Starting /dee2/code/volunteer_pipeline.sh SRR12161469 current disk space = 3087978463232 free memory = 1582590580 SRR12161469 SRAfilesize 638b3134b8b0a247d8faedc3ae0d27ff SRR12161469.sra SRR12161469.sra file validated SRR12161469 is paired end SRR12161469 is conventional basespace SRR12161469 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3715 37.0 37.0 37.0 37.0 37.0 2 36.342 37.0 37.0 37.0 37.0 37.0 3 36.475 37.0 37.0 37.0 37.0 37.0 4 36.5145 37.0 37.0 37.0 37.0 37.0 5 36.492 37.0 37.0 37.0 37.0 37.0 6 36.577 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.3675 37.0 37.0 37.0 37.0 37.0 9 36.4835 37.0 37.0 37.0 37.0 37.0 10-14 36.5044 37.0 37.0 37.0 37.0 37.0 15-19 36.4684 37.0 37.0 37.0 37.0 37.0 20-24 36.4915 37.0 37.0 37.0 37.0 37.0 25-29 36.4482 37.0 37.0 37.0 37.0 37.0 30-34 36.37500000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3351 37.0 37.0 37.0 37.0 37.0 40-44 36.3448 37.0 37.0 37.0 37.0 37.0 45-49 36.2873 37.0 37.0 37.0 37.0 37.0 50-54 36.3167 37.0 37.0 37.0 37.0 37.0 55-59 36.253 37.0 37.0 37.0 37.0 37.0 60-64 36.2417 37.0 37.0 37.0 37.0 37.0 65-69 36.196400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1982 37.0 37.0 37.0 37.0 37.0 75-79 36.1909 37.0 37.0 37.0 37.0 37.0 80-84 36.0987 37.0 37.0 37.0 37.0 37.0 85-89 36.075300000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.0987 37.0 37.0 37.0 37.0 37.0 95-99 36.10719999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9867 37.0 37.0 37.0 37.0 37.0 105-109 36.0236 37.0 37.0 37.0 37.0 37.0 110-114 35.88289999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.9567 37.0 37.0 37.0 37.0 37.0 120-124 36.0001 37.0 37.0 37.0 37.0 37.0 125-129 35.9435 37.0 37.0 37.0 37.0 37.0 130-134 35.8135 37.0 37.0 37.0 37.0 37.0 135-139 35.782 37.0 37.0 37.0 37.0 37.0 140-144 35.6719 37.0 37.0 37.0 37.0 37.0 145-149 35.638400000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.3995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 1.0 25 1.0 26 8.0 27 12.0 28 19.0 29 19.0 30 28.0 31 52.0 32 53.0 33 93.0 34 132.0 35 349.0 36 2934.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.21342685370742 11.998997995991983 7.3146292585170345 36.47294589178357 2 21.85 12.8 33.300000000000004 32.05 3 17.125 16.575 29.2 37.1 4 21.099999999999998 24.375 25.224999999999998 29.299999999999997 5 23.625 29.775000000000002 24.825 21.775 6 21.0 33.95 23.45 21.6 7 14.625 27.950000000000003 40.575 16.85 8 17.599999999999998 26.625 31.974999999999998 23.799999999999997 9 17.325 24.8 33.6 24.275 10-14 19.935 30.03 27.73 22.305 15-19 20.175 28.525 27.61 23.69 20-24 19.744999999999997 28.610000000000003 27.915 23.73 25-29 19.38 28.360000000000003 28.155 24.104999999999997 30-34 20.28 28.799999999999997 27.725 23.195 35-39 19.845 27.925 28.410000000000004 23.82 40-44 19.81 28.96 27.894999999999996 23.335 45-49 19.580000000000002 28.470000000000002 28.015 23.935000000000002 50-54 20.34 28.08 28.16 23.419999999999998 55-59 19.57 28.84 27.584999999999997 24.005000000000003 60-64 19.830000000000002 28.439999999999998 27.91 23.82 65-69 20.195 28.09 28.215 23.5 70-74 19.61 28.194999999999997 28.689999999999998 23.505000000000003 75-79 20.005 28.03 28.29 23.674999999999997 80-84 20.169999999999998 28.655 27.42 23.755000000000003 85-89 20.0 28.144999999999996 28.244999999999997 23.61 90-94 20.575 27.189999999999998 28.255000000000003 23.98 95-99 20.185 28.465 28.27 23.080000000000002 100-104 20.79 28.694999999999997 26.939999999999998 23.575 105-109 20.775 28.860000000000003 27.474999999999998 22.89 110-114 20.305 28.560000000000002 28.125 23.01 115-119 20.68 28.15 27.68 23.49 120-124 21.029999999999998 27.98 27.29 23.7 125-129 20.74 28.335 27.07 23.855 130-134 21.060000000000002 28.110000000000003 27.735 23.095 135-139 21.015 28.07 26.99 23.925 140-144 20.94 28.29 27.01 23.76 145-149 21.365000000000002 28.634999999999998 26.555 23.445 150-151 21.4125 28.375 26.700000000000003 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 4.0 26 4.5 27 4.5 28 7.5 29 13.5 30 17.0 31 20.0 32 28.5 33 39.5 34 48.5 35 60.5 36 74.0 37 92.0 38 124.5 39 169.5 40 207.0 41 233.5 42 265.5 43 273.5 44 274.0 45 274.5 46 269.5 47 260.5 48 239.5 49 204.5 50 168.0 51 158.5 52 133.0 53 92.0 54 69.5 55 52.0 56 30.0 57 24.5 58 22.0 59 10.5 60 7.0 61 6.0 62 3.5 63 2.5 64 1.5 65 0.