Starting /dee2/code/volunteer_pipeline.sh SRR12161471 current disk space = 3088757616640 free memory = 1466566060 SRR12161471 SRAfilesize b9dc63547a49dde424d73215db18bf4b SRR12161471.sra SRR12161471.sra file validated SRR12161471 is paired end SRR12161471 is conventional basespace SRR12161471 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47025 37.0 37.0 37.0 37.0 37.0 2 36.3265 37.0 37.0 37.0 37.0 37.0 3 36.4875 37.0 37.0 37.0 37.0 37.0 4 36.4585 37.0 37.0 37.0 37.0 37.0 5 36.587 37.0 37.0 37.0 37.0 37.0 6 36.605 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.418 37.0 37.0 37.0 37.0 37.0 9 36.4395 37.0 37.0 37.0 37.0 37.0 10-14 36.529 37.0 37.0 37.0 37.0 37.0 15-19 36.460300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4326 37.0 37.0 37.0 37.0 37.0 25-29 36.383399999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3607 37.0 37.0 37.0 37.0 37.0 35-39 36.286699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2436 37.0 37.0 37.0 37.0 37.0 45-49 36.300599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.211400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.169500000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.2189 37.0 37.0 37.0 37.0 37.0 65-69 36.1436 37.0 37.0 37.0 37.0 37.0 70-74 36.1195 37.0 37.0 37.0 37.0 37.0 75-79 36.1344 37.0 37.0 37.0 37.0 37.0 80-84 36.0561 37.0 37.0 37.0 37.0 37.0 85-89 36.114999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0809 37.0 37.0 37.0 37.0 37.0 95-99 36.05499999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.0013 37.0 37.0 37.0 37.0 37.0 105-109 35.9459 37.0 37.0 37.0 37.0 37.0 110-114 35.855199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.909299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9307 37.0 37.0 37.0 37.0 37.0 125-129 35.879000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8035 37.0 37.0 37.0 37.0 37.0 135-139 35.743100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.6409 37.0 37.0 37.0 37.0 37.0 145-149 35.7042 37.0 37.0 37.0 37.0 37.0 150-151 35.48125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 1.0 24 3.0 25 3.0 26 10.0 27 8.0 28 11.0 29 28.0 30 30.0 31 46.0 32 68.0 33 89.0 34 150.0 35 328.0 36 2926.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.13248184322564 12.847483095416981 6.135737540696218 33.88429752066116 2 20.1 13.65 34.775 31.474999999999998 3 17.825 20.05 29.775000000000002 32.35 4 21.625 27.375 24.125 26.875 5 21.75 31.374999999999996 25.275 21.6 6 21.6 33.725 24.0 20.674999999999997 7 15.725 26.3 41.975 16.0 8 16.925 26.200000000000003 32.975 23.9 9 17.474999999999998 24.474999999999998 35.175 22.875 10-14 19.445 29.755 27.685 23.115 15-19 19.895 28.95 27.639999999999997 23.515 20-24 19.715 28.599999999999998 28.575 23.11 25-29 20.07 29.154999999999998 27.61 23.165 30-34 20.044999999999998 28.18 28.439999999999998 23.335 35-39 19.53 28.26 28.59 23.62 40-44 19.509999999999998 29.095 27.839999999999996 23.555 45-49 19.485 28.79 28.115000000000002 23.61 50-54 19.57 28.754999999999995 28.044999999999998 23.630000000000003 55-59 20.244999999999997 28.095 28.49 23.169999999999998 60-64 20.560000000000002 28.78 27.24 23.419999999999998 65-69 20.31 28.76 27.900000000000002 23.03 70-74 20.29 28.285 27.96 23.465 75-79 20.145 27.894999999999996 27.975 23.985 80-84 20.555 28.720000000000002 27.875 22.85 85-89 19.935 28.16 28.095 23.810000000000002 90-94 20.07 28.64 27.63 23.66 95-99 20.085 28.03 27.91 23.974999999999998 100-104 20.549999999999997 28.26 27.544999999999998 23.645 105-109 20.395 28.725 27.68 23.200000000000003 110-114 20.235 28.375 27.375 24.015 115-119 20.055 28.565 27.389999999999997 23.990000000000002 120-124 20.435 28.715000000000003 27.47 23.380000000000003 125-129 20.305 28.33 27.605 23.76 130-134 20.19 29.2 26.945000000000004 23.665 135-139 20.544999999999998 28.634999999999998 27.325 23.494999999999997 140-144 20.835 28.52 26.995 23.65 145-149 20.74 28.82 27.555000000000003 22.884999999999998 150-151 21.099999999999998 27.9375 26.5875 24.