Starting /dee2/code/volunteer_pipeline.sh SRR12161472 current disk space = 3088690368512 free memory = 1375283304 SRR12161472 SRAfilesize 9a382e8464edda37fbd3b9cdfdc78322 SRR12161472.sra SRR12161472.sra file validated SRR12161472 is paired end SRR12161472 is conventional basespace SRR12161472 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46625 37.0 37.0 37.0 37.0 37.0 2 36.37 37.0 37.0 37.0 37.0 37.0 3 36.5235 37.0 37.0 37.0 37.0 37.0 4 36.578 37.0 37.0 37.0 37.0 37.0 5 36.4955 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.4605 37.0 37.0 37.0 37.0 37.0 8 36.476 37.0 37.0 37.0 37.0 37.0 9 36.5235 37.0 37.0 37.0 37.0 37.0 10-14 36.551 37.0 37.0 37.0 37.0 37.0 15-19 36.5118 37.0 37.0 37.0 37.0 37.0 20-24 36.5132 37.0 37.0 37.0 37.0 37.0 25-29 36.408699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.351 37.0 37.0 37.0 37.0 37.0 35-39 36.349599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3266 37.0 37.0 37.0 37.0 37.0 45-49 36.323600000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3069 37.0 37.0 37.0 37.0 37.0 55-59 36.285 37.0 37.0 37.0 37.0 37.0 60-64 36.303700000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.27759999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2234 37.0 37.0 37.0 37.0 37.0 75-79 36.1927 37.0 37.0 37.0 37.0 37.0 80-84 36.134 37.0 37.0 37.0 37.0 37.0 85-89 36.11710000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1237 37.0 37.0 37.0 37.0 37.0 95-99 36.123400000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.023199999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0438 37.0 37.0 37.0 37.0 37.0 110-114 35.970499999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.028 37.0 37.0 37.0 37.0 37.0 120-124 36.0323 37.0 37.0 37.0 37.0 37.0 125-129 35.9149 37.0 37.0 37.0 37.0 37.0 130-134 35.9043 37.0 37.0 37.0 37.0 37.0 135-139 35.7977 37.0 37.0 37.0 37.0 37.0 140-144 35.7411 37.0 37.0 37.0 37.0 37.0 145-149 35.7328 37.0 37.0 37.0 37.0 37.0 150-151 35.484750000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 4.0 27 10.0 28 22.0 29 20.0 30 41.0 31 41.0 32 54.0 33 80.0 34 130.0 35 329.0 36 2935.0 37 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.33333333333333 12.628157039259817 6.626656664166042 47.41185296324081 2 17.224999999999998 12.5 40.2 30.075000000000003 3 15.825 14.975 26.625 42.575 4 18.75 21.224999999999998 26.05 33.975 5 22.775000000000002 28.249999999999996 25.324999999999996 23.65 6 20.925 32.95 24.675 21.45 7 14.45 27.875 40.75 16.925 8 17.150000000000002 27.075 33.15 22.625 9 16.875 24.3 35.75 23.075000000000003 10-14 18.875 30.635 28.939999999999998 21.55 15-19 19.0 28.544999999999998 28.59 23.865 20-24 19.139999999999997 28.105000000000004 29.215000000000003 23.54 25-29 18.695 29.755 28.299999999999997 23.25 30-34 18.89 28.860000000000003 28.835 23.415 35-39 19.35 28.845 28.555000000000003 23.25 40-44 18.884999999999998 29.645 28.29 23.18 45-49 18.85 29.630000000000003 28.12 23.400000000000002 50-54 19.33 29.265 28.249999999999996 23.155 55-59 19.040000000000003 29.005 28.825 23.13 60-64 19.125 28.884999999999998 28.599999999999998 23.39 65-69 19.375 29.185 28.525 22.915 70-74 19.56 29.17 28.365000000000002 22.905 75-79 19.99 28.549999999999997 27.994999999999997 23.465 80-84 20.195 29.14 28.1 22.564999999999998 85-89 19.509999999999998 29.325000000000003 28.225 22.939999999999998 90-94 19.495 29.26 28.21 23.035 95-99 19.34 29.28 28.605000000000004 22.775000000000002 100-104 19.74 29.255 27.88 23.125 105-109 20.11 28.82 27.950000000000003 23.119999999999997 110-114 19.525000000000002 29.07 28.065 23.34 115-119 20.0 29.275000000000002 27.500000000000004 23.225 120-124 20.080000000000002 29.45 27.735 22.735 125-129 20.080000000000002 28.78 27.99 23.150000000000002 130-134 19.775000000000002 28.53 28.24 23.455000000000002 135-139 20.4 28.76 27.305 23.535 140-144 20.880000000000003 28.38 27.18 23.56 