36.527 37.0 37.0 37.0 37.0 37.0 6 36.6155 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.521 37.0 37.0 37.0 37.0 37.0 9 36.4855 37.0 37.0 37.0 37.0 37.0 10-14 36.4683 37.0 37.0 37.0 37.0 37.0 15-19 36.46730000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4281 37.0 37.0 37.0 37.0 37.0 25-29 36.3496 37.0 37.0 37.0 37.0 37.0 30-34 36.3104 37.0 37.0 37.0 37.0 37.0 35-39 36.3026 37.0 37.0 37.0 37.0 37.0 40-44 36.3105 37.0 37.0 37.0 37.0 37.0 45-49 36.258500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2519 37.0 37.0 37.0 37.0 37.0 55-59 36.1578 37.0 37.0 37.0 37.0 37.0 60-64 36.2014 37.0 37.0 37.0 37.0 37.0 65-69 36.223499999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.1896 37.0 37.0 37.0 37.0 37.0 75-79 36.189 37.0 37.0 37.0 37.0 37.0 80-84 36.099900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0782 37.0 37.0 37.0 37.0 37.0 90-94 36.101699999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.091499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.976000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9961 37.0 37.0 37.0 37.0 37.0 110-114 35.925 37.0 37.0 37.0 37.0 37.0 115-119 35.9332 37.0 37.0 37.0 37.0 37.0 120-124 35.992399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8887 37.0 37.0 37.0 37.0 37.0 130-134 35.8339 37.0 37.0 37.0 37.0 37.0 135-139 35.796299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.713 37.0 37.0 37.0 37.0 37.0 145-149 35.7193 37.0 37.0 37.0 37.0 37.0 150-151 35.51225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 2.0 25 0.0 26 6.0 27 9.0 28 20.0 29 28.0 30 39.0 31 57.0 32 60.0 33 75.0 34 135.0 35 334.0 36 2899.0 37 334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.767150726089135 13.044566850275412 6.810215322984477 35.37806710065098 2 19.3 12.7 35.15 32.85 3 15.950000000000001 19.0 29.125 35.925000000000004 4 20.825 25.424999999999997 25.45 28.299999999999997 5 23.225 29.625 25.1 22.05 6 21.099999999999998 33.475 23.9 21.525 7 15.125 27.55 41.825 15.5 8 17.825 26.075 30.875000000000004 25.224999999999998 9 17.825 24.9 34.225 23.05 10-14 19.759999999999998 29.435 27.955000000000002 22.85 15-19 19.57 28.09 27.894999999999996 24.445 20-24 19.84 28.134999999999998 28.53 23.494999999999997 25-29 19.63 28.4 28.655 23.315 30-34 19.515 28.275 28.46 23.75 35-39 19.400000000000002 28.599999999999998 28.095 23.905 40-44 19.24 28.884999999999998 28.035 23.84 45-49 19.85 28.395 27.715 24.04 50-54 20.195 28.29 28.09 23.425 55-59 19.825 28.475 27.689999999999998 24.01 60-64 19.885 28.825 27.485 23.805 65-69 20.415 28.134999999999998 27.185 24.265 70-74 19.79 28.67 28.21 23.330000000000002 75-79 20.064999999999998 28.205000000000002 27.85 23.880000000000003 80-84 19.759999999999998 28.615000000000002 28.15 23.474999999999998 85-89 20.43 28.299999999999997 27.66 23.61 90-94 20.4 28.365000000000002 28.065 23.169999999999998 95-99 20.43 28.035 27.615000000000002 23.919999999999998 100-104 20.78 29.025000000000002 27.01 23.185 105-109 20.880000000000003 28.365000000000002 27.765 22.99 110-114 20.125 28.384999999999998 27.765 23.724999999999998 115-119 20.294999999999998 28.205000000000002 27.67 23.830000000000002 120-124 20.745 27.939999999999998 27.36 23.955000000000002 125-129 20.915 28.155 27.325 23.605 130-134 20.45 28.494999999999997 27.105 23.95 135-139 20.655 28.665000000000003 27.325 23.355 140-144 20.995 27.395000000000003 27.37 24.240000000000002 145-149 20.94 28.349999999999998 27.35 23.36 150-151 21.5625 27.987499999999997 26.9625 23.