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 4.5 25 6.5 26 5.5 27 6.5 28 7.0 29 11.0 30 18.0 31 22.5 32 31.0 33 43.0 34 55.0 35 66.5 36 85.5 37 111.0 38 132.0 39 155.0 40 191.5 41 219.0 42 248.0 43 277.0 44 273.5 45 266.5 46 271.0 47 283.0 48 257.5 49 204.0 50 173.5 51 151.0 52 123.0 53 92.0 54 60.0 55 41.0 56 35.5 57 23.5 58 13.0 59 8.0 60 6.0 61 4.0 62 3.0 63 2.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91703976823808 90.10000000000001 2 4.845930998156439 9.2 3 0.21069265209375823 0.6 4 0.02633658151171978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.65 0.0 0.0 0.0 0.0 132-133 4.050000000000001 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161471 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161471_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.348 37.0 37.0 37.0 37.0 37.0 2 36.023 37.0 37.0 37.0 37.0 37.0 3 36.08 37.0 37.0 37.0 37.0 37.0 4 36.189 37.0 37.0 37.0 37.0 37.0 5 36.2005 37.0 37.0 37.0 37.0 37.0 6 36.2375 37.0 37.0 37.0 37.0 37.0 7 36.246 37.0 37.0 37.0 37.0 37.0 8 36.2055 37.0 37.0 37.0 37.0 37.0 9 36.325 37.0 37.0 37.0 37.0 37.0 10-14 36.2324 37.0 37.0 37.0 37.0 37.0 15-19 36.221 37.0 37.0 37.0 37.0 37.0 20-24 36.1936 37.0 37.0 37.0 37.0 37.0 25-29 36.0625 37.0 37.0 37.0 37.0 37.0 30-34 36.105599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0751 37.0 37.0 37.0 37.0 37.0 40-44 36.0157 37.0 37.0 37.0 37.0 37.0 45-49 35.971 37.0 37.0 37.0 37.0 37.0 50-54 35.898199999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9602 37.0 37.0 37.0 37.0 37.0 60-64 35.9239 37.0 37.0 37.0 37.0 37.0 65-69 35.895799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.890100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8463 37.0 37.0 37.0 37.0 37.0 80-84 35.8146 37.0 37.0 37.0 37.0 37.0 85-89 35.771699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.706999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.6545 37.0 37.0 37.0 37.0 37.0 100-104 35.7227 37.0 37.0 37.0 37.0 37.0 105-109 35.619800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.560500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5756 37.0 37.0 37.0 37.0 37.0 120-124 35.5334 37.0 37.0 37.0 37.0 37.0 125-129 35.506600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.467200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3971 37.0 37.0 37.0 34.6 37.0 140-144 35.2941 37.0 37.0 37.0 34.6 37.0 145-149 35.33200000000001 37.0 37.0 37.0 37.0 37.0 150-151 34.997249999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 4.0 14 4.0 15 5.0 16 6.0 17 3.0 18 0.0 19 0.0 20 1.0 21 2.0 22 9.0 23 5.0 24 7.0 25 10.0 26 10.0 27 14.0 28 22.0 29 27.0 30 27.0 31 43.0 32 55.0 33 94.0 34 151.0 35 510.0 36 2730.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.55 24.625 8.325000000000001 22.5 2 28.4 25.4 29.5 16.7 3 21.349999999999998 27.150000000000002 33.125 18.375 4 24.25 34.35 24.275 17.125 5 24.675 37.525 20.775 17.025000000000002 6 22.075 39.625 21.475 16.825000000000003 7 20.825 22.75 37.6 18.825 8 20.9 25.1 28.7 25.3 9 21.375 25.85 28.975 23.799999999999997 10-14 24.235 28.994999999999997 26.674999999999997 20.095 15-19 23.380000000000003 28.4 27.529999999999998 20.69 20-24 22.814999999999998 28.985 27.365000000000002 20.835 25-29 23.169999999999998 28.875 27.955000000000002 20.0 30-34 22.255 28.425 29.025000000000002 20.294999999999998 35-39 23.385 28.32 27.705000000000002 20.59 40-44 23.645 28.73 27.62 20.005 45-49 23.244999999999997 28.42 27.800000000000004 20.535 50-54 22.98 28.395 27.994999999999997 20.630000000000003 55-59 23.71 28.105000000000004 28.22 19.965 60-64 23.085 28.525 27.605 20.785 65-69 23.415 28.26 28.175 20.150000000000002 70-74 23.105 28.310000000000002 28.349999999999998 20.235 75-79 22.85 28.615000000000002 