145-149 20.175 29.12 27.415 23.29 150-151 20.7625 29.4375 26.687499999999996 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 2.5 27 4.5 28 6.0 29 11.0 30 19.5 31 23.5 32 28.5 33 37.5 34 62.0 35 95.0 36 108.5 37 127.5 38 155.0 39 196.5 40 246.5 41 269.0 42 281.5 43 287.0 44 298.0 45 304.5 46 281.5 47 252.0 48 226.0 49 189.0 50 147.5 51 112.0 52 79.5 53 55.5 54 32.5 55 21.5 56 16.5 57 8.0 58 5.0 59 4.0 60 1.5 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10010537407798 90.25 2 4.531085353003162 8.6 3 0.26343519494204426 0.75 4 0.10537407797681769 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.3625 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.325 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.4375 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAAAT 10 0.006830828 145.0 1 >>END_MODULE SRR12161472 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3405 37.0 37.0 37.0 37.0 37.0 2 36.1535 37.0 37.0 37.0 37.0 37.0 3 36.1625 37.0 37.0 37.0 37.0 37.0 4 36.182 37.0 37.0 37.0 37.0 37.0 5 36.253 37.0 37.0 37.0 37.0 37.0 6 36.2295 37.0 37.0 37.0 37.0 37.0 7 36.2815 37.0 37.0 37.0 37.0 37.0 8 36.26 37.0 37.0 37.0 37.0 37.0 9 36.2275 37.0 37.0 37.0 37.0 37.0 10-14 36.2731 37.0 37.0 37.0 37.0 37.0 15-19 36.3137 37.0 37.0 37.0 37.0 37.0 20-24 36.2382 37.0 37.0 37.0 37.0 37.0 25-29 36.2273 37.0 37.0 37.0 37.0 37.0 30-34 36.2235 37.0 37.0 37.0 37.0 37.0 35-39 36.178200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.161500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1571 37.0 37.0 37.0 37.0 37.0 50-54 36.1469 37.0 37.0 37.0 37.0 37.0 55-59 36.071600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0434 37.0 37.0 37.0 37.0 37.0 65-69 35.9875 37.0 37.0 37.0 37.0 37.0 70-74 35.9983 37.0 37.0 37.0 37.0 37.0 75-79 35.943 37.0 37.0 37.0 37.0 37.0 80-84 35.9091 37.0 37.0 37.0 37.0 37.0 85-89 35.9024 37.0 37.0 37.0 37.0 37.0 90-94 35.8578 37.0 37.0 37.0 37.0 37.0 95-99 35.821000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8175 37.0 37.0 37.0 37.0 37.0 105-109 35.7529 37.0 37.0 37.0 37.0 37.0 110-114 35.7345 37.0 37.0 37.0 37.0 37.0 115-119 35.7151 37.0 37.0 37.0 37.0 37.0 120-124 35.6845 37.0 37.0 37.0 37.0 37.0 125-129 35.582899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.592600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4268 37.0 37.0 37.0 34.6 37.0 140-144 35.264799999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.1939 37.0 37.0 37.0 32.2 37.0 150-151 34.7255 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 6.0 24 2.0 25 5.0 26 9.0 27 14.0 28 11.0 29 27.0 30 25.0 31 47.0 32 68.0 33 106.0 34 238.0 35 570.0 36 2654.0 37 212.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.25 26.575 10.15 31.025000000000002 2 25.4 28.299999999999997 32.475 13.825000000000001 3 18.575 27.725 32.9 20.8 4 21.525 34.375 26.400000000000002 17.7 5 23.599999999999998 35.55 22.475 18.375 6 20.200000000000003 38.525 24.55 16.725 7 20.075000000000003 21.65 40.075 18.2 8 18.9 24.95 32.025 24.125 9 21.95 23.474999999999998 31.974999999999998 22.6 10-14 22.57 29.53 27.395000000000003 20.505000000000003 15-19 22.439999999999998 28.535 28.405 20.62 20-24 22.67 28.92 28.165000000000003 20.244999999999997 25-29 22.64 28.849999999999998 28.389999999999997 20.119999999999997 30-34 22.3 28.804999999999996 28.46 20.435 35-39 22.49 28.549999999999997 28.904999999999998 20.055 40-44 22.615 28.15 28.775000000000002 20.46 45-49 22.400000000000002 28.09 29.125 20.385 50-54 22.88 28.375 28.54 20.205000000000002 55-59 22.53 28.655 28.365000000000002 20.45 60-64 22.24 28.98 28.82 19.96 65-69 22.78 28.970000000000002 28.134999999999998 20.115 70-74 22.785 28.95 27.82 20.445 75-79 22.575 28.449999999999996 28.810000000000002 20.165 80-84 22.745 28.565 28.395 20.294999999999998 85-89 22.985 28.265 28.825 19.925 90-94 22.62 28.84 28.970000000000002 19.57 95-99 23.135 29.68 