Starting /dee2/code/volunteer_pipeline.sh SRR12161475 current disk space = 3088868958208 free memory = 1581583740 SRR12161475 SRAfilesize 8401aaf16dfaa7d0f4a8451bf1cbaec8 SRR12161475.sra SRR12161475.sra file validated SRR12161475 is paired end SRR12161475 is conventional basespace SRR12161475 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48725 37.0 37.0 37.0 37.0 37.0 2 36.39 37.0 37.0 37.0 37.0 37.0 3 36.504 37.0 37.0 37.0 37.0 37.0 4 36.488 37.0 37.0 37.0 37.0 37.0 5 36.5805 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.5215 37.0 37.0 37.0 37.0 37.0 8 36.512 37.0 37.0 37.0 37.0 37.0 9 36.525 37.0 37.0 37.0 37.0 37.0 10-14 36.546099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.48479999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.516200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.434400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3675 37.0 37.0 37.0 37.0 37.0 35-39 36.3678 37.0 37.0 37.0 37.0 37.0 40-44 36.3225 37.0 37.0 37.0 37.0 37.0 45-49 36.388799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.345499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.272000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.2752 37.0 37.0 37.0 37.0 37.0 65-69 36.2682 37.0 37.0 37.0 37.0 37.0 70-74 36.224199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.187400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1628 37.0 37.0 37.0 37.0 37.0 85-89 36.0881 37.0 37.0 37.0 37.0 37.0 90-94 36.120400000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1279 37.0 37.0 37.0 37.0 37.0 100-104 36.04639999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.07110000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9486 37.0 37.0 37.0 37.0 37.0 115-119 36.0407 37.0 37.0 37.0 37.0 37.0 120-124 36.048500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.898900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.887499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.7595 37.0 37.0 37.0 37.0 37.0 140-144 35.7802 37.0 37.0 37.0 37.0 37.0 145-149 35.758500000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.573499999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 2.0 26 6.0 27 9.0 28 14.0 29 20.0 30 25.0 31 29.0 32 53.0 33 94.0 34 140.0 35 358.0 36 2953.0 37 293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.250688016012006 13.610207655741807 7.780835626720039 44.35826870152614 2 19.825 13.525 35.05 31.6 3 15.049999999999999 16.325 28.225 40.400000000000006 4 18.9 24.15 25.5 31.45 5 21.425 28.9 26.825 22.85 6 21.075 33.45 23.45 22.025 7 13.825000000000001 28.349999999999998 40.975 16.85 8 16.7 27.650000000000002 31.624999999999996 24.025 9 16.175 25.674999999999997 35.65 22.5 10-14 18.55 30.61 28.634999999999998 22.205 15-19 18.59 29.025000000000002 28.73 23.655 20-24 19.07 29.735 28.205000000000002 22.99 25-29 18.615000000000002 29.59 28.705000000000002 23.09 30-34 18.825 29.459999999999997 28.29 23.425 35-39 18.790000000000003 29.770000000000003 28.18 23.26 40-44 19.25 29.005 28.634999999999998 23.11 45-49 18.485 29.54 28.389999999999997 23.585 50-54 19.53 28.904999999999998 28.055000000000003 23.51 55-59 19.575 29.01 27.779999999999998 23.635 60-64 18.785 29.160000000000004 28.07 23.985 65-69 19.025 29.604999999999997 27.76 23.61 70-74 19.215 29.07 28.205000000000002 23.51 75-79 19.134999999999998 29.015 28.410000000000004 23.44 80-84 19.25 28.9 27.994999999999997 23.855 85-89 19.075 29.34 27.855 23.73 90-94 19.134999999999998 28.689999999999998 28.505000000000003 23.669999999999998 95-99 19.11 28.785 28.854999999999997 23.25 100-104 19.31 28.37 28.62 23.7 105-109 19.235 28.735 28.485 23.544999999999998 110-114 19.475 28.9 28.025 23.599999999999998 115-119 19.57 28.93 27.474999999999998 24.025 120-124 19.555 28.7 28.285 