Starting /dee2/code/volunteer_pipeline.sh SRR12161473 current disk space = 3088902729728 free memory = 1575859504 SRR12161473 SRAfilesize 1010e61ad23b18ff3ff16610116eae8b SRR12161473.sra SRR12161473.sra file validated SRR12161473 is paired end SRR12161473 is conventional basespace SRR12161473 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46925 37.0 37.0 37.0 37.0 37.0 2 36.4875 37.0 37.0 37.0 37.0 37.0 3 36.484 37.0 37.0 37.0 37.0 37.0 4 36.47 37.0 37.0 37.0 37.0 37.0 5 36.5485 37.0 37.0 37.0 37.0 37.0 6 36.633 37.0 37.0 37.0 37.0 37.0 7 36.47 37.0 37.0 37.0 37.0 37.0 8 36.4735 37.0 37.0 37.0 37.0 37.0 9 36.502 37.0 37.0 37.0 37.0 37.0 10-14 36.585300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.52140000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4778 37.0 37.0 37.0 37.0 37.0 25-29 36.417500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.392300000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3703 37.0 37.0 37.0 37.0 37.0 40-44 36.3669 37.0 37.0 37.0 37.0 37.0 45-49 36.404399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3158 37.0 37.0 37.0 37.0 37.0 55-59 36.3332 37.0 37.0 37.0 37.0 37.0 60-64 36.3027 37.0 37.0 37.0 37.0 37.0 65-69 36.25599999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2197 37.0 37.0 37.0 37.0 37.0 75-79 36.2252 37.0 37.0 37.0 37.0 37.0 80-84 36.186600000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1918 37.0 37.0 37.0 37.0 37.0 90-94 36.19670000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.193 37.0 37.0 37.0 37.0 37.0 100-104 36.05839999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.086200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.989999999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.018800000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.037400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.919200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9244 37.0 37.0 37.0 37.0 37.0 135-139 35.7967 37.0 37.0 37.0 37.0 37.0 140-144 35.7269 37.0 37.0 37.0 37.0 37.0 145-149 35.7418 37.0 37.0 37.0 37.0 37.0 150-151 35.51725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 2.0 26 1.0 27 5.0 28 11.0 29 22.0 30 35.0 31 44.0 32 61.0 33 93.0 34 130.0 35 309.0 36 2922.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15361521140856 13.25994495871904 7.430572929697273 41.155866900175134 2 20.25 14.05 35.3 30.4 3 17.5 16.75 27.150000000000002 38.6 4 21.224999999999998 24.45 24.275 30.049999999999997 5 23.325000000000003 28.975 25.35 22.35 6 20.125 34.449999999999996 23.425 22.0 7 15.2 27.400000000000002 40.275 17.125 8 17.299999999999997 26.674999999999997 31.5 24.525 9 15.425 25.95 34.599999999999994 24.025 10-14 18.735 30.070000000000004 28.299999999999997 22.895 15-19 19.455 28.99 27.944999999999997 23.61 20-24 18.895 29.54 28.349999999999998 23.215 25-29 18.95 28.58 28.875 23.595 30-34 19.36 29.25 27.815 23.575 35-39 19.13 29.154999999999998 28.285 23.43 40-44 18.675 28.825 28.754999999999995 23.745 45-49 18.94 29.37 28.43 23.26 50-54 19.16 29.15 27.855 23.835 55-59 19.245 29.299999999999997 28.025 23.43 60-64 19.42 28.365000000000002 28.255000000000003 23.96 65-69 18.865000000000002 28.815 28.599999999999998 23.72 70-74 18.945 28.515 28.595 23.945 75-79 19.265 28.360000000000003 28.79 23.585 80-84 19.145 28.685 28.18 23.990000000000002 85-89 19.794999999999998 29.465000000000003 27.49 23.25 90-94 20.32 28.199999999999996 27.96 23.52 95-99 19.21 29.12 28.525 23.145 100-104 19.5 28.79 28.535 23.175 105-109 19.900000000000002 28.33 28.389999999999997 23.380000000000003 110-114 19.525000000000002 28.144999999999996 28.32 24.01 115-119 20.275000000000002 28.910000000000004 27.775 23.04 120-124 19.575 28.904999999999998 28.249999999999996 23.27 125-129 19.595000000000002 