Starting /dee2/code/volunteer_pipeline.sh SRR12161468 current disk space = 3088176816128 free memory = 1582568600 SRR12161468 SRAfilesize 6ef1afe6ccbcb0e0eb2d0646e461c64f SRR12161468.sra SRR12161468.sra file validated SRR12161468 is paired end SRR12161468 is conventional basespace SRR12161468 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5265 37.0 37.0 37.0 37.0 37.0 2 36.4035 37.0 37.0 37.0 37.0 37.0 3 36.5245 37.0 37.0 37.0 37.0 37.0 4 36.583 37.0 37.0 37.0 37.0 37.0 5 36.5685 37.0 37.0 37.0 37.0 37.0 6 36.578 37.0 37.0 37.0 37.0 37.0 7 36.4555 37.0 37.0 37.0 37.0 37.0 8 36.3785 37.0 37.0 37.0 37.0 37.0 9 36.4775 37.0 37.0 37.0 37.0 37.0 10-14 36.5476 37.0 37.0 37.0 37.0 37.0 15-19 36.4741 37.0 37.0 37.0 37.0 37.0 20-24 36.4816 37.0 37.0 37.0 37.0 37.0 25-29 36.3998 37.0 37.0 37.0 37.0 37.0 30-34 36.422200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3463 37.0 37.0 37.0 37.0 37.0 40-44 36.329 37.0 37.0 37.0 37.0 37.0 45-49 36.37650000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.31660000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2691 37.0 37.0 37.0 37.0 37.0 60-64 36.2419 37.0 37.0 37.0 37.0 37.0 65-69 36.2341 37.0 37.0 37.0 37.0 37.0 70-74 36.2062 37.0 37.0 37.0 37.0 37.0 75-79 36.169200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1524 37.0 37.0 37.0 37.0 37.0 85-89 36.0841 37.0 37.0 37.0 37.0 37.0 90-94 36.1006 37.0 37.0 37.0 37.0 37.0 95-99 36.0954 37.0 37.0 37.0 37.0 37.0 100-104 36.004999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9973 37.0 37.0 37.0 37.0 37.0 110-114 35.9425 37.0 37.0 37.0 37.0 37.0 115-119 36.0142 37.0 37.0 37.0 37.0 37.0 120-124 36.0256 37.0 37.0 37.0 37.0 37.0 125-129 35.9261 37.0 37.0 37.0 37.0 37.0 130-134 35.847699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.72330000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8098 37.0 37.0 37.0 37.0 37.0 145-149 35.7958 37.0 37.0 37.0 37.0 37.0 150-151 35.59325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 4.0 26 5.0 27 9.0 28 22.0 29 24.0 30 25.0 31 42.0 32 55.0 33 87.0 34 121.0 35 321.0 36 2955.0 37 326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.33733733733734 11.586586586586586 7.807807807807808 43.268268268268265 2 19.825 12.85 37.075 30.25 3 17.349999999999998 15.9 28.925 37.824999999999996 4 21.475 23.75 24.175 30.599999999999998 5 23.200000000000003 29.525000000000002 24.4 22.875 6 20.45 33.275 24.9 21.375 7 16.375 26.575 40.875 16.175 8 18.25 26.55 31.55 23.65 9 17.05 23.724999999999998 36.25 22.975 10-14 19.455 29.580000000000002 28.494999999999997 22.470000000000002 15-19 19.915 28.22 28.315 23.549999999999997 20-24 19.285 28.560000000000002 28.765 23.39 25-29 19.38 29.195 28.215 23.21 30-34 20.080000000000002 28.325 28.444999999999997 23.150000000000002 35-39 19.46 28.349999999999998 28.935 23.255 40-44 19.925 28.26 27.805000000000003 24.01 45-49 19.73 27.985 28.439999999999998 23.845 50-54 19.439999999999998 28.660000000000004 27.51 24.39 55-59 20.015 28.73 27.37 23.885 60-64 19.634999999999998 29.25 27.27 23.845 65-69 19.165 28.74 28.49 23.605 70-74 19.869999999999997 28.299999999999997 27.91 23.919999999999998 75-79 19.645000000000003 28.294999999999998 28.04 24.02 80-84 19.785 28.465 27.655 24.095 85-89 19.915 27.6 28.665000000000003 23.82 90-94 19.48 29.04 27.865000000000002 23.615 95-99 19.355 28.645 27.994999999999997 24.005000000000003 100-104 20.315 29.015 27.92 22.75 105-109 20.235 28.189999999999998 27.915 23.66 110-114 19.78 28.410000000000004 28.015 23.794999999999998 115-119 20.095 28.205000000000002 28.425 23.275000000000002 120-124 20.395 28.449999999999996 27.77 23.385 125-129 20.465 28.16 27.279999999999998 24.095 130-134 20.415 29.39 26.674999999999997 23.52 135-139 20.815 28.005000000000003 27.37 23.810000000000002 140-144 20.18 28.694999999999997 27.825 23.3 145-149 20.330000000000002 28.79 27.405 