Starting /dee2/code/volunteer_pipeline.sh SRR12161474 current disk space = 3088905519104 free memory = 1582743772 SRR12161474 SRAfilesize 965c85a462358163f25d1d0fafc29543 SRR12161474.sra SRR12161474.sra file validated SRR12161474 is paired end SRR12161474 is conventional basespace SRR12161474 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43675 37.0 37.0 37.0 37.0 37.0 2 36.351 37.0 37.0 37.0 37.0 37.0 3 36.421 37.0 37.0 37.0 37.0 37.0 4 36.5085 37.0 37.0 37.0 37.0 37.0 5 36.56 37.0 37.0 37.0 37.0 37.0 6 36.559 37.0 37.0 37.0 37.0 37.0 7 36.464 37.0 37.0 37.0 37.0 37.0 8 36.4555 37.0 37.0 37.0 37.0 37.0 9 36.4695 37.0 37.0 37.0 37.0 37.0 10-14 36.48910000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4968 37.0 37.0 37.0 37.0 37.0 20-24 36.48010000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.37949999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.395199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3724 37.0 37.0 37.0 37.0 37.0 40-44 36.334799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3146 37.0 37.0 37.0 37.0 37.0 50-54 36.3429 37.0 37.0 37.0 37.0 37.0 55-59 36.305400000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.29019999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.243399999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.21959999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.15840000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1579 37.0 37.0 37.0 37.0 37.0 85-89 36.06529999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.1101 37.0 37.0 37.0 37.0 37.0 95-99 36.1025 37.0 37.0 37.0 37.0 37.0 100-104 36.059000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.0127 37.0 37.0 37.0 37.0 37.0 110-114 35.930400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.95910000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0005 37.0 37.0 37.0 37.0 37.0 125-129 35.9747 37.0 37.0 37.0 37.0 37.0 130-134 35.9058 37.0 37.0 37.0 37.0 37.0 135-139 35.819 37.0 37.0 37.0 37.0 37.0 140-144 35.7192 37.0 37.0 37.0 37.0 37.0 145-149 35.699600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.50925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 4.0 25 2.0 26 4.0 27 9.0 28 13.0 29 22.0 30 37.0 31 46.0 32 50.0 33 83.0 34 133.0 35 331.0 36 2960.0 37 304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.95369211514393 11.989987484355444 5.607008760951189 39.44931163954944 2 19.825 11.95 34.775 33.45 3 16.975 15.1 28.549999999999997 39.375 4 21.275 23.825 26.075 28.825 5 21.3 29.799999999999997 25.674999999999997 23.225 6 20.875 33.550000000000004 24.85 20.724999999999998 7 16.075 28.449999999999996 39.800000000000004 15.675 8 16.775000000000002 26.200000000000003 32.574999999999996 24.45 9 17.45 23.599999999999998 35.525 23.425 10-14 19.12 30.415 28.249999999999996 22.215 15-19 19.56 28.605000000000004 28.625 23.21 20-24 19.32 28.910000000000004 28.27 23.5 25-29 19.33 28.51 28.345 23.815 30-34 19.689999999999998 29.01 27.839999999999996 23.46 35-39 19.41 28.865000000000002 28.49 23.235 40-44 19.5 29.160000000000004 27.975 23.365 45-49 19.67 28.720000000000002 28.395 23.215 50-54 19.23 28.4 28.694999999999997 23.674999999999997 55-59 19.445 28.634999999999998 28.035 23.885 60-64 19.475 28.205000000000002 28.32 24.0 65-69 19.405 28.435 28.470000000000002 23.69 70-74 19.68 28.110000000000003 28.34 23.87 75-79 19.66 28.194999999999997 28.26 23.885 80-84 20.0 28.59 28.32 23.09 85-89 20.349999999999998 28.02 28.389999999999997 23.24 90-94 19.85 28.74 28.01 23.400000000000002 95-99 19.49 28.985 28.205000000000002 23.32 100-104 20.05 28.685 27.800000000000004 23.465 105-109 19.96 28.084999999999997 28.360000000000003 23.595 110-114 19.915 28.615000000000002 27.525 23.945 115-119 19.805 28.660000000000004 