27.6 19.585 100-104 23.474999999999998 28.725 28.68 19.12 105-109 23.615 28.389999999999997 28.470000000000002 19.525000000000002 110-114 24.224999999999998 28.060000000000002 28.315 19.400000000000002 115-119 23.935000000000002 28.68 28.38 19.005 120-124 24.97 27.905 28.03 19.095000000000002 125-129 24.45 28.884999999999998 28.03 18.634999999999998 130-134 24.695 28.799999999999997 27.439999999999998 19.064999999999998 135-139 25.169999999999998 28.64 27.284999999999997 18.905 140-144 25.685000000000002 28.89 27.165 18.26 145-149 25.955000000000002 28.12 27.91 18.015 150-151 26.224999999999998 28.1 28.025 17.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 1.5 26 0.5 27 4.5 28 8.5 29 11.0 30 16.5 31 23.5 32 31.0 33 40.0 34 65.0 35 89.0 36 103.5 37 124.5 38 166.0 39 197.5 40 234.5 41 275.5 42 283.0 43 295.0 44 312.0 45 323.0 46 293.0 47 243.0 48 209.5 49 180.0 50 143.5 51 101.0 52 75.5 53 54.0 54 29.5 55 16.0 56 10.0 57 6.0 58 5.0 59 4.5 60 3.0 61 1.0 62 0.5 63 0.5 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.112285336856 90.0 2 4.517833553500661 8.55 3 0.23778071334214002 0.675 4 0.05284015852047556 0.2 5 0.02642007926023778 0.125 6 0.0 0.0 7 0.02642007926023778 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02642007926023778 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 11 0.27499999999999997 No Hit CCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTA 7 0.17500000000000002 No Hit AGATGATCAGCCCTTTCCTGACACACAGGACAAAGAGCAAGTTTGTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 2.1 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.925 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.6125 0.0 0.0 0.0 0.0 128-129 7.1625 0.0 0.0 0.0 0.0 130-131 7.612500000000001 0.0 0.0 0.0 0.0 132-133 8.2 0.0 0.0 0.0 0.0 134-135 8.7625 0.0 0.0 0.0 0.0 136-137 9.399999999999999 0.0 0.0 0.0 0.0 138-139 9.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323707 spots for SRR12161472.sra Written 1323707 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra Read 1323692 spots for SRR12161472.sra Written 1323692 spots for SRR12161472.sra SRR ids: ['SRR12161472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bein5gna SRR12161472.sra spots: 26473855 blocks: [[1, 1323692], [1323693, 2647384], [2647385, 3971076], [3971077, 5294768], [5294769, 6618460], [6618461, 7942152], [7942153, 9265844], [9265845, 10589536], [10589537, 11913228], [11913229, 13236920], [13236921, 14560612], [14560613, 15884304], [15884305, 17207996], [17207997, 18531688], [18531689, 19855380], [19855381, 21179072], [21179073, 22502764], [22502765, 23826456], [23826457, 25150148], [25150149, 26473855]] SRR12161472 file size 8975273 SRR12161472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161472 SRR12161472_1.fastq SRR12161472_2.fastq Input file: SRR12161472_1.fastq Paired file: SRR12161472_2.fastq trimmed: SRR12161472-trimmed-pair1.fastq, SRR12161472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:37:48 2025 >> started Thu Feb 13 17:38:20 2025 >> done (31.433s) 26473855 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 857 ( 0.00%) empty read pairs filtered out after trimming by size control 26472902 (100.00%) read pairs available; of these: 3630885 (13.72%) trimmed read pairs available after processing 22842017 (86.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 10 0.00% 21 12 0.00% 22 14 0.00% 23 23 0.00% 24 12 0.00% 25 24 0.00% 26 11 0.00% 27 23 0.00% 28 21 0.00% 29 20 0.00% 30 34 0.00% 31 40 0.00% 32 40 0.00% 33 38 0.00% 34 38 0.00% 35 45 0.00% 36 45 0.00% 37 32 0.00% 38 58 0.00% 39 44 0.00% 40 54 0.00% 41 50 0.00% 42 55 0.00% 43 57 0.00% 44 57 0.00% 45 53 0.00% 46 76 0.00% 47 92 0.00% 48 112 0.00% 49 130 0.00% 50 126 0.00% 51 153 0.00% 52 168 0.00% 53 159 0.00% 54 188 0.00% 55 209 0.00% 56 208 0.00% 57 290 0.00% 58 336 0.00% 59 381 0.00% 60 429 0.00% 61 517 0.00% 62 533 0.00% 63 