Starting /dee2/code/volunteer_pipeline.sh SRR12161470 current disk space = 3088706486272 free memory = 1464733744 SRR12161470 SRAfilesize bcb62f85eb8bc9116f097ae512458072 SRR12161470.sra SRR12161470.sra file validated SRR12161470 is paired end SRR12161470 is conventional basespace SRR12161470 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52125 37.0 37.0 37.0 37.0 37.0 2 36.429 37.0 37.0 37.0 37.0 37.0 3 36.4845 37.0 37.0 37.0 37.0 37.0 4 36.5245 37.0 37.0 37.0 37.0 37.0 5 36.621 37.0 37.0 37.0 37.0 37.0 6 36.5695 37.0 37.0 37.0 37.0 37.0 7 36.4895 37.0 37.0 37.0 37.0 37.0 8 36.428 37.0 37.0 37.0 37.0 37.0 9 36.3905 37.0 37.0 37.0 37.0 37.0 10-14 36.5026 37.0 37.0 37.0 37.0 37.0 15-19 36.4567 37.0 37.0 37.0 37.0 37.0 20-24 36.450900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4147 37.0 37.0 37.0 37.0 37.0 30-34 36.33969999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3322 37.0 37.0 37.0 37.0 37.0 40-44 36.24679999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2844 37.0 37.0 37.0 37.0 37.0 50-54 36.275600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2247 37.0 37.0 37.0 37.0 37.0 60-64 36.263200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.241600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.18900000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1284 37.0 37.0 37.0 37.0 37.0 80-84 36.1774 37.0 37.0 37.0 37.0 37.0 85-89 36.060900000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.101099999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.064800000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9481 37.0 37.0 37.0 37.0 37.0 105-109 36.0416 37.0 37.0 37.0 37.0 37.0 110-114 35.9563 37.0 37.0 37.0 37.0 37.0 115-119 35.9208 37.0 37.0 37.0 37.0 37.0 120-124 35.986200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.847 37.0 37.0 37.0 37.0 37.0 130-134 35.824 37.0 37.0 37.0 37.0 37.0 135-139 35.7841 37.0 37.0 37.0 37.0 37.0 140-144 35.6758 37.0 37.0 37.0 37.0 37.0 145-149 35.6836 37.0 37.0 37.0 37.0 37.0 150-151 35.49325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 5.0 26 4.0 27 15.0 28 16.0 29 23.0 30 40.0 31 47.0 32 52.0 33 80.0 34 140.0 35 340.0 36 2869.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.12140175219024 13.391739674593243 6.758448060075094 42.72841051314143 2 18.8 14.299999999999999 35.55 31.35 3 16.6 16.55 28.125 38.725 4 19.575 23.225 25.5 31.7 5 21.725 31.15 25.525 21.6 6 22.0 32.725 24.325 20.95 7 15.2 28.249999999999996 40.0 16.55 8 17.5 25.900000000000002 33.425 23.175 9 17.025000000000002 25.35 34.5 23.125 10-14 19.67 29.520000000000003 28.03 22.78 15-19 19.115 28.24 28.194999999999997 24.45 20-24 19.235 28.76 28.17 23.835 25-29 19.335 29.45 27.950000000000003 23.265 30-34 19.905 28.720000000000002 27.839999999999996 23.535 35-39 19.365 29.03 27.925 23.68 40-44 19.575 29.24 27.634999999999998 23.549999999999997 45-49 19.939999999999998 29.160000000000004 27.625 23.275000000000002 50-54 19.875 28.645 27.644999999999996 23.835 55-59 19.950000000000003 28.804999999999996 28.060000000000002 23.185 60-64 20.01 28.64 27.925 23.425 65-69 19.34 28.549999999999997 28.189999999999998 23.919999999999998 70-74 20.1 28.665000000000003 27.33 23.905 75-79 19.525000000000002 27.900000000000002 27.68 24.895 80-84 19.465 29.310000000000002 27.965 23.26 85-89 20.04 27.935 27.845 24.18 90-94 20.635 28.09 27.71 23.565 95-99 19.98 28.16 27.805000000000003 24.055 100-104 19.735 28.98 27.944999999999997 23.34 105-109 20.415 28.37 27.41 23.805 110-114 20.285 29.2 27.084999999999997 23.43 115-119 20.095 28.525 27.534999999999997 23.845 120-124 20.345 28.050000000000004 27.800000000000004 23.805 125-129 20.16 27.779999999999998 27.845 24.215 130-134 20.36 28.389999999999997 27.495000000000005 23.755000000000003 135-139 20.93 28.29 26.965 23.815 140-144 20.424999999999997 28.599999999999998 27.389999999999997 23.585 145-149 20.555 28.205000000000002 26.875 24.365000000000002 150-151 21.075 28.050000000000004 27.0 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 2.5 26 2.0 27 3.0 28 7.0 29 10.0 30 13.5 31 20.0 32 28.5 33 38.5 34 53.0 35 69.0 36 85.5 37 104.5 38 133.5 39 172.0 40 205.0 41 238.5 42 271.5 43 286.0 44 283.5 45 273.5 46 266.5 47 260.0 48 243.5 49 213.5 50 177.0 51 137.5 52 103.5 53 75.0 54 54.5 55 48.5 56 34.5 57 23.0 58 19.5 59 16.0 60 9.0 61 2.5 62 3.0 63 2.0 64 1.