28.189999999999998 23.345 120-124 19.814999999999998 28.294999999999998 27.694999999999997 24.195 125-129 20.445 28.265 27.6 23.69 130-134 20.05 29.2 27.834999999999997 22.915 135-139 20.345 28.189999999999998 27.779999999999998 23.685000000000002 140-144 20.549999999999997 28.67 27.185 23.595 145-149 20.32 28.605000000000004 27.435 23.64 150-151 19.9375 28.5625 27.3625 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 5.0 27 8.0 28 7.5 29 10.0 30 12.0 31 13.0 32 20.5 33 37.0 34 48.0 35 60.5 36 89.5 37 114.5 38 142.0 39 170.5 40 224.0 41 267.5 42 278.0 43 298.0 44 302.0 45 292.5 46 282.5 47 257.0 48 221.0 49 196.0 50 170.0 51 136.5 52 110.0 53 81.0 54 50.5 55 31.5 56 21.0 57 17.0 58 12.0 59 5.0 60 2.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.19306540583136 90.60000000000001 2 4.544260572629367 8.649999999999999 3 0.2626740215392698 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATA 10 0.006830828 145.0 1 AGAACTT 10 0.006830828 145.0 3 >>END_MODULE SRR12161474 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161474_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.187 37.0 37.0 37.0 37.0 37.0 2 35.947 37.0 37.0 37.0 37.0 37.0 3 35.9495 37.0 37.0 37.0 37.0 37.0 4 36.0255 37.0 37.0 37.0 37.0 37.0 5 36.102 37.0 37.0 37.0 37.0 37.0 6 36.222 37.0 37.0 37.0 37.0 37.0 7 36.1025 37.0 37.0 37.0 37.0 37.0 8 36.1015 37.0 37.0 37.0 37.0 37.0 9 36.179 37.0 37.0 37.0 37.0 37.0 10-14 36.199799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1519 37.0 37.0 37.0 37.0 37.0 20-24 36.1366 37.0 37.0 37.0 37.0 37.0 25-29 36.1284 37.0 37.0 37.0 37.0 37.0 30-34 36.0857 37.0 37.0 37.0 37.0 37.0 35-39 36.0235 37.0 37.0 37.0 37.0 37.0 40-44 36.0095 37.0 37.0 37.0 37.0 37.0 45-49 35.96650000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.91510000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9374 37.0 37.0 37.0 37.0 37.0 60-64 35.866800000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.8461 37.0 37.0 37.0 37.0 37.0 70-74 35.80309999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.802800000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.7656 37.0 37.0 37.0 37.0 37.0 85-89 35.7777 37.0 37.0 37.0 37.0 37.0 90-94 35.6269 37.0 37.0 37.0 37.0 37.0 95-99 35.6692 37.0 37.0 37.0 37.0 37.0 100-104 35.686099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5967 37.0 37.0 37.0 37.0 37.0 110-114 35.5869 37.0 37.0 37.0 37.0 37.0 115-119 35.616 37.0 37.0 37.0 37.0 37.0 120-124 35.5903 37.0 37.0 37.0 37.0 37.0 125-129 35.504400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.507600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4484 37.0 37.0 37.0 37.0 37.0 140-144 35.299099999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.3449 37.0 37.0 37.0 34.6 37.0 150-151 34.8375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 3.0 22 6.0 23 6.0 24 5.0 25 12.0 26 6.0 27 10.0 28 23.0 29 22.0 30 31.0 31 40.0 32 73.0 33 121.0 34 217.0 35 594.0 36 2594.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.725 24.5 10.525 25.25 2 27.625 27.375 29.875 15.125 3 20.75 27.875 31.8 19.575 4 22.8 34.425 23.825 18.95 5 24.325 37.55 21.45 16.675 6 20.65 40.525 21.6 17.224999999999998 7 20.3 23.724999999999998 37.55 18.425 8 21.925 25.95 29.299999999999997 22.825 9 21.925 24.474999999999998 31.125000000000004 22.475 10-14 23.330000000000002 29.755 26.229999999999997 20.685000000000002 15-19 23.200000000000003 28.74 27.505000000000003 20.555 20-24 23.330000000000002 29.115000000000002 27.750000000000004 19.805 25-29 23.335 28.465 27.315 20.885 30-34 22.78 28.685 28.165000000000003 20.369999999999997 35-39 23.005 27.58 28.63 20.785 40-44 23.21 28.125 28.52 20.145 45-49 23.125 27.74 28.560000000000002 20.575 50-54 22.900000000000002 28.715000000000003 28.065 20.32 