28.58 28.185 23.64 130-134 19.915 29.67 27.04 23.375 135-139 19.595000000000002 28.565 28.285 23.555 140-144 20.335 28.705000000000002 28.02 22.939999999999998 145-149 20.02 28.95 27.625 23.405 150-151 19.9125 29.4375 27.500000000000004 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 3.5 25 3.5 26 2.0 27 3.0 28 7.0 29 8.5 30 10.5 31 16.5 32 28.5 33 43.5 34 54.0 35 70.0 36 103.5 37 135.5 38 148.0 39 172.5 40 212.5 41 254.5 42 282.5 43 288.0 44 298.5 45 308.5 46 298.5 47 265.5 48 231.5 49 205.0 50 156.5 51 117.0 52 95.5 53 63.0 54 40.0 55 29.0 56 20.0 57 13.0 58 5.5 59 1.0 60 0.5 61 0.0 62 0.5 63 0.5 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.8603057459146 89.97500000000001 2 4.876120189773326 9.25 3 0.23721665788086455 0.675 4 0.02635740643120717 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGG 10 0.006830828 145.0 145 >>END_MODULE SRR12161473 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161473_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3575 37.0 37.0 37.0 37.0 37.0 2 36.007 37.0 37.0 37.0 37.0 37.0 3 36.09 37.0 37.0 37.0 37.0 37.0 4 36.1575 37.0 37.0 37.0 37.0 37.0 5 36.2995 37.0 37.0 37.0 37.0 37.0 6 36.22 37.0 37.0 37.0 37.0 37.0 7 36.2165 37.0 37.0 37.0 37.0 37.0 8 36.141 37.0 37.0 37.0 37.0 37.0 9 36.148 37.0 37.0 37.0 37.0 37.0 10-14 36.2368 37.0 37.0 37.0 37.0 37.0 15-19 36.2628 37.0 37.0 37.0 37.0 37.0 20-24 36.257400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1313 37.0 37.0 37.0 37.0 37.0 30-34 36.1497 37.0 37.0 37.0 37.0 37.0 35-39 36.091899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1139 37.0 37.0 37.0 37.0 37.0 45-49 36.0548 37.0 37.0 37.0 37.0 37.0 50-54 36.005700000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9935 37.0 37.0 37.0 37.0 37.0 60-64 35.9756 37.0 37.0 37.0 37.0 37.0 65-69 35.9114 37.0 37.0 37.0 37.0 37.0 70-74 35.89790000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8383 37.0 37.0 37.0 37.0 37.0 80-84 35.838 37.0 37.0 37.0 37.0 37.0 85-89 35.8095 37.0 37.0 37.0 37.0 37.0 90-94 35.7105 37.0 37.0 37.0 37.0 37.0 95-99 35.765100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7645 37.0 37.0 37.0 37.0 37.0 105-109 35.6614 37.0 37.0 37.0 37.0 37.0 110-114 35.5638 37.0 37.0 37.0 37.0 37.0 115-119 35.6281 37.0 37.0 37.0 37.0 37.0 120-124 35.5897 37.0 37.0 37.0 37.0 37.0 125-129 35.522800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.445499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.411699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.285199999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.3642 37.0 37.0 37.0 37.0 37.0 150-151 35.00425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 1.0 17 2.0 18 0.0 19 0.0 20 0.0 21 3.0 22 4.0 23 5.0 24 6.0 25 6.0 26 8.0 27 15.0 28 18.0 29 22.0 30 34.0 31 49.0 32 68.0 33 111.0 34 216.0 35 600.0 36 2653.0 37 176.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 23.025000000000002 10.975 26.775 2 26.0 29.575000000000003 29.049999999999997 15.375 3 19.35 29.125 32.324999999999996 19.2 4 22.625 33.95 24.5 18.925 5 23.849999999999998 37.275000000000006 22.675 16.2 6 20.175 39.275 24.349999999999998 16.2 7 20.525 23.599999999999998 38.45 17.424999999999997 8 20.200000000000003 26.924999999999997 28.725 24.15 9 21.275 23.825 32.175 22.725 10-14 22.400000000000002 29.79 27.32 20.49 15-19 21.925 28.410000000000004 28.689999999999998 20.974999999999998 20-24 22.085 28.744999999999997 28.29 20.880000000000003 25-29 22.5 28.155 28.625 20.72 30-34 22.745 27.97 28.634999999999998 20.65 35-39 22.445 28.384999999999998 28.48 20.69 40-44 22.515 28.32 28.939999999999998 20.225 45-49 22.400000000000002 28.299999999999997 28.98 20.32 50-54 22.24 28.415000000000003 28.810000000000002 20.535 55-59 22.6 29.005 28.255000000000003 20.14 60-64 