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.28548978522787 90.95 2 4.662126767941331 8.9 3 0.05238344683080147 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.050000000000001 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATT 10 0.006830828 145.0 6 TGTAGAA 10 0.006830828 145.0 8 TCATTCC 10 0.006830828 145.0 8 >>END_MODULE SRR12161470 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2955 37.0 37.0 37.0 37.0 37.0 2 36.015 37.0 37.0 37.0 37.0 37.0 3 36.117 37.0 37.0 37.0 37.0 37.0 4 36.1495 37.0 37.0 37.0 37.0 37.0 5 36.1815 37.0 37.0 37.0 37.0 37.0 6 36.11 37.0 37.0 37.0 37.0 37.0 7 36.107 37.0 37.0 37.0 37.0 37.0 8 36.1255 37.0 37.0 37.0 37.0 37.0 9 36.1645 37.0 37.0 37.0 37.0 37.0 10-14 36.1579 37.0 37.0 37.0 37.0 37.0 15-19 36.1433 37.0 37.0 37.0 37.0 37.0 20-24 36.1321 37.0 37.0 37.0 37.0 37.0 25-29 35.977500000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.986200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.005900000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.907 37.0 37.0 37.0 37.0 37.0 45-49 35.989200000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.888 37.0 37.0 37.0 37.0 37.0 55-59 35.907300000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.8133 37.0 37.0 37.0 37.0 37.0 65-69 35.839999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.7522 37.0 37.0 37.0 37.0 37.0 75-79 35.75609999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.778 37.0 37.0 37.0 37.0 37.0 85-89 35.7213 37.0 37.0 37.0 37.0 37.0 90-94 35.6666 37.0 37.0 37.0 37.0 37.0 95-99 35.6669 37.0 37.0 37.0 37.0 37.0 100-104 35.6244 37.0 37.0 37.0 37.0 37.0 105-109 35.653800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5778 37.0 37.0 37.0 37.0 37.0 115-119 35.555699999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.53830000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4709 37.0 37.0 37.0 37.0 37.0 130-134 35.3808 37.0 37.0 37.0 37.0 37.0 135-139 35.3331 37.0 37.0 37.0 34.6 37.0 140-144 35.1901 37.0 37.0 37.0 25.0 37.0 145-149 35.2196 37.0 37.0 37.0 32.2 37.0 150-151 34.73975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 11.0 14 2.0 15 5.0 16 2.0 17 5.0 18 0.0 19 3.0 20 2.0 21 1.0 22 5.0 23 11.0 24 10.0 25 5.0 26 11.0 27 10.0 28 23.0 29 19.0 30 28.0 31 45.0 32 55.0 33 105.0 34 195.0 35 500.0 36 2720.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.125 23.799999999999997 10.625 26.450000000000003 2 27.85 27.474999999999998 29.575000000000003 15.1 3 20.65 28.975 31.8 18.575 4 23.9 33.25 24.675 18.175 5 24.875 36.175000000000004 22.8 16.150000000000002 6 21.975 38.1 23.65 16.275000000000002 7 20.8 23.75 37.075 18.375 8 23.05 25.0 28.549999999999997 23.400000000000002 9 22.275 24.8 29.975 22.95 10-14 23.46 29.625 26.384999999999998 20.53 15-19 23.425 28.599999999999998 27.450000000000003 20.525 20-24 22.895 28.849999999999998 27.66 20.595 25-29 23.669999999999998 28.955 26.889999999999997 20.485 30-34 22.955000000000002 28.33 28.15 20.565 35-39 23.47 28.53 27.800000000000004 20.200000000000003 40-44 23.165 28.549999999999997 28.144999999999996 20.14 45-49 23.485 27.794999999999998 28.255000000000003 20.465 50-54 22.955000000000002 28.449999999999996 28.655 19.939999999999998 55-59 23.26 27.71 28.139999999999997 