678 0.00% 64 678 0.00% 65 701 0.00% 66 844 0.00% 67 986 0.00% 68 1128 0.00% 69 1263 0.00% 70 1394 0.01% 71 1605 0.01% 72 1871 0.01% 73 2177 0.01% 74 2670 0.01% 75 2734 0.01% 76 3147 0.01% 77 3419 0.01% 78 3947 0.01% 79 4414 0.02% 80 4985 0.02% 81 5447 0.02% 82 6211 0.02% 83 7029 0.03% 84 7943 0.03% 85 8986 0.03% 86 9690 0.04% 87 10419 0.04% 88 11571 0.04% 89 12513 0.05% 90 13503 0.05% 91 14836 0.06% 92 16224 0.06% 93 17670 0.07% 94 19579 0.07% 95 21075 0.08% 96 22593 0.09% 97 24054 0.09% 98 25516 0.10% 99 26950 0.10% 100 28434 0.11% 101 29566 0.11% 102 31402 0.12% 103 33072 0.12% 104 34914 0.13% 105 36931 0.14% 106 39779 0.15% 107 41109 0.16% 108 42492 0.16% 109 44209 0.17% 110 45084 0.17% 111 46195 0.17% 112 47506 0.18% 113 48819 0.18% 114 51397 0.19% 115 53470 0.20% 116 55467 0.21% 117 57427 0.22% 118 59608 0.23% 119 59588 0.23% 120 60485 0.23% 121 61911 0.23% 122 62371 0.24% 123 64385 0.24% 124 66844 0.25% 125 67498 0.25% 126 70007 0.26% 127 71489 0.27% 128 73040 0.28% 129 73480 0.28% 130 74180 0.28% 131 73945 0.28% 132 75286 0.28% 133 76776 0.29% 134 77531 0.29% 135 79166 0.30% 136 80040 0.30% 137 82068 0.31% 138 83324 0.31% 139 83547 0.32% 140 85121 0.32% 141 84392 0.32% 142 85640 0.32% 143 85192 0.32% 144 86456 0.33% 145 87294 0.33% 146 87659 0.33% 147 88476 0.33% 148 90359 0.34% 149 90651 0.34% 150 90323 0.34% 151 22842017 86.28% 26472902 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=35 prefix-density=0.55 prefix-fanout=2.3 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=493.60 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=38.7 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=27 prefix-density=0.52 prefix-fanout=2.8 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=330.89 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=32.3 sequence=AAGAAGAAGAAA SRR12161472 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:39:36 Started mapping on | Feb 13 17:39:36 Finished on | Feb 13 17:41:59 Mapping speed, Million of reads per hour | 666.45 Number of input reads | 26472902 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 22595500 Uniquely mapped reads % | 85.35% Average mapped length | 287.79 Number of splices: Total | 23113933 Number of splices: Annotated (sjdb) | 22557742 Number of splices: GT/AG | 22723090 Number of splices: GC/AG | 306847 Number of splices: AT/AC | 19722 Number of splices: Non-canonical | 64274 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514525 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 22662 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.55% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3362877 3362877 3362877 N_multimapping 514525 514525 514525 N_noFeature 853426 22407229 943462 N_ambiguous 344536 2108 245115 UnstrandedReadsAssigned:21397538 PositiveStrandReadsAssigned:186163 NegativeStrandReadsAssigned:21406923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161472-trimmed-pair1.fastq SRR12161472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,472,902 reads, 23,780,270 reads pseudoaligned [quant] estimated average fragment length: 237.637 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,307 rounds 52401 SRR12161472.ke.tsv 34699 SRR12161472.se.tsv 87100 total ==> SRR12161472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.36 2549 69.0733 Potri.005G024800.1.v4.1 1035 798.363 275 16.6274 Potri.004G059700.1.v4.1 961 724.449 90 5.99691 Potri.007G009000.2.v4.1 1416 1179.36 0 0 Potri.003G141000.2.v4.1 2943 2706.36 1092 19.4773 Potri.016G087400.1.v4.1 270 96.4037 1025.48 513.484 Potri.015G069301.1.v4.1 564 336.272 0 0 Potri.010G195200.1.v4.1 1773 1536.36 458 14.3901 Potri.012G127500.1.v4.1 977 740.4 7830 510.491 ==> SRR12161472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 509 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 359 SRR12161472 completed mapping pipeline successfully