55-59 23.115 28.83 28.16 19.895 60-64 23.51 29.01 27.644999999999996 19.835 65-69 22.814999999999998 27.875 29.154999999999998 20.155 70-74 23.735 28.535 27.465 20.265 75-79 23.455000000000002 28.335 28.525 19.685 80-84 22.97 28.62 28.48 19.93 85-89 23.345 28.945 27.665 20.044999999999998 90-94 23.95 28.515 27.450000000000003 20.085 95-99 22.665 28.175 28.9 20.26 100-104 24.335 27.834999999999997 27.889999999999997 19.939999999999998 105-109 24.25 28.285 27.950000000000003 19.515 110-114 23.18 28.544999999999998 28.205000000000002 20.07 115-119 23.685000000000002 28.470000000000002 28.110000000000003 19.735 120-124 24.060000000000002 28.565 27.845 19.53 125-129 24.14 27.905 27.779999999999998 20.175 130-134 24.240000000000002 28.54 28.07 19.15 135-139 24.834999999999997 28.51 27.325 19.33 140-144 24.595 28.939999999999998 27.134999999999998 19.33 145-149 25.115 28.935 26.889999999999997 19.06 150-151 24.15 28.812500000000004 27.425 19.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.0 9 1.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 2.0 25 1.5 26 2.0 27 3.0 28 6.0 29 9.0 30 10.0 31 18.5 32 27.0 33 27.5 34 37.5 35 64.0 36 92.0 37 126.5 38 156.5 39 180.0 40 224.0 41 265.5 42 275.5 43 281.5 44 311.0 45 316.5 46 293.0 47 257.0 48 215.5 49 193.5 50 165.0 51 121.5 52 92.5 53 74.5 54 48.5 55 29.0 56 21.0 57 14.0 58 7.0 59 2.5 60 3.5 61 3.0 62 1.0 63 0.5 64 0.5 65 0.5 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04872267579668 90.225 2 4.635238346062681 8.799999999999999 3 0.26336581511719775 0.75 4 0.02633658151171978 0.1 5 0.02633658151171978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.8499999999999996 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.375 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTGC 10 0.006830828 145.0 145 GCATGAA 10 0.006830828 145.0 2 >>END_MODULE Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474190 spots for SRR12161474.sra Written 1474190 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra Read 1474188 spots for SRR12161474.sra Written 1474188 spots for SRR12161474.sra SRR ids: ['SRR12161474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6tqafq1 SRR12161474.sra spots: 29483762 blocks: [[1, 1474188], [1474189, 2948376], [2948377, 4422564], [4422565, 5896752], [5896753, 7370940], [7370941, 8845128], [8845129, 10319316], [10319317, 11793504], [11793505, 13267692], [13267693, 14741880], [14741881, 16216068], [16216069, 17690256], [17690257, 19164444], [19164445, 20638632], [20638633, 22112820], [22112821, 23587008], [23587009, 25061196], [25061197, 26535384], [26535385, 28009572], [28009573, 29483762]] SRR12161474 file size 9998171 SRR12161474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161474 SRR12161474_1.fastq SRR12161474_2.fastq Input file: SRR12161474_1.fastq Paired file: SRR12161474_2.fastq trimmed: SRR12161474-trimmed-pair1.fastq, SRR12161474-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:43:34 2025 >> started Fri Feb 14 01:44:06 2025 >> done (31.655s) 29483762 read pairs processed; of these: 43 ( 0.00%) short read pairs filtered out after trimming by size control 6022 ( 0.02%) empty read pairs filtered out after trimming by size control 29477697 (99.98%) read pairs available; of these: 2134550 ( 7.24%) trimmed read pairs available after processing 27343147 (92.