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.06432134418482 90.525 2 4.88317143607246 9.3 3 0.026253609871357313 0.075 4 0.026253609871357313 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.2125000000000004 0.0 0.0 0.0 0.0 112-113 2.525 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.6125 0.0 0.0 0.0 0.0 126-127 5.175000000000001 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.4 0.0 0.0 0.0 0.0 136-137 7.949999999999999 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161469 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.175 37.0 37.0 37.0 37.0 37.0 2 35.927 37.0 37.0 37.0 37.0 37.0 3 36.0295 37.0 37.0 37.0 37.0 37.0 4 36.136 37.0 37.0 37.0 37.0 37.0 5 36.1065 37.0 37.0 37.0 37.0 37.0 6 36.0115 37.0 37.0 37.0 37.0 37.0 7 36.0975 37.0 37.0 37.0 37.0 37.0 8 36.1345 37.0 37.0 37.0 37.0 37.0 9 36.2375 37.0 37.0 37.0 37.0 37.0 10-14 36.1375 37.0 37.0 37.0 37.0 37.0 15-19 36.0635 37.0 37.0 37.0 37.0 37.0 20-24 36.0598 37.0 37.0 37.0 37.0 37.0 25-29 35.948699999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.9259 37.0 37.0 37.0 37.0 37.0 35-39 35.886799999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.816 37.0 37.0 37.0 37.0 37.0 45-49 35.8593 37.0 37.0 37.0 37.0 37.0 50-54 35.8172 37.0 37.0 37.0 37.0 37.0 55-59 35.839 37.0 37.0 37.0 37.0 37.0 60-64 35.7128 37.0 37.0 37.0 37.0 37.0 65-69 35.65410000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.644 37.0 37.0 37.0 37.0 37.0 75-79 35.625 37.0 37.0 37.0 37.0 37.0 80-84 35.6416 37.0 37.0 37.0 37.0 37.0 85-89 35.5628 37.0 37.0 37.0 37.0 37.0 90-94 35.561099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.488299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.5242 37.0 37.0 37.0 37.0 37.0 105-109 35.4701 37.0 37.0 37.0 37.0 37.0 110-114 35.472300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3728 37.0 37.0 37.0 37.0 37.0 120-124 35.3703 37.0 37.0 37.0 37.0 37.0 125-129 35.2096 37.0 37.0 37.0 32.2 37.0 130-134 35.1672 37.0 37.0 37.0 32.2 37.0 135-139 35.0146 37.0 37.0 37.0 25.0 37.0 140-144 34.943200000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.8424 37.0 37.0 37.0 25.0 37.0 150-151 34.3375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 2.0 14 8.0 15 6.0 16 7.0 17 4.0 18 3.0 19 2.0 20 4.0 21 7.0 22 4.0 23 11.0 24 11.0 25 11.0 26 10.0 27 17.0 28 18.0 29 23.0 30 28.0 31 50.0 32 69.0 33 118.0 34 235.0 35 559.0 36 2595.0 37 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.349999999999994 24.975 9.825000000000001 23.849999999999998 2 27.275 27.200000000000003 29.299999999999997 16.225 3 21.575 27.625 32.15 18.65 4 24.7 33.6 23.400000000000002 18.3 5 25.525 35.975 21.025 17.474999999999998 6 20.724999999999998 38.6 23.275000000000002 17.4 7 21.099999999999998 22.1 38.574999999999996 18.224999999999998 8 23.1 25.025 28.499999999999996 23.375 9 22.650000000000002 23.825 30.625000000000004 22.900000000000002 10-14 23.599999999999998 29.659999999999997 25.96 20.78 15-19 23.169999999999998 28.544999999999998 27.11 21.175 20-24 22.755 29.189999999999998 27.05 21.005 25-29 23.765 28.32 26.995 20.919999999999998 30-34 23.05 27.950000000000003 28.560000000000002 20.44 35-39 22.7 28.799999999999997 27.685 20.815 40-44 23.205000000000002 28.515 27.515 20.765 45-49 22.36 28.92 27.810000000000002 20.91 50-54 23.105 28.084999999999997 28.225 20.585 55-59 23.445 28.535 27.889999999999997 20.13 60-64 22.775000000000002 28.655 27.93 20.64 65-69 23.57 28.73 27.505000000000003 20.195 70-74 