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 3.0 27 5.5 28 7.5 29 10.0 30 15.5 31 17.0 32 24.0 33 35.0 34 41.5 35 55.0 36 76.0 37 99.5 38 128.0 39 166.5 40 205.0 41 219.5 42 246.0 43 278.0 44 289.5 45 306.0 46 312.5 47 285.0 48 235.0 49 202.0 50 178.0 51 144.5 52 103.0 53 81.0 54 61.5 55 45.5 56 41.0 57 25.0 58 17.5 59 13.0 60 6.5 61 2.5 62 2.0 63 2.5 64 1.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.19306540583136 90.60000000000001 2 4.570527974783293 8.7 3 0.21013921723141582 0.6 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.7750000000000004 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGCAG 10 0.006830828 145.0 1 ATTCAAG 10 0.006830828 145.0 145 CTTTTTC 10 0.006830828 145.0 7 >>END_MODULE SRR12161467 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.148 37.0 37.0 37.0 37.0 37.0 2 35.9365 37.0 37.0 37.0 37.0 37.0 3 36.0125 37.0 37.0 37.0 37.0 37.0 4 36.0065 37.0 37.0 37.0 37.0 37.0 5 36.04 37.0 37.0 37.0 37.0 37.0 6 35.962 37.0 37.0 37.0 37.0 37.0 7 35.9975 37.0 37.0 37.0 37.0 37.0 8 36.1015 37.0 37.0 37.0 37.0 37.0 9 36.147 37.0 37.0 37.0 37.0 37.0 10-14 36.1144 37.0 37.0 37.0 37.0 37.0 15-19 36.130399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.05 37.0 37.0 37.0 37.0 37.0 25-29 35.9898 37.0 37.0 37.0 37.0 37.0 30-34 35.9885 37.0 37.0 37.0 37.0 37.0 35-39 35.9979 37.0 37.0 37.0 37.0 37.0 40-44 35.9094 37.0 37.0 37.0 37.0 37.0 45-49 35.923500000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8549 37.0 37.0 37.0 37.0 37.0 55-59 35.9029 37.0 37.0 37.0 37.0 37.0 60-64 35.8239 37.0 37.0 37.0 37.0 37.0 65-69 35.754000000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.756600000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.6657 37.0 37.0 37.0 37.0 37.0 80-84 35.6579 37.0 37.0 37.0 37.0 37.0 85-89 35.6195 37.0 37.0 37.0 37.0 37.0 90-94 35.565 37.0 37.0 37.0 37.0 37.0 95-99 35.6322 37.0 37.0 37.0 37.0 37.0 100-104 35.5646 37.0 37.0 37.0 37.0 37.0 105-109 35.537800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.46329999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.486900000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4291 37.0 37.0 37.0 37.0 37.0 125-129 35.3332 37.0 37.0 37.0 37.0 37.0 130-134 35.3766 37.0 37.0 37.0 37.0 37.0 135-139 35.216300000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.122499999999995 37.0 37.0 37.0 27.4 37.0 145-149 35.082499999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.83825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 6.0 22 0.0 23 8.0 24 9.0 25 15.0 26 19.0 27 15.0 28 21.0 29 21.0 30 25.0 31 59.0 32 64.0 33 121.0 34 239.0 35 678.0 36 2502.0 37 186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.075 27.200000000000003 9.35 22.375 2 29.425 25.224999999999998 28.449999999999996 16.900000000000002 3 20.200000000000003 28.475 32.25 19.075 4 22.475 35.175 23.674999999999997 18.675 5 23.974999999999998 35.675000000000004 22.525000000000002 17.825 6 20.95 38.675 22.2 18.175 7 19.85 23.625 37.9 18.625 8 20.825 26.224999999999998 29.549999999999997 23.400000000000002 9 22.25 24.875 29.975 22.900000000000002 10-14 23.74 29.585 26.240000000000002 20.435 15-19 22.79 29.13 27.134999999999998 20.945 20-24 22.439999999999998 28.725 27.650000000000002 21.185000000000002 25-29 23.26 28.88 26.965 20.895 30-34 22.485 28.685 27.42 21.41 35-39 22.695 28.04 28.060000000000002 21.205 40-44 22.75 28.37 27.875 21.005 45-49 23.485 28.689999999999998 27.315 20.51 50-54 23.31 27.675 28.205000000000002 20.810000000000002 55-59 23.005 28.78 27.77 20.445 60-64 22.945 27.96 28.26 20.835 65-69 23.49 28.005000000000003 27.63 20.875 70-74 23.51 28.37 27.634999999999998 20.485 75-79 23.974999999999998 27.88 27.685 20.46 80-84 23.375 28.134999999999998 28.095 20.395 85-89 23.52 