22.86 28.189999999999998 28.455000000000002 20.495 65-69 22.67 28.57 28.884999999999998 19.875 70-74 22.835 28.854999999999997 28.18 20.13 75-79 22.36 28.689999999999998 28.910000000000004 20.04 80-84 23.294999999999998 28.64 28.349999999999998 19.715 85-89 23.255 28.754999999999995 28.115000000000002 19.875 90-94 23.580000000000002 28.910000000000004 28.29 19.220000000000002 95-99 23.849999999999998 28.044999999999998 28.384999999999998 19.72 100-104 23.07 28.54 28.349999999999998 20.04 105-109 23.794999999999998 28.470000000000002 28.65 19.085 110-114 23.830000000000002 28.88 27.815 19.475 115-119 23.585 28.749999999999996 28.345 19.32 120-124 24.21 28.610000000000003 27.455000000000002 19.725 125-129 24.09 28.439999999999998 27.935 19.535 130-134 24.025 29.085 28.24 18.65 135-139 23.925 28.804999999999996 27.875 19.395 140-144 24.62 28.84 27.560000000000002 18.98 145-149 24.165 28.875 27.99 18.970000000000002 150-151 25.874999999999996 27.3375 28.512500000000003 18.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 4.5 26 6.5 27 3.5 28 4.5 29 10.5 30 15.5 31 25.5 32 33.0 33 38.5 34 59.0 35 84.5 36 104.5 37 123.0 38 141.0 39 190.5 40 238.5 41 269.0 42 301.5 43 316.5 44 303.0 45 291.0 46 277.5 47 235.5 48 220.0 49 193.5 50 141.5 51 107.5 52 84.5 53 66.0 54 41.0 55 19.5 56 13.5 57 10.5 58 5.0 59 1.5 60 1.0 61 1.5 62 1.0 63 0.5 64 0.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57528446679015 89.35 2 5.080709182323366 9.6 3 0.2910822969039428 0.8250000000000001 4 0.02646202699126753 0.1 5 0.02646202699126753 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9000000000000004 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAACA 10 0.006830828 145.0 2 AAAAAAA 65 0.0076375785 13.384615 10-14 >>END_MODULE Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722044 spots for SRR12161473.sra Written 1722044 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra Read 1722035 spots for SRR12161473.sra Written 1722035 spots for SRR12161473.sra SRR ids: ['SRR12161473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mvk44d7z SRR12161473.sra spots: 34440709 blocks: [[1, 1722035], [1722036, 3444070], [3444071, 5166105], [5166106, 6888140], [6888141, 8610175], [8610176, 10332210], [10332211, 12054245], [12054246, 13776280], [13776281, 15498315], [15498316, 17220350], [17220351, 18942385], [18942386, 20664420], [20664421, 22386455], [22386456, 24108490], [24108491, 25830525], [25830526, 27552560], [27552561, 29274595], [29274596, 30996630], [30996631, 32718665], [32718666, 34440709]] SRR12161473 file size 11682759 SRR12161473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161473 SRR12161473_1.fastq SRR12161473_2.fastq Input file: SRR12161473_1.fastq Paired file: SRR12161473_2.fastq trimmed: SRR12161473-trimmed-pair1.fastq, SRR12161473-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:42:35 2025 >> started Fri Feb 14 01:43:14 2025 >> done (38.662s) 34440709 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 3707 ( 0.01%) empty read pairs filtered out after trimming by size control 34436947 (99.99%) read pairs available; of these: 2391271 ( 6.94%) trimmed read pairs available after processing 32045676 (93.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 6 0.00% 25 6 0.00% 26 15 0.00% 27 19 0.00% 28 22 0.00% 29 15 0.00% 30 21 0.00% 31 13 0.00% 32 22 0.00% 33 20 0.00% 34 23 0.00% 35 16 0.00% 36 18 0.00% 37 26 0.00% 38 20 0.00% 39 25 0.00% 40 32 0.00% 41 31 0.00% 42 38 0.00% 43 38 0.00% 44 30 0.00% 45 39 0.00% 46 41 0.00% 47 49 0.00% 48 55 0.00% 49 66 0.00% 50 68 0.00% 51 78 0.00% 52 68 0.00% 53 91 0.00% 54 102 0.00% 55 84 0.00% 56 103 0.00% 57 107 0.00% 58 106 0.00% 59 145 0.00% 60 136 0.00% 61 215 0.00% 62 215 0.00% 63 221 0.00% 64 281 0.00% 65 281 0.00% 66 285 0.00% 