23.68 27.54 28.4 20.380000000000003 75-79 23.369999999999997 28.655 27.79 20.185 80-84 23.64 28.139999999999997 27.694999999999997 20.525 85-89 23.150000000000002 28.799999999999997 27.97 20.080000000000002 90-94 24.3 29.065 26.795 19.84 95-99 24.349999999999998 29.235 26.815 19.6 100-104 24.065 29.15 26.8 19.985 105-109 24.265 28.29 27.389999999999997 20.055 110-114 24.095 28.849999999999998 27.165 19.89 115-119 24.7 28.249999999999996 27.389999999999997 19.66 120-124 24.765 28.439999999999998 26.884999999999998 19.91 125-129 24.68 28.994999999999997 26.845000000000002 19.48 130-134 25.674999999999997 28.355000000000004 26.745 19.225 135-139 25.619999999999997 28.54 26.66 19.18 140-144 26.21 28.1 26.169999999999998 19.52 145-149 26.61 28.134999999999998 26.400000000000002 18.855 150-151 26.724999999999998 28.425 26.0375 18.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 1.5 7 2.0 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 2.0 16 2.0 17 2.5 18 2.5 19 2.0 20 2.0 21 1.5 22 2.0 23 1.0 24 0.5 25 1.0 26 0.5 27 2.5 28 5.5 29 10.0 30 17.0 31 21.0 32 26.0 33 35.5 34 45.0 35 62.0 36 92.5 37 115.5 38 129.0 39 154.5 40 198.0 41 243.0 42 275.0 43 292.0 44 295.5 45 288.0 46 266.5 47 245.5 48 236.0 49 212.0 50 163.0 51 123.5 52 105.5 53 83.5 54 56.0 55 41.0 56 31.5 57 24.5 58 18.0 59 10.5 60 6.5 61 2.5 62 0.5 63 1.5 64 2.0 65 2.0 66 2.0 67 1.0 68 1.5 69 2.0 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 1.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.5 92 1.0 93 1.5 94 1.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.14895860796203 90.225 2 4.640126548905879 8.799999999999999 3 0.10545742156604272 0.3 4 0.05272871078302136 0.2 5 0.0 0.0 6 0.02636435539151068 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02636435539151068 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5374999999999996 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.225 0.0 0.0 0.0 0.0 128-129 5.925000000000001 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.55 0.0 0.0 0.0 0.0 136-137 8.1 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra Read 1923591 spots for SRR12161469.sra Written 1923591 spots for SRR12161469.sra Read 1923588 spots for SRR12161469.sra Written 1923588 spots for SRR12161469.sra SRR ids: ['SRR12161469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rbtpe1n SRR12161469.sra spots: 38471763 blocks: [[1, 1923588], [1923589, 3847176], [3847177, 5770764], [5770765, 7694352], [7694353, 9617940], [9617941, 11541528], [11541529, 13465116], [13465117, 15388704], [15388705, 17312292], [17312293, 19235880], [19235881, 21159468], [21159469, 23083056], [23083057, 25006644], [25006645, 26930232], [26930233, 28853820], [28853821, 30777408], [30777409, 32700996], [32700997, 34624584], [34624585, 36548172], [36548173, 38471763]] SRR12161469 file size 13052687 SRR12161469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161469 SRR12161469_1.fastq SRR12161469_2.fastq Input file: SRR12161469_1.fastq Paired file: SRR12161469_2.fastq trimmed: SRR12161469-trimmed-pair1.fastq, SRR12161469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:36:49 2025 >> started Thu Feb 13 18:37:31 2025 >> done (41.848s) 38471763 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 26624 ( 0.07%) empty read pairs filtered out after trimming by size control 38445044 (99.93%) read pairs available; of these: 5164425 (13.43%) trimmed read pairs available after processing 33280619 (86.