28.915000000000003 27.339999999999996 20.225 90-94 24.01 28.07 27.27 20.65 95-99 24.0 27.725 28.215 20.06 100-104 23.765 28.62 27.61 20.005 105-109 24.085 28.134999999999998 27.565 20.215 110-114 23.7 28.189999999999998 27.665 20.445 115-119 24.435000000000002 27.96 27.57 20.035 120-124 24.41 28.335 27.29 19.965 125-129 23.849999999999998 28.49 27.415 20.244999999999997 130-134 24.135 28.384999999999998 27.485 19.994999999999997 135-139 24.67 28.52 27.33 19.48 140-144 25.069999999999997 28.115000000000002 27.425 19.39 145-149 26.05 27.985 26.784999999999997 19.18 150-151 25.874999999999996 27.487499999999997 27.1625 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 3.0 26 3.0 27 3.5 28 5.5 29 6.5 30 8.5 31 13.5 32 19.5 33 29.5 34 40.5 35 60.5 36 78.5 37 99.5 38 130.5 39 172.5 40 211.0 41 246.0 42 275.5 43 290.0 44 296.5 45 316.0 46 309.0 47 263.5 48 240.0 49 194.0 50 151.0 51 130.0 52 106.0 53 87.5 54 59.0 55 39.0 56 32.5 57 23.5 58 15.5 59 9.0 60 6.0 61 2.0 62 1.0 63 2.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30961791831358 90.425 2 4.374176548089592 8.3 3 0.21080368906455862 0.6 4 0.026350461133069828 0.1 5 0.026350461133069828 0.125 6 0.0 0.0 7 0.026350461133069828 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026350461133069828 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 11 0.27499999999999997 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9750000000000001 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCT 10 0.006830828 145.0 8 >>END_MODULE Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra Read 1692851 spots for SRR12161467.sra Written 1692851 spots for SRR12161467.sra SRR ids: ['SRR12161467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_obe_1q4e SRR12161467.sra spots: 33857020 blocks: [[1, 1692851], [1692852, 3385702], [3385703, 5078553], [5078554, 6771404], [6771405, 8464255], [8464256, 10157106], [10157107, 11849957], [11849958, 13542808], [13542809, 15235659], [15235660, 16928510], [16928511, 18621361], [18621362, 20314212], [20314213, 22007063], [22007064, 23699914], [23699915, 25392765], [25392766, 27085616], [27085617, 28778467], [28778468, 30471318], [30471319, 32164169], [32164170, 33857020]] SRR12161467 file size 11484396 SRR12161467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161467 SRR12161467_1.fastq SRR12161467_2.fastq Input file: SRR12161467_1.fastq Paired file: SRR12161467_2.fastq trimmed: SRR12161467-trimmed-pair1.fastq, SRR12161467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:25:42 2025 >> started Thu Feb 13 18:26:18 2025 >> done (35.633s) 33857020 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 8603 ( 0.03%) empty read pairs filtered out after trimming by size control 33848335 (99.97%) read pairs available; of these: 2905208 ( 8.58%) trimmed read pairs available after processing 30943127 (91.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 11 0.00% 20 12 0.00% 21 14 0.00% 22 19 0.00% 23 27 0.00% 24 28 0.00% 25 39 0.00% 26 39 0.00% 27 52 0.00% 28 31 0.00% 29 33 0.00% 30 64 0.00% 31 40 0.00% 32 43 0.00% 33 42 0.00% 34 58 0.00% 35 52 0.00% 36 62 0.00% 37 52 0.00% 38 74 0.00% 39 71 0.00% 40 71 0.00% 41 69 0.00% 42 71 0.00% 43 73 0.00% 44 83 0.00% 45 78 0.00% 46 94 0.00% 47 98 0.00% 48 103 0.00% 49 113 0.00% 50 150 0.00% 51 150 0.00% 52 142 0.00% 53 156 0.00% 54 162 0.00% 55 179 0.00% 56 169 0.00% 57 233 0.00% 58 223 0.00% 59 284 0.00% 60 281 0.00% 61 327 0.00% 62 387 0.00% 63 384 0.00% 64 455 0.00% 65 450 0.00% 66 475 0.00% 67 540 0.00% 68 565 0.00% 69 673 0.00% 70 731 0.00% 71 870 0.00% 72 1006 0.00% 73 1092 0.00% 74 1244 0.00% 75 1380 0.00% 76 1451 0.00% 