23.46 125-129 19.63 28.625 27.689999999999998 24.055 130-134 19.445 29.26 27.71 23.585 135-139 19.634999999999998 28.675 28.38 23.31 140-144 19.67 27.77 28.349999999999998 24.21 145-149 20.169999999999998 28.720000000000002 27.495000000000005 23.615 150-151 20.5375 28.4 27.750000000000004 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 0.5 24 2.0 25 3.0 26 3.0 27 4.0 28 7.5 29 11.5 30 14.5 31 26.0 32 34.5 33 42.5 34 66.5 35 83.5 36 103.5 37 132.5 38 156.5 39 181.0 40 214.5 41 259.5 42 290.5 43 302.5 44 314.5 45 304.0 46 276.0 47 259.0 48 238.0 49 189.5 50 141.5 51 111.5 52 78.0 53 54.0 54 35.0 55 19.5 56 12.0 57 7.5 58 6.5 59 5.0 60 2.5 61 1.0 62 0.5 63 0.0 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.5781539275324 89.4 2 5.07802168738429 9.6 3 0.3173763554615181 0.8999999999999999 4 0.026448029621793177 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.6499999999999999 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.15 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161475 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0325 37.0 37.0 37.0 37.0 37.0 2 35.685 37.0 37.0 37.0 37.0 37.0 3 35.9065 37.0 37.0 37.0 37.0 37.0 4 35.837 37.0 37.0 37.0 37.0 37.0 5 36.0535 37.0 37.0 37.0 37.0 37.0 6 35.9595 37.0 37.0 37.0 37.0 37.0 7 36.163 37.0 37.0 37.0 37.0 37.0 8 35.928 37.0 37.0 37.0 37.0 37.0 9 36.0665 37.0 37.0 37.0 37.0 37.0 10-14 36.0661 37.0 37.0 37.0 37.0 37.0 15-19 36.06170000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0069 37.0 37.0 37.0 37.0 37.0 25-29 35.9216 37.0 37.0 37.0 37.0 37.0 30-34 35.972500000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.891200000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.89960000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.8855 37.0 37.0 37.0 37.0 37.0 50-54 35.8577 37.0 37.0 37.0 37.0 37.0 55-59 35.8135 37.0 37.0 37.0 37.0 37.0 60-64 35.7044 37.0 37.0 37.0 37.0 37.0 65-69 35.7505 37.0 37.0 37.0 37.0 37.0 70-74 35.7365 37.0 37.0 37.0 37.0 37.0 75-79 35.7036 37.0 37.0 37.0 37.0 37.0 80-84 35.641200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.601299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.5772 37.0 37.0 37.0 37.0 37.0 95-99 35.5834 37.0 37.0 37.0 37.0 37.0 100-104 35.538799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.5069 37.0 37.0 37.0 34.6 37.0 110-114 35.37259999999999 37.0 37.0 37.0 34.6 37.0 115-119 35.4525 37.0 37.0 37.0 37.0 37.0 120-124 35.3405 37.0 37.0 37.0 34.6 37.0 125-129 35.3308 37.0 37.0 37.0 34.6 37.0 130-134 35.2403 37.0 37.0 37.0 27.4 37.0 135-139 35.23049999999999 37.0 37.0 37.0 27.4 37.0 140-144 35.0657 37.0 37.0 37.0 25.0 37.0 145-149 35.1142 37.0 37.0 37.0 27.4 37.0 150-151 34.728 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 0.0 16 2.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 4.0 23 8.0 24 8.0 25 10.0 26 12.0 27 14.0 28 24.0 29 25.0 30 43.0 31 69.0 32 82.0 33 116.0 34 251.0 35 753.0 36 2414.0 37 157.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.975 24.8 11.95 29.275000000000002 2 25.124999999999996 28.050000000000004 30.85 15.975 3 19.3 28.975 31.65 20.075000000000003 4 20.375 34.675 26.6 18.35 5 23.625 37.525 22.525000000000002 16.325 6 20.525 40.0 23.5 15.975 7 20.4 24.9 36.975 17.724999999999998 8 20.549999999999997 27.075 28.349999999999998 24.025 9 21.975 25.374999999999996 31.025000000000002 21.625 10-14 23.07 29.715000000000003 27.169999999999998 20.044999999999998 15-19 22.785 28.345 28.84 20.03 20-24 22.814999999999998 28.675 28.249999999999996 20.26 25-29 22.725 28.65 28.015 20.61 30-34 22.49 29.205 27.894999999999996 20.41 35-39 22.575 28.96 28.285 20.18 40-44 23.125 28.765 27.97 20.14 45-49 23.14 28.305000000000003 28.884999999999998 19.67 50-54 22.85 29.34 28.050000000000004 19.759999999999998 55-59 