20.89 60-64 23.445 29.035 27.63 19.89 65-69 23.52 28.439999999999998 27.815 20.225 70-74 24.175 28.415000000000003 27.339999999999996 20.07 75-79 23.830000000000002 27.92 28.315 19.935 80-84 23.87 28.255000000000003 27.51 20.365 85-89 23.544999999999998 28.585 28.075 19.794999999999998 90-94 24.295 28.410000000000004 27.855 19.439999999999998 95-99 23.974999999999998 28.15 27.62 20.255000000000003 100-104 24.395 28.83 27.279999999999998 19.495 105-109 23.669999999999998 28.799999999999997 27.515 20.015 110-114 24.59 28.7 27.43 19.28 115-119 24.375 29.17 27.334999999999997 19.12 120-124 24.709999999999997 28.799999999999997 27.405 19.085 125-129 24.67 28.549999999999997 27.700000000000003 19.08 130-134 25.185000000000002 28.660000000000004 26.85 19.305 135-139 25.005 27.58 27.875 19.54 140-144 25.345000000000002 28.27 26.650000000000002 19.735 145-149 25.455 28.139999999999997 27.1 19.305 150-151 25.7 28.8375 27.037499999999998 18.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 1.0 12 2.0 13 1.5 14 1.0 15 1.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 1.0 25 3.0 26 5.0 27 5.5 28 6.0 29 6.0 30 12.0 31 24.0 32 33.5 33 41.5 34 41.0 35 54.5 36 81.5 37 107.5 38 134.5 39 168.0 40 220.5 41 258.5 42 265.0 43 275.5 44 281.5 45 281.0 46 284.5 47 270.5 48 247.0 49 197.0 50 147.0 51 127.5 52 107.0 53 87.5 54 64.5 55 43.5 56 34.0 57 20.0 58 10.5 59 8.0 60 5.5 61 4.0 62 3.0 63 1.5 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29813501444707 90.7 2 4.596795376937221 8.75 3 0.052534804307853955 0.15 4 0.0 0.0 5 0.0 0.0 6 0.026267402153926978 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026267402153926978 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.3125 0.0 0.0 0.0 0.0 126-127 3.6500000000000004 0.0 0.0 0.0 0.0 128-129 4.025 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423730 spots for SRR12161470.sra Written 1423730 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra Read 1423719 spots for SRR12161470.sra Written 1423719 spots for SRR12161470.sra SRR ids: ['SRR12161470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cp1w0ofs SRR12161470.sra spots: 28474391 blocks: [[1, 1423719], [1423720, 2847438], [2847439, 4271157], [4271158, 5694876], [5694877, 7118595], [7118596, 8542314], [8542315, 9966033], [9966034, 11389752], [11389753, 12813471], [12813472, 14237190], [14237191, 15660909], [15660910, 17084628], [17084629, 18508347], [18508348, 19932066], [19932067, 21355785], [21355786, 22779504], [22779505, 24203223], [24203224, 25626942], [25626943, 27050661], [27050662, 28474391]] SRR12161470 file size 9655143 SRR12161470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161470 SRR12161470_1.fastq SRR12161470_2.fastq Input file: SRR12161470_1.fastq Paired file: SRR12161470_2.fastq trimmed: SRR12161470-trimmed-pair1.fastq, SRR12161470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:51:52 2025 >> started Thu Feb 13 17:52:26 2025 >> done (33.533s) 28474391 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 9585 ( 0.03%) empty read pairs filtered out after trimming by size control 28464765 (99.97%) read pairs available; of these: 2677409 ( 9.41%) trimmed read pairs available after processing 25787356 (90.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 8 0.00% 25 5 0.00% 26 12 0.00% 27 12 0.00% 28 18 0.00% 29 23 0.00% 30 28 0.00% 31 17 0.00% 32 24 0.00% 33 17 0.00% 34 25 0.00% 35 25 0.00% 36 37 0.00% 37 22 0.00% 38 42 0.00% 39 41 0.00% 40 32 0.00% 41 39 0.00% 42 52 0.00% 43 45 0.00% 44 27 0.00% 45 41 0.00% 46 50 0.00% 47 55 0.00% 48 80 0.00% 49 81 0.00% 50 93 0.00% 51 78 0.00% 52 96 0.00% 53 105 0.00% 54 101 0.00% 55 110 0.00% 56 136 0.00% 57 153 0.00% 58 184 0.00% 59 198 0.00% 60 239 0.00% 61 261 0.00% 62 289 0.00% 63 288 0.00% 64 346 0.00% 65 359 0.00% 66 