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 9 0.00% 24 11 0.00% 25 8 0.00% 26 10 0.00% 27 13 0.00% 28 16 0.00% 29 20 0.00% 30 22 0.00% 31 13 0.00% 32 24 0.00% 33 27 0.00% 34 25 0.00% 35 26 0.00% 36 31 0.00% 37 24 0.00% 38 29 0.00% 39 25 0.00% 40 22 0.00% 41 25 0.00% 42 36 0.00% 43 37 0.00% 44 39 0.00% 45 40 0.00% 46 31 0.00% 47 51 0.00% 48 48 0.00% 49 50 0.00% 50 53 0.00% 51 79 0.00% 52 61 0.00% 53 72 0.00% 54 88 0.00% 55 71 0.00% 56 96 0.00% 57 90 0.00% 58 128 0.00% 59 136 0.00% 60 139 0.00% 61 181 0.00% 62 169 0.00% 63 222 0.00% 64 211 0.00% 65 226 0.00% 66 262 0.00% 67 295 0.00% 68 318 0.00% 69 339 0.00% 70 400 0.00% 71 432 0.00% 72 529 0.00% 73 573 0.00% 74 744 0.00% 75 770 0.00% 76 867 0.00% 77 859 0.00% 78 1017 0.00% 79 1116 0.00% 80 1312 0.00% 81 1485 0.01% 82 1740 0.01% 83 1947 0.01% 84 2211 0.01% 85 2578 0.01% 86 2626 0.01% 87 2974 0.01% 88 3407 0.01% 89 3477 0.01% 90 3934 0.01% 91 4460 0.02% 92 4997 0.02% 93 5490 0.02% 94 6086 0.02% 95 6925 0.02% 96 7471 0.03% 97 8034 0.03% 98 8475 0.03% 99 9296 0.03% 100 9974 0.03% 101 10734 0.04% 102 11693 0.04% 103 12707 0.04% 104 13748 0.05% 105 14725 0.05% 106 15603 0.05% 107 16932 0.06% 108 17749 0.06% 109 18717 0.06% 110 19755 0.07% 111 20750 0.07% 112 21753 0.07% 113 23102 0.08% 114 24626 0.08% 115 25792 0.09% 116 27023 0.09% 117 28080 0.10% 118 29540 0.10% 119 30464 0.10% 120 32006 0.11% 121 33191 0.11% 122 34065 0.12% 123 35706 0.12% 124 37302 0.13% 125 38567 0.13% 126 40233 0.14% 127 41751 0.14% 128 42899 0.15% 129 44040 0.15% 130 45198 0.15% 131 46447 0.16% 132 48317 0.16% 133 49962 0.17% 134 51090 0.17% 135 52886 0.18% 136 54709 0.19% 137 56150 0.19% 138 57838 0.20% 139 58268 0.20% 140 59979 0.20% 141 61372 0.21% 142 63436 0.22% 143 64489 0.22% 144 66057 0.22% 145 67858 0.23% 146 68862 0.23% 147 69646 0.24% 148 71720 0.24% 149 72711 0.25% 150 74125 0.25% 151 27343147 92.76% 29477697 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=82.41 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=CTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=346.67 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.6 sequence=GAAGAAGAAGAAA SRR12161474 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:44:50 Started mapping on | Feb 14 01:44:50 Finished on | Feb 14 01:47:51 Mapping speed, Million of reads per hour | 586.30 Number of input reads | 29477697 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 28005848 Uniquely mapped reads % | 95.01% Average mapped length | 297.81 Number of splices: Total | 30359109 Number of splices: Annotated (sjdb) | 29762260 Number of splices: GT/AG | 29876670 Number of splices: GC/AG | 388951 Number of splices: AT/AC | 24702 Number of splices: Non-canonical | 68786 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 643262 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 28800 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 828587 828587 828587 N_multimapping 643262 643262 643262 N_noFeature 692838 27770988 798077 N_ambiguous 276646 1204 146388 UnstrandedReadsAssigned:27036364 PositiveStrandReadsAssigned:233656 NegativeStrandReadsAssigned:27061383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161474 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161474-trimmed-pair1.fastq SRR12161474-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,477,697 reads, 26,982,282 reads pseudoaligned [quant] estimated average fragment length: 261.908 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12161474.ke.tsv 34699 SRR12161474.se.tsv 87100 total ==> SRR12161474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.09 2003 43.0292 Potri.005G024800.1.v4.1 1035 774.092 345 16.823 Potri.004G059700.1.v4.1 961 700.206 63 3.39619 Potri.007G009000.2.v4.1 1416 1155.09 0 0 Potri.003G141000.2.v4.1 2943 2682.09 947.259 13.3313 Potri.016G087400.1.v4.1 270 76.629 1783 878.283 Potri.015G069301.1.v4.1 564 313.824 0 0 Potri.010G195200.1.v4.1 1773 1512.09 177 4.41847 Potri.012G127500.1.v4.1 977 716.136 3246 171.092 ==> SRR12161474.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 587 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 147 SRR12161474 completed mapping pipeline successfully