23.025000000000002 28.860000000000003 28.12 19.994999999999997 60-64 22.919999999999998 28.860000000000003 28.33 19.89 65-69 23.75 28.62 28.24 19.39 70-74 23.39 28.955 28.055000000000003 19.6 75-79 23.28 29.01 28.03 19.68 80-84 23.395 28.89 28.189999999999998 19.525000000000002 85-89 23.735 28.68 27.73 19.855 90-94 23.5 28.375 28.215 19.91 95-99 23.605 28.62 28.310000000000002 19.465 100-104 23.665 28.055000000000003 28.645 19.634999999999998 105-109 23.799999999999997 28.315 28.395 19.49 110-114 24.474999999999998 28.634999999999998 28.22 18.67 115-119 23.96 28.335 28.244999999999997 19.46 120-124 23.435 28.694999999999997 28.265 19.605 125-129 24.044999999999998 28.384999999999998 28.560000000000002 19.009999999999998 130-134 24.395 28.77 27.595 19.24 135-139 24.575 27.665 28.660000000000004 19.1 140-144 24.395 28.994999999999997 27.689999999999998 18.92 145-149 25.105 28.384999999999998 27.505000000000003 19.005 150-151 25.837500000000002 27.9125 27.6625 18.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 2.5 24 1.5 25 3.5 26 5.5 27 4.0 28 5.5 29 8.5 30 12.5 31 20.5 32 25.5 33 37.0 34 62.0 35 76.0 36 99.5 37 135.0 38 172.0 39 204.0 40 233.0 41 280.5 42 296.0 43 290.0 44 289.0 45 288.5 46 299.0 47 257.0 48 213.0 49 181.5 50 144.0 51 113.5 52 72.5 53 51.5 54 33.5 55 23.0 56 17.0 57 11.0 58 8.5 59 5.0 60 1.5 61 0.0 62 0.5 63 1.0 64 0.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.81755684822845 89.64999999999999 2 4.812268640930725 9.1 3 0.29085140137493387 0.8250000000000001 4 0.052882072977260705 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026441036488630353 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCTG 10 0.006830828 145.0 5 TTTTTTT 60 0.004491891 14.500001 15-19 >>END_MODULE Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra Read 1634808 spots for SRR12161475.sra Written 1634808 spots for SRR12161475.sra Read 1634792 spots for SRR12161475.sra Written 1634792 spots for SRR12161475.sra SRR ids: ['SRR12161475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nzqh7qae SRR12161475.sra spots: 32695856 blocks: [[1, 1634792], [1634793, 3269584], [3269585, 4904376], [4904377, 6539168], [6539169, 8173960], [8173961, 9808752], [9808753, 11443544], [11443545, 13078336], [13078337, 14713128], [14713129, 16347920], [16347921, 17982712], [17982713, 19617504], [19617505, 21252296], [21252297, 22887088], [22887089, 24521880], [24521881, 26156672], [26156673, 27791464], [27791465, 29426256], [29426257, 31061048], [31061049, 32695856]] SRR12161475 file size 11089781 SRR12161475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161475 SRR12161475_1.fastq SRR12161475_2.fastq Input file: SRR12161475_1.fastq Paired file: SRR12161475_2.fastq trimmed: SRR12161475-trimmed-pair1.fastq, SRR12161475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:45:39 2025 >> started Fri Feb 14 01:46:15 2025 >> done (36.181s) 32695856 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 3295 ( 0.01%) empty read pairs filtered out after trimming by size control 32692527 (99.99%) read pairs available; of these: 2031125 ( 6.21%) trimmed read pairs available after processing 30661402 (93.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 8 0.00% 22 3 0.00% 23 9 0.00% 24 4 0.00% 25 4 0.00% 26 13 0.00% 27 10 0.00% 28 10 0.00% 29 6 0.00% 30 9 0.00% 31 11 0.00% 32 13 0.00% 33 17 0.00% 34 11 0.00% 35 6 0.00% 36 19 0.00% 37 24 0.00% 38 24 0.00% 39 23 0.00% 40 26 0.00% 41 39 0.00% 42 33 0.00% 43 22 0.00% 44 24 0.00% 45 25 0.00% 46 35 0.00% 47 34 0.00% 48 44 0.00% 49 46 0.00% 50 49 0.00% 51 58 0.00% 52 52 0.00% 53 52 0.00% 54 67 0.00% 55 79 0.00% 56 81 0.00% 57 90 0.00% 58 103 0.00% 59 121 0.00% 60 120 0.00% 61 152 0.00% 62 183 0.00% 63 169 0.00% 64 206 0.00% 65 241 0.00% 66 223 0.00% 67 283 0.00% 