372 0.00% 67 465 0.00% 68 528 0.00% 69 590 0.00% 70 659 0.00% 71 753 0.00% 72 887 0.00% 73 1072 0.00% 74 1169 0.00% 75 1222 0.00% 76 1343 0.00% 77 1508 0.01% 78 1749 0.01% 79 1919 0.01% 80 2123 0.01% 81 2447 0.01% 82 2946 0.01% 83 3219 0.01% 84 3804 0.01% 85 4245 0.01% 86 4441 0.02% 87 4959 0.02% 88 5364 0.02% 89 5823 0.02% 90 6418 0.02% 91 7331 0.03% 92 8019 0.03% 93 8640 0.03% 94 9783 0.03% 95 10619 0.04% 96 11438 0.04% 97 12437 0.04% 98 13193 0.05% 99 14028 0.05% 100 15368 0.05% 101 15938 0.06% 102 17380 0.06% 103 18774 0.07% 104 19853 0.07% 105 21506 0.08% 106 22914 0.08% 107 24302 0.09% 108 25469 0.09% 109 25860 0.09% 110 27327 0.10% 111 28303 0.10% 112 29936 0.11% 113 31050 0.11% 114 33204 0.12% 115 34861 0.12% 116 36619 0.13% 117 38004 0.13% 118 39174 0.14% 119 40660 0.14% 120 41559 0.15% 121 43695 0.15% 122 44330 0.16% 123 46244 0.16% 124 48076 0.17% 125 48772 0.17% 126 51066 0.18% 127 52576 0.18% 128 54559 0.19% 129 55193 0.19% 130 56819 0.20% 131 57611 0.20% 132 58896 0.21% 133 60729 0.21% 134 62618 0.22% 135 63748 0.22% 136 65642 0.23% 137 66969 0.24% 138 68237 0.24% 139 70034 0.25% 140 71680 0.25% 141 71912 0.25% 142 73637 0.26% 143 74758 0.26% 144 76781 0.27% 145 77998 0.27% 146 78515 0.28% 147 80503 0.28% 148 81760 0.29% 149 82807 0.29% 150 83745 0.29% 151 25787356 90.59% 28464765 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=17 prefix-density=0.84 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=10.41 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=2.7 sequence=TCCTTCTGGATATTGTAGTCTGCCAGGGTGCGCCCAT criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=27 prefix-density=0.77 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=44.33 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.8 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR12161470 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:53:08 Started mapping on | Feb 13 17:53:08 Finished on | Feb 13 17:55:55 Mapping speed, Million of reads per hour | 613.61 Number of input reads | 28464765 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 26976486 Uniquely mapped reads % | 94.77% Average mapped length | 296.58 Number of splices: Total | 28418609 Number of splices: Annotated (sjdb) | 27822014 Number of splices: GT/AG | 27959168 Number of splices: GC/AG | 360972 Number of splices: AT/AC | 24851 Number of splices: Non-canonical | 73618 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 726988 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 28380 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 761291 761291 761291 N_multimapping 726988 726988 726988 N_noFeature 714122 26745847 814423 N_ambiguous 279950 1407 148926 UnstrandedReadsAssigned:25982414 PositiveStrandReadsAssigned:229232 NegativeStrandReadsAssigned:26013137 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161470-trimmed-pair1.fastq SRR12161470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,464,765 reads, 25,947,192 reads pseudoaligned [quant] estimated average fragment length: 252.463 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR12161470.ke.tsv 34699 SRR12161470.se.tsv 87100 total ==> SRR12161470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.54 2872 58.4715 Potri.005G024800.1.v4.1 1035 783.537 476 21.8489 Potri.004G059700.1.v4.1 961 709.629 80 4.05454 Potri.007G009000.2.v4.1 1416 1164.54 0 0 Potri.003G141000.2.v4.1 2943 2691.54 1134.19 15.1554 Potri.016G087400.1.v4.1 270 81.4938 1652.53 729.303 Potri.015G069301.1.v4.1 564 321.496 0 0 Potri.010G195200.1.v4.1 1773 1521.54 548 12.9533 Potri.012G127500.1.v4.1 977 725.583 5844 289.672 ==> SRR12161470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 710 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1122 SRR12161470 completed mapping pipeline successfully