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 10 0.00% 21 15 0.00% 22 26 0.00% 23 28 0.00% 24 19 0.00% 25 37 0.00% 26 34 0.00% 27 29 0.00% 28 36 0.00% 29 39 0.00% 30 48 0.00% 31 43 0.00% 32 33 0.00% 33 58 0.00% 34 64 0.00% 35 59 0.00% 36 65 0.00% 37 71 0.00% 38 64 0.00% 39 94 0.00% 40 86 0.00% 41 89 0.00% 42 89 0.00% 43 91 0.00% 44 101 0.00% 45 123 0.00% 46 126 0.00% 47 145 0.00% 48 158 0.00% 49 187 0.00% 50 190 0.00% 51 233 0.00% 52 229 0.00% 53 244 0.00% 54 258 0.00% 55 254 0.00% 56 316 0.00% 57 364 0.00% 58 369 0.00% 59 457 0.00% 60 555 0.00% 61 640 0.00% 62 678 0.00% 63 748 0.00% 64 812 0.00% 65 881 0.00% 66 965 0.00% 67 1080 0.00% 68 1237 0.00% 69 1318 0.00% 70 1643 0.00% 71 1828 0.00% 72 2166 0.01% 73 2371 0.01% 74 2630 0.01% 75 3026 0.01% 76 3307 0.01% 77 3751 0.01% 78 4137 0.01% 79 4702 0.01% 80 5281 0.01% 81 5999 0.02% 82 6863 0.02% 83 7875 0.02% 84 8722 0.02% 85 9746 0.03% 86 10558 0.03% 87 11701 0.03% 88 12605 0.03% 89 13668 0.04% 90 15083 0.04% 91 16756 0.04% 92 18536 0.05% 93 20595 0.05% 94 22663 0.06% 95 24437 0.06% 96 26220 0.07% 97 27942 0.07% 98 29493 0.08% 99 31579 0.08% 100 33744 0.09% 101 36195 0.09% 102 39143 0.10% 103 41735 0.11% 104 44544 0.12% 105 46557 0.12% 106 49320 0.13% 107 51665 0.13% 108 53664 0.14% 109 56038 0.15% 110 57914 0.15% 111 60936 0.16% 112 64548 0.17% 113 66561 0.17% 114 70110 0.18% 115 73565 0.19% 116 75760 0.20% 117 77216 0.20% 118 79961 0.21% 119 80992 0.21% 120 83391 0.22% 121 87020 0.23% 122 89303 0.23% 123 92411 0.24% 124 96143 0.25% 125 98535 0.26% 126 101409 0.26% 127 102522 0.27% 128 105087 0.27% 129 105443 0.27% 130 107119 0.28% 131 109260 0.28% 132 112593 0.29% 133 115032 0.30% 134 118033 0.31% 135 120745 0.31% 136 122436 0.32% 137 122773 0.32% 138 124255 0.32% 139 125414 0.33% 140 127053 0.33% 141 128054 0.33% 142 130552 0.34% 143 132593 0.34% 144 136823 0.36% 145 138687 0.36% 146 139780 0.36% 147 139252 0.36% 148 141272 0.37% 149 140072 0.36% 150 141396 0.37% 151 33280619 86.57% 38445044 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=10.43 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=CCAGTGAGGGTCTTCACAAAGATCTGCAT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=43.64 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.1 sequence=CTCTCTTCTTCT SRR12161469 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:38:55 Started mapping on | Feb 13 18:38:55 Finished on | Feb 13 18:42:18 Mapping speed, Million of reads per hour | 681.78 Number of input reads | 38445044 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 32608606 Uniquely mapped reads % | 84.82% Average mapped length | 291.97 Number of splices: Total | 34502188 Number of splices: Annotated (sjdb) | 33812662 Number of splices: GT/AG | 33945729 Number of splices: GC/AG | 434102 Number of splices: AT/AC | 30908 Number of splices: Non-canonical | 91449 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 882743 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 102093 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.42% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4953695 4953695 4953695 N_multimapping 882743 882743 882743 N_noFeature 822327 32336615 945336 N_ambiguous 497884 3263 347076 UnstrandedReadsAssigned:31288395 PositiveStrandReadsAssigned:268728 NegativeStrandReadsAssigned:31316194 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161469-trimmed-pair1.fastq SRR12161469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,445,044 reads, 34,627,710 reads pseudoaligned [quant] estimated average fragment length: 237.895 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR12161469.ke.tsv 34699 SRR12161469.se.tsv 87100 total ==> SRR12161469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.11 2717.53 45.1431 Potri.005G024800.1.v4.1 1035 798.105 504 18.6843 Potri.004G059700.1.v4.1 961 724.269 84 3.43152 Potri.007G009000.2.v4.1 1416 1179.11 0 0 Potri.003G141000.2.v4.1 2943 2706.11 1406.49 15.3779 Potri.016G087400.1.v4.1 270 92.6477 1900 606.772 Potri.015G069301.1.v4.1 564 337.599 0 0 Potri.010G195200.1.v4.1 1773 1536.11 324 6.24066 Potri.012G127500.1.v4.1 977 740.169 5638 225.372 ==> SRR12161469.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 741 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1282 SRR12161469 completed mapping pipeline successfully