77 1637 0.00% 78 1730 0.01% 79 1989 0.01% 80 2368 0.01% 81 2612 0.01% 82 2914 0.01% 83 3438 0.01% 84 3841 0.01% 85 4322 0.01% 86 4523 0.01% 87 4885 0.01% 88 5340 0.02% 89 5766 0.02% 90 6521 0.02% 91 7208 0.02% 92 8072 0.02% 93 9151 0.03% 94 10054 0.03% 95 10738 0.03% 96 11679 0.03% 97 12647 0.04% 98 13242 0.04% 99 14243 0.04% 100 15233 0.05% 101 16291 0.05% 102 18054 0.05% 103 19722 0.06% 104 20995 0.06% 105 22414 0.07% 106 23570 0.07% 107 24348 0.07% 108 25998 0.08% 109 26988 0.08% 110 28774 0.09% 111 29838 0.09% 112 31325 0.09% 113 32695 0.10% 114 35574 0.11% 115 37440 0.11% 116 38708 0.11% 117 39729 0.12% 118 40979 0.12% 119 42476 0.13% 120 43773 0.13% 121 46275 0.14% 122 47334 0.14% 123 49785 0.15% 124 52685 0.16% 125 53844 0.16% 126 56250 0.17% 127 57661 0.17% 128 60200 0.18% 129 59419 0.18% 130 60778 0.18% 131 61892 0.18% 132 64398 0.19% 133 67373 0.20% 134 69571 0.21% 135 71907 0.21% 136 72731 0.21% 137 73792 0.22% 138 75600 0.22% 139 76044 0.22% 140 78451 0.23% 141 79092 0.23% 142 80676 0.24% 143 82923 0.24% 144 86299 0.25% 145 88915 0.26% 146 88977 0.26% 147 89882 0.27% 148 90154 0.27% 149 90629 0.27% 150 91949 0.27% 151 30943127 91.42% 33848335 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=18 prefix-density=1.32 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=30.14 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.5 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=15 prefix-density=1.47 prefix-fanout=2.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=113.24 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.6 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGA SRR12161467 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:27:02 Started mapping on | Feb 13 18:27:02 Finished on | Feb 13 18:30:20 Mapping speed, Million of reads per hour | 615.42 Number of input reads | 33848335 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 31751303 Uniquely mapped reads % | 93.80% Average mapped length | 296.84 Number of splices: Total | 33253380 Number of splices: Annotated (sjdb) | 32522205 Number of splices: GT/AG | 32723547 Number of splices: GC/AG | 412417 Number of splices: AT/AC | 29898 Number of splices: Non-canonical | 87518 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 880237 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 34796 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1216795 1216795 1216795 N_multimapping 880237 880237 880237 N_noFeature 855375 31488981 978748 N_ambiguous 333702 1538 193979 UnstrandedReadsAssigned:30562226 PositiveStrandReadsAssigned:260784 NegativeStrandReadsAssigned:30578576 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161467-trimmed-pair1.fastq SRR12161467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,848,335 reads, 30,435,015 reads pseudoaligned [quant] estimated average fragment length: 259.731 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12161467.ke.tsv 34699 SRR12161467.se.tsv 87100 total ==> SRR12161467.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.27 3939 66.4724 Potri.005G024800.1.v4.1 1035 776.269 893 34.1528 Potri.004G059700.1.v4.1 961 702.404 184 7.77712 Potri.007G009000.2.v4.1 1416 1157.27 0 0 Potri.003G141000.2.v4.1 2943 2684.27 1513.23 16.7366 Potri.016G087400.1.v4.1 270 80.1755 1594.53 590.443 Potri.015G069301.1.v4.1 564 316.796 0 0 Potri.010G195200.1.v4.1 1773 1514.27 430.962 8.44936 Potri.012G127500.1.v4.1 977 718.34 9005 372.17 ==> SRR12161467.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 813 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2179 SRR12161467 completed mapping pipeline successfully