28.26 20.275000000000002 80-84 23.87 27.800000000000004 27.950000000000003 20.380000000000003 85-89 23.580000000000002 27.99 27.985 20.445 90-94 23.405 28.015 28.075 20.505000000000003 95-99 23.04 28.854999999999997 28.115000000000002 19.99 100-104 24.04 28.139999999999997 27.955000000000002 19.865 105-109 23.84 28.575 27.650000000000002 19.935 110-114 23.895 28.415000000000003 27.54 20.150000000000002 115-119 24.175 28.485 27.365000000000002 19.975 120-124 24.125 28.444999999999997 27.445000000000004 19.985 125-129 23.69 28.22 28.015 20.075000000000003 130-134 24.555 28.349999999999998 26.905 20.19 135-139 24.47 28.435 27.37 19.725 140-144 25.330000000000002 28.43 26.875 19.365 145-149 25.385 28.585 26.840000000000003 19.189999999999998 150-151 25.112499999999997 29.099999999999998 26.6125 19.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 1.0 11 1.5 12 0.5 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 1.5 19 2.5 20 3.0 21 2.0 22 0.5 23 1.5 24 3.0 25 2.5 26 3.0 27 6.0 28 8.0 29 10.5 30 10.5 31 15.5 32 27.0 33 35.0 34 52.0 35 73.0 36 85.0 37 101.5 38 149.0 39 183.0 40 196.0 41 234.0 42 272.0 43 286.5 44 279.5 45 279.0 46 268.5 47 250.5 48 237.5 49 199.5 50 172.5 51 144.0 52 104.5 53 85.5 54 61.5 55 36.0 56 24.0 57 23.5 58 17.5 59 9.5 60 8.0 61 4.5 62 2.5 63 2.0 64 1.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90899498812978 89.95 2 4.827222368768135 9.15 3 0.1846478501714587 0.525 4 0.026378264310208392 0.1 5 0.026378264310208392 0.125 6 0.026378264310208392 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.475 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGATCG 20 0.00593511 29.0 115-119 >>END_MODULE Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916890 spots for SRR12161471.sra Written 1916890 spots for SRR12161471.sra Read 1916895 spots for SRR12161471.sra Written 1916895 spots for SRR12161471.sra SRR ids: ['SRR12161471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xxe7ivce SRR12161471.sra spots: 38337805 blocks: [[1, 1916890], [1916891, 3833780], [3833781, 5750670], [5750671, 7667560], [7667561, 9584450], [9584451, 11501340], [11501341, 13418230], [13418231, 15335120], [15335121, 17252010], [17252011, 19168900], [19168901, 21085790], [21085791, 23002680], [23002681, 24919570], [24919571, 26836460], [26836461, 28753350], [28753351, 30670240], [30670241, 32587130], [32587131, 34504020], [34504021, 36420910], [36420911, 38337805]] SRR12161471 file size 13007163 SRR12161471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161471 SRR12161471_1.fastq SRR12161471_2.fastq Input file: SRR12161471_1.fastq Paired file: SRR12161471_2.fastq trimmed: SRR12161471-trimmed-pair1.fastq, SRR12161471-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:57:41 2025 >> started Thu Feb 13 17:58:21 2025 >> done (39.967s) 38337805 read pairs processed; of these: 87 ( 0.00%) short read pairs filtered out after trimming by size control 12850 ( 0.03%) empty read pairs filtered out after trimming by size control 38324868 (99.97%) read pairs available; of these: 3016871 ( 7.87%) trimmed read pairs available after processing 35307997 (92.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 19 0.00% 21 11 0.00% 22 22 0.00% 23 29 0.00% 24 36 0.00% 25 48 0.00% 26 32 0.00% 27 47 0.00% 28 46 0.00% 29 51 0.00% 30 48 0.00% 31 43 0.00% 32 53 0.00% 33 53 0.00% 34 68 0.00% 35 63 0.00% 36 68 0.00% 37 58 0.00% 38 91 0.00% 39 43 0.00% 40 66 0.00% 41 79 0.00% 42 76 0.00% 43 74 0.00% 44 77 0.00% 45 78 0.00% 46 110 0.00% 47 106 0.00% 48 107 0.00% 49 97 0.00% 50 128 0.00% 51 153 0.00% 52 167 0.00% 53 150 0.00% 54 149 0.00% 55 176 0.00% 56 196 0.00% 57 186 0.00% 58 221 0.00% 59 235 0.00% 60 295 0.00% 61 313 0.00% 62 350 0.00% 63 375 0.00% 64 429 0.00% 65 430 0.00% 66 500 0.00% 67 495 0.00% 68 581 0.00% 69 590 0.00% 70 767 0.00% 71 889 0.00% 72 1019 0.00% 73 1158 0.00% 