68 312 0.00% 69 342 0.00% 70 408 0.00% 71 433 0.00% 72 494 0.00% 73 580 0.00% 74 637 0.00% 75 706 0.00% 76 871 0.00% 77 854 0.00% 78 981 0.00% 79 1157 0.00% 80 1235 0.00% 81 1475 0.00% 82 1658 0.01% 83 1910 0.01% 84 2024 0.01% 85 2482 0.01% 86 2544 0.01% 87 2888 0.01% 88 3083 0.01% 89 3546 0.01% 90 3803 0.01% 91 4112 0.01% 92 4723 0.01% 93 5266 0.02% 94 5938 0.02% 95 6521 0.02% 96 7071 0.02% 97 7667 0.02% 98 8137 0.02% 99 8865 0.03% 100 9615 0.03% 101 10150 0.03% 102 11064 0.03% 103 11935 0.04% 104 12728 0.04% 105 14075 0.04% 106 14875 0.05% 107 15850 0.05% 108 16796 0.05% 109 17599 0.05% 110 18392 0.06% 111 19375 0.06% 112 20603 0.06% 113 21385 0.07% 114 22654 0.07% 115 24158 0.07% 116 25182 0.08% 117 26445 0.08% 118 27929 0.09% 119 28573 0.09% 120 30155 0.09% 121 31436 0.10% 122 31897 0.10% 123 33538 0.10% 124 35272 0.11% 125 36343 0.11% 126 37912 0.12% 127 39823 0.12% 128 41392 0.13% 129 41849 0.13% 130 43141 0.13% 131 44567 0.14% 132 45680 0.14% 133 47647 0.15% 134 48798 0.15% 135 50168 0.15% 136 51658 0.16% 137 53546 0.16% 138 54809 0.17% 139 56478 0.17% 140 58021 0.18% 141 58425 0.18% 142 59977 0.18% 143 61446 0.19% 144 63442 0.19% 145 65107 0.20% 146 65712 0.20% 147 67994 0.21% 148 68481 0.21% 149 70281 0.21% 150 71133 0.22% 151 30661402 93.79% 32692527 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=31 prefix-density=0.77 prefix-fanout=2.0 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=523.12 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=38.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=33 prefix-density=0.58 prefix-fanout=2.9 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=459.00 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=32.5 sequence=AAGAAGAAGAAG SRR12161475 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:47:03 Started mapping on | Feb 14 01:47:03 Finished on | Feb 14 01:50:31 Mapping speed, Million of reads per hour | 565.83 Number of input reads | 32692527 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31355451 Uniquely mapped reads % | 95.91% Average mapped length | 298.17 Number of splices: Total | 32916634 Number of splices: Annotated (sjdb) | 32148170 Number of splices: GT/AG | 32372951 Number of splices: GC/AG | 433971 Number of splices: AT/AC | 27227 Number of splices: Non-canonical | 82485 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 713821 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 21808 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 623255 623255 623255 N_multimapping 713821 713821 713821 N_noFeature 1062797 31084375 1187608 N_ambiguous 333318 1494 186264 UnstrandedReadsAssigned:29959336 PositiveStrandReadsAssigned:269582 NegativeStrandReadsAssigned:29981579 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161475-trimmed-pair1.fastq SRR12161475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,692,527 reads, 29,813,850 reads pseudoaligned [quant] estimated average fragment length: 273.91 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR12161475.ke.tsv 34699 SRR12161475.se.tsv 87100 total ==> SRR12161475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.09 3072 60.9746 Potri.005G024800.1.v4.1 1035 762.09 348 15.8168 Potri.004G059700.1.v4.1 961 688.256 98 4.93199 Potri.007G009000.2.v4.1 1416 1143.09 0 0 Potri.003G141000.2.v4.1 2943 2670.09 1139.35 14.7801 Potri.016G087400.1.v4.1 270 74.7931 1466 678.919 Potri.015G069301.1.v4.1 564 304.415 0 0 Potri.010G195200.1.v4.1 1773 1500.09 363 8.38176 Potri.012G127500.1.v4.1 977 704.176 6717 330.4 ==> SRR12161475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 124 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 812 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 428 SRR12161475 completed mapping pipeline successfully