23.474999999999998 150-151 19.9125 29.575000000000003 26.674999999999997 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 2.0 24 2.5 25 1.5 26 2.0 27 6.0 28 9.5 29 8.5 30 11.5 31 22.0 32 33.0 33 46.0 34 55.0 35 68.5 36 88.5 37 103.5 38 124.5 39 169.0 40 211.5 41 229.0 42 247.0 43 276.0 44 291.0 45 292.0 46 286.5 47 258.0 48 225.0 49 200.0 50 172.5 51 144.0 52 120.0 53 90.5 54 66.5 55 49.0 56 32.5 57 21.0 58 10.0 59 6.5 60 6.5 61 3.0 62 1.0 63 1.0 64 0.5 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15825809877855 88.64999999999999 2 5.469994689325544 10.299999999999999 3 0.37174721189591076 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCCGC 10 0.006830828 145.0 1 TTCAAAT 10 0.006830828 145.0 7 >>END_MODULE SRR12161468 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.253 37.0 37.0 37.0 37.0 37.0 2 35.905 37.0 37.0 37.0 37.0 37.0 3 36.0845 37.0 37.0 37.0 37.0 37.0 4 36.0175 37.0 37.0 37.0 37.0 37.0 5 36.134 37.0 37.0 37.0 37.0 37.0 6 36.0535 37.0 37.0 37.0 37.0 37.0 7 36.0995 37.0 37.0 37.0 37.0 37.0 8 36.112 37.0 37.0 37.0 37.0 37.0 9 36.2045 37.0 37.0 37.0 37.0 37.0 10-14 36.2297 37.0 37.0 37.0 37.0 37.0 15-19 36.2219 37.0 37.0 37.0 37.0 37.0 20-24 36.15 37.0 37.0 37.0 37.0 37.0 25-29 36.1052 37.0 37.0 37.0 37.0 37.0 30-34 36.1502 37.0 37.0 37.0 37.0 37.0 35-39 36.055899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.011 37.0 37.0 37.0 37.0 37.0 45-49 36.0576 37.0 37.0 37.0 37.0 37.0 50-54 35.933400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.90259999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.858000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.843599999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8603 37.0 37.0 37.0 37.0 37.0 75-79 35.813399999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.76639999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.765100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.723 37.0 37.0 37.0 37.0 37.0 95-99 35.7328 37.0 37.0 37.0 37.0 37.0 100-104 35.688 37.0 37.0 37.0 37.0 37.0 105-109 35.6515 37.0 37.0 37.0 37.0 37.0 110-114 35.5503 37.0 37.0 37.0 37.0 37.0 115-119 35.6086 37.0 37.0 37.0 37.0 37.0 120-124 35.5148 37.0 37.0 37.0 37.0 37.0 125-129 35.5128 37.0 37.0 37.0 37.0 37.0 130-134 35.4431 37.0 37.0 37.0 37.0 37.0 135-139 35.464800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.311099999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.30210000000001 37.0 37.0 37.0 34.6 37.0 150-151 34.80175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 0.0 16 0.0 17 0.0 18 2.0 19 0.0 20 2.0 21 3.0 22 3.0 23 4.0 24 6.0 25 6.0 26 13.0 27 8.0 28 18.0 29 28.0 30 36.0 31 50.0 32 63.0 33 126.0 34 222.0 35 589.0 36 2581.0 37 234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.025 22.225 12.15 29.599999999999998 2 27.35 26.724999999999998 30.525000000000002 15.4 3 20.1 28.449999999999996 31.75 19.7 4 23.575 32.550000000000004 24.55 19.325 5 25.55 35.325 22.375 16.75 6 21.875 37.65 23.25 17.224999999999998 7 20.150000000000002 21.425 38.324999999999996 20.1 8 19.825 27.0 29.95 23.225 9 22.175 24.45 30.875000000000004 22.5 10-14 23.655 28.42 27.505000000000003 20.419999999999998 15-19 23.325000000000003 28.275 27.83 20.57 20-24 23.18 28.705000000000002 27.85 20.265 25-29 23.21 28.335 27.91 20.544999999999998 30-34 23.02 27.560000000000002 28.485 20.935000000000002 35-39 22.509999999999998 27.994999999999997 28.57 20.925 40-44 22.18 28.34 28.860000000000003 20.62 45-49 23.305 27.445000000000004 28.810000000000002 20.44 50-54 22.825 28.565 28.384999999999998 20.225 55-59 23.555 29.104999999999997 27.339999999999996 20.0 60-64 22.915 28.17 28.465 20.45 65-69 22.685 28.07 28.46 20.785 70-74 24.0 27.965 28.205000000000002 19.830000000000002 75-79 23.29 28.27 27.994999999999997 20.445 80-84 23.76 28.475 27.815 19.950000000000003 85-89 23.9 28.449999999999996 27.615000000000002 20.035 