67 345 0.00% 68 426 0.00% 69 457 0.00% 70 499 0.00% 71 591 0.00% 72 658 0.00% 73 864 0.00% 74 826 0.00% 75 926 0.00% 76 1190 0.00% 77 1198 0.00% 78 1394 0.00% 79 1522 0.00% 80 1655 0.00% 81 1897 0.01% 82 2206 0.01% 83 2558 0.01% 84 2849 0.01% 85 3264 0.01% 86 3541 0.01% 87 3798 0.01% 88 4179 0.01% 89 4491 0.01% 90 5038 0.01% 91 5530 0.02% 92 6270 0.02% 93 7118 0.02% 94 7849 0.02% 95 8505 0.02% 96 9199 0.03% 97 9873 0.03% 98 10649 0.03% 99 11288 0.03% 100 12017 0.03% 101 12734 0.04% 102 14027 0.04% 103 15233 0.04% 104 16278 0.05% 105 17502 0.05% 106 18725 0.05% 107 19730 0.06% 108 20813 0.06% 109 21665 0.06% 110 22574 0.07% 111 23697 0.07% 112 24945 0.07% 113 25743 0.07% 114 27919 0.08% 115 29339 0.09% 116 30796 0.09% 117 32116 0.09% 118 33416 0.10% 119 34870 0.10% 120 35728 0.10% 121 37069 0.11% 122 38038 0.11% 123 40081 0.12% 124 41784 0.12% 125 42987 0.12% 126 44716 0.13% 127 46305 0.13% 128 48483 0.14% 129 49093 0.14% 130 51001 0.15% 131 51400 0.15% 132 53206 0.15% 133 55172 0.16% 134 56433 0.16% 135 58114 0.17% 136 59726 0.17% 137 61366 0.18% 138 63542 0.18% 139 64273 0.19% 140 66637 0.19% 141 67459 0.20% 142 68989 0.20% 143 70294 0.20% 144 72663 0.21% 145 73940 0.21% 146 75142 0.22% 147 77216 0.22% 148 78431 0.23% 149 80174 0.23% 150 81698 0.24% 151 32045676 93.06% 34436947 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=2.1 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=576.69 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=36.6 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=34 prefix-density=0.44 prefix-fanout=2.9 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=496.38 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=32.1 sequence=AAGAAGAAGAAG SRR12161473 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:44:02 Started mapping on | Feb 14 01:44:02 Finished on | Feb 14 01:47:41 Mapping speed, Million of reads per hour | 566.09 Number of input reads | 34436947 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 32877537 Uniquely mapped reads % | 95.47% Average mapped length | 297.85 Number of splices: Total | 36189818 Number of splices: Annotated (sjdb) | 35418584 Number of splices: GT/AG | 35598639 Number of splices: GC/AG | 475771 Number of splices: AT/AC | 28858 Number of splices: Non-canonical | 86550 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 772091 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 29548 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787319 787319 787319 N_multimapping 772091 772091 772091 N_noFeature 1005156 32613165 1122689 N_ambiguous 332449 1441 184842 UnstrandedReadsAssigned:31539932 PositiveStrandReadsAssigned:262931 NegativeStrandReadsAssigned:31570006 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161473 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161473-trimmed-pair1.fastq SRR12161473-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,436,947 reads, 31,440,686 reads pseudoaligned [quant] estimated average fragment length: 267.073 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR12161473.ke.tsv 34699 SRR12161473.se.tsv 87100 total ==> SRR12161473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.93 2611 47.0394 Potri.005G024800.1.v4.1 1035 768.927 456 18.7176 Potri.004G059700.1.v4.1 961 695.123 123 5.58489 Potri.007G009000.2.v4.1 1416 1149.93 0 0 Potri.003G141000.2.v4.1 2943 2676.93 1273.79 15.0188 Potri.016G087400.1.v4.1 270 76.4135 2358 973.969 Potri.015G069301.1.v4.1 564 310.711 0 0 Potri.010G195200.1.v4.1 1773 1506.93 610 12.7764 Potri.012G127500.1.v4.1 977 711.039 4692 208.274 ==> SRR12161473.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 899 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 399 SRR12161473 completed mapping pipeline successfully