74 1191 0.00% 75 1321 0.00% 76 1368 0.00% 77 1603 0.00% 78 1681 0.00% 79 1982 0.01% 80 2377 0.01% 81 2658 0.01% 82 3026 0.01% 83 3444 0.01% 84 3827 0.01% 85 4234 0.01% 86 4398 0.01% 87 4848 0.01% 88 5306 0.01% 89 5705 0.01% 90 6528 0.02% 91 7339 0.02% 92 8185 0.02% 93 9129 0.02% 94 9847 0.03% 95 10649 0.03% 96 11418 0.03% 97 12205 0.03% 98 13004 0.03% 99 14047 0.04% 100 15234 0.04% 101 16512 0.04% 102 18070 0.05% 103 19842 0.05% 104 21002 0.05% 105 22151 0.06% 106 23634 0.06% 107 24555 0.06% 108 25082 0.07% 109 26875 0.07% 110 28247 0.07% 111 29939 0.08% 112 32360 0.08% 113 33498 0.09% 114 36309 0.09% 115 37820 0.10% 116 39001 0.10% 117 40370 0.11% 118 41285 0.11% 119 42830 0.11% 120 44971 0.12% 121 46901 0.12% 122 48395 0.13% 123 52521 0.14% 124 55172 0.14% 125 55755 0.15% 126 57778 0.15% 127 58641 0.15% 128 61403 0.16% 129 61109 0.16% 130 62585 0.16% 131 64054 0.17% 132 66945 0.17% 133 70324 0.18% 134 73264 0.19% 135 75859 0.20% 136 77007 0.20% 137 77677 0.20% 138 78790 0.21% 139 79667 0.21% 140 82544 0.22% 141 83443 0.22% 142 85691 0.22% 143 88537 0.23% 144 91776 0.24% 145 94542 0.25% 146 94949 0.25% 147 96148 0.25% 148 96395 0.25% 149 97136 0.25% 150 99185 0.26% 151 35307997 92.13% 38324868 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=18 prefix-density=1.10 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=22.17 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTCGTTGTTGAAGGTAACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCTTCGAATCGATGATTTCACCGTACTGGCTAAACGCTTCTTGAAGGGATTGGTCAGTAGTGGCCCATGCGAGGCCACCAACAAAGC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=14 prefix-density=1.23 prefix-fanout=2.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=92.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.1 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR12161471 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:59:03 Started mapping on | Feb 13 17:59:03 Finished on | Feb 13 18:02:56 Mapping speed, Million of reads per hour | 592.14 Number of input reads | 38324868 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 35816439 Uniquely mapped reads % | 93.45% Average mapped length | 297.22 Number of splices: Total | 36784360 Number of splices: Annotated (sjdb) | 35988636 Number of splices: GT/AG | 36192795 Number of splices: GC/AG | 462800 Number of splices: AT/AC | 32702 Number of splices: Non-canonical | 96063 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 890624 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 36892 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1617805 1617805 1617805 N_multimapping 890624 890624 890624 N_noFeature 1110532 35516557 1251476 N_ambiguous 367913 1939 207913 UnstrandedReadsAssigned:34337994 PositiveStrandReadsAssigned:297943 NegativeStrandReadsAssigned:34357050 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161471 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161471-trimmed-pair1.fastq SRR12161471-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,324,868 reads, 34,193,749 reads pseudoaligned [quant] estimated average fragment length: 261.563 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR12161471.ke.tsv 34699 SRR12161471.se.tsv 87100 total ==> SRR12161471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.44 4628 73.3208 Potri.005G024800.1.v4.1 1035 774.437 843 30.3078 Potri.004G059700.1.v4.1 961 700.61 102 4.05357 Potri.007G009000.2.v4.1 1416 1155.44 0 0 Potri.003G141000.2.v4.1 2943 2682.44 1528.29 15.8632 Potri.016G087400.1.v4.1 270 78.5455 1456 516.123 Potri.015G069301.1.v4.1 564 315.086 0 0 Potri.010G195200.1.v4.1 1773 1512.44 565 10.4012 Potri.012G127500.1.v4.1 977 716.525 9700 376.924 ==> SRR12161471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 855 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2533 SRR12161471 completed mapping pipeline successfully