90-94 23.945 28.444999999999997 27.689999999999998 19.919999999999998 95-99 23.525 28.575 27.544999999999998 20.355 100-104 24.095 28.655 27.51 19.74 105-109 24.165 28.315 27.650000000000002 19.869999999999997 110-114 24.099999999999998 28.305000000000003 27.529999999999998 20.064999999999998 115-119 23.79 28.08 27.584999999999997 20.544999999999998 120-124 23.62 28.08 28.23 20.07 125-129 24.279999999999998 27.97 27.689999999999998 20.06 130-134 24.315 28.485 27.705000000000002 19.495 135-139 24.675 28.515 26.965 19.845 140-144 24.490000000000002 28.33 27.055 20.125 145-149 25.264999999999997 28.494999999999997 26.634999999999998 19.605 150-151 25.324999999999996 28.975 26.900000000000002 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 3.5 25 4.5 26 5.0 27 4.5 28 5.0 29 10.0 30 12.5 31 12.0 32 24.5 33 37.5 34 48.5 35 65.5 36 87.5 37 112.0 38 138.0 39 168.5 40 195.0 41 234.5 42 276.5 43 303.5 44 313.0 45 301.0 46 289.5 47 277.5 48 233.0 49 182.5 50 162.5 51 131.5 52 91.5 53 76.5 54 58.5 55 33.5 56 28.5 57 23.0 58 9.5 59 6.0 60 7.0 61 3.5 62 1.5 63 1.5 64 0.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06599254922831 88.375 2 5.481639169771155 10.299999999999999 3 0.3991484832357637 1.125 4 0.05321979776476849 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.725 0.0 0.0 0.0 0.0 134-135 4.2125 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAAC 10 0.006830828 145.0 6 TTTTTTT 20 0.00593511 29.0 135-139 >>END_MODULE Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810481 spots for SRR12161468.sra Written 1810481 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra Read 1810462 spots for SRR12161468.sra Written 1810462 spots for SRR12161468.sra SRR ids: ['SRR12161468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zaks15xj SRR12161468.sra spots: 36209259 blocks: [[1, 1810462], [1810463, 3620924], [3620925, 5431386], [5431387, 7241848], [7241849, 9052310], [9052311, 10862772], [10862773, 12673234], [12673235, 14483696], [14483697, 16294158], [16294159, 18104620], [18104621, 19915082], [19915083, 21725544], [21725545, 23536006], [23536007, 25346468], [25346469, 27156930], [27156931, 28967392], [28967393, 30777854], [30777855, 32588316], [32588317, 34398778], [34398779, 36209259]] SRR12161468 file size 12283789 SRR12161468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161468 SRR12161468_1.fastq SRR12161468_2.fastq Input file: SRR12161468_1.fastq Paired file: SRR12161468_2.fastq trimmed: SRR12161468-trimmed-pair1.fastq, SRR12161468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:28:46 2025 >> started Thu Feb 13 18:29:25 2025 >> done (39.192s) 36209259 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 4347 ( 0.01%) empty read pairs filtered out after trimming by size control 36204858 (99.99%) read pairs available; of these: 2708779 ( 7.48%) trimmed read pairs available after processing 33496079 (92.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 12 0.00% 23 19 0.00% 24 24 0.00% 25 13 0.00% 26 19 0.00% 27 19 0.00% 28 26 0.00% 29 27 0.00% 30 27 0.00% 31 31 0.00% 32 33 0.00% 33 43 0.00% 34 32 0.00% 35 38 0.00% 36 55 0.00% 37 45 0.00% 38 46 0.00% 39 58 0.00% 40 56 0.00% 41 55 0.00% 42 71 0.00% 43 61 0.00% 44 65 0.00% 45 71 0.00% 46 75 0.00% 47 77 0.00% 48 74 0.00% 49 92 0.00% 50 91 0.00% 51 109 0.00% 52 127 0.00% 53 123 0.00% 54 150 0.00% 55 134 0.00% 56 154 0.00% 57 166 0.00% 58 184 0.00% 59 189 0.00% 60 223 0.00% 61 275 0.00% 62 285 0.00% 63 372 0.00% 64 326 0.00% 65 371 0.00% 66 396 0.00% 67 445 0.00% 68 498 0.00% 69 524 0.00% 70 650 0.00% 71 719 0.00% 72 844 0.00% 73 969 0.00% 74 1052 0.00% 75 1114 0.00% 76 1255 0.00% 77 1431 0.00% 78 1566 0.00% 79 1849 0.01% 80 2068 0.01% 81 2339 0.01% 82 2651 0.01% 83 2935 0.01% 84 3362 0.01% 85 3776 0.01% 86 4203 0.01% 87 4474 0.01% 88 4904 0.01% 89 5428 0.01% 90 6061 0.02% 91 6661 0.02% 92 7319 0.02% 93 8093 0.02% 94 9054 0.03% 95 9920 0.03% 96 10559 0.03% 97 11570 0.03% 98 12515 0.03% 99 13175 0.04% 100 14081 0.04% 101 14944 0.04% 102 16270 0.04% 103 18053 0.05% 104 19174 0.05% 105 20342 0.06% 106 22083 0.06% 107 23134 0.06% 108 23905 0.07% 109 25065 0.07% 110 26163 0.07% 111 27551 0.08% 112 28728 0.08% 113 30629 0.08% 114 32147 0.09% 115 34072 0.09% 116 35704 0.10% 117 37137 0.10% 118 38515 0.11% 119 39708 0.11% 120 40809 0.11% 121 42577 0.12% 122 43675 0.12% 123 45487 0.13% 124 47527 0.13% 125 49025 0.14% 126 51674 0.14% 127 53272 0.15% 128 55069 0.15% 129 55840 0.15% 130 56958 0.16% 131 59043 0.16% 132 60418 0.17% 133 62489 0.17% 134 63879 0.18% 135 65710 0.18% 136 67458 0.19% 137 69054 0.19% 138 71308 0.20% 139 72561 0.20% 140 73669 0.20% 141 75161 0.21% 142 77364 0.21% 143 77604 0.21% 144 80430 0.22% 145 82697 0.23% 146 83693 0.23% 147 85052 0.23% 148 86497 0.24% 149 87405 0.24% 150 89026 0.25% 151 33496079 92.52% 36204858 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.58 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=28.09 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=7.0 sequence=TCTTCTCATCAAGGCTTCCAGAACTTCCAAAGAAGATGATTCCGGAAGTACGAAATCTAAGCAAGAGAATTTGCACAGCTGTAGCCACATTTACTGAGTGACTCCCGGTCTTAACATATATAATAAGGCTATTGTTAAGTGTTCCAATATGGAACCTTCTTCCGGCAATGTCAACAGAAGGATTTTCACTGTCAGGCTCATAAAGACCAGAGTCTAGAAGAGCCTTTTCGTTGTTATCAGAGGTAAAAACAAGGCCTAAGCGAAGGAATGCAATTTTGCAATTGCTTGTCTCAATCTCAGCTGTAGGGTTTCTCAAACTCATCTGCATGGACTGCTGTGCCGTAACCAACAGCAGCCCAAGCACCAGCAGTACTGCCAAATTGATACTCGACATTGTGTGAAGTGGATTGAGCAGACGGATAGTACTTTAGAAA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=18 prefix-density=1.00 prefix-fanout=2.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=67.77 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.4 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT SRR12161468 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:30:09 Started mapping on | Feb 13 18:30:10 Finished on | Feb 13 18:34:06 Mapping speed, Million of reads per hour | 552.28 Number of input reads | 36204858 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 34425965 Uniquely mapped reads % | 95.09% Average mapped length | 297.52 Number of splices: Total | 36299095 Number of splices: Annotated (sjdb) | 35517756 Number of splices: GT/AG | 35719268 Number of splices: GC/AG | 458646 Number of splices: AT/AC | 30846 Number of splices: Non-canonical | 90335 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 912349 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 38216 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 866544 866544 866544 N_multimapping 912349 912349 912349 N_noFeature 965894 34144350 1088570 N_ambiguous 368165 1663 208451 UnstrandedReadsAssigned:33091906 PositiveStrandReadsAssigned:279952 NegativeStrandReadsAssigned:33128944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161468-trimmed-pair1.fastq SRR12161468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,204,858 reads, 32,902,642 reads pseudoaligned [quant] estimated average fragment length: 268.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR12161468.ke.tsv 34699 SRR12161468.se.tsv 87100 total ==> SRR12161468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.77 3419.51 55.8536 Potri.005G024800.1.v4.1 1035 767.77 722 26.892 Potri.004G059700.1.v4.1 961 693.89 84 3.46182 Potri.007G009000.2.v4.1 1416 1148.77 0 0 Potri.003G141000.2.v4.1 2943 2675.77 1514 16.1806 Potri.016G087400.1.v4.1 270 77.3265 1922.52 710.982 Potri.015G069301.1.v4.1 564 308.781 0 0 Potri.010G195200.1.v4.1 1773 1505.77 549 10.4263 Potri.012G127500.1.v4.1 977 709.822 8034 323.667 ==> SRR12161468.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 121 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 851 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1640 SRR12161468 completed mapping pipeline successfully