Starting /dee2/code/volunteer_pipeline.sh SRR12161476 current disk space = 3087992651776 free memory = 1577622188 SRR12161476 SRAfilesize d56bf1e677d090d6d3dbd3cd6990f552 SRR12161476.sra SRR12161476.sra file validated SRR12161476 is paired end SRR12161476 is conventional basespace SRR12161476 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35625 37.0 37.0 37.0 37.0 37.0 2 36.2715 37.0 37.0 37.0 37.0 37.0 3 36.441 37.0 37.0 37.0 37.0 37.0 4 36.517 37.0 37.0 37.0 37.0 37.0 5 36.489 37.0 37.0 37.0 37.0 37.0 6 36.534 37.0 37.0 37.0 37.0 37.0 7 36.388 37.0 37.0 37.0 37.0 37.0 8 36.393 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.543600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.511 37.0 37.0 37.0 37.0 37.0 20-24 36.4545 37.0 37.0 37.0 37.0 37.0 25-29 36.4279 37.0 37.0 37.0 37.0 37.0 30-34 36.4003 37.0 37.0 37.0 37.0 37.0 35-39 36.3505 37.0 37.0 37.0 37.0 37.0 40-44 36.3506 37.0 37.0 37.0 37.0 37.0 45-49 36.367200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3093 37.0 37.0 37.0 37.0 37.0 55-59 36.278499999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.2763 37.0 37.0 37.0 37.0 37.0 65-69 36.240899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.1573 37.0 37.0 37.0 37.0 37.0 75-79 36.2012 37.0 37.0 37.0 37.0 37.0 80-84 36.1863 37.0 37.0 37.0 37.0 37.0 85-89 36.135 37.0 37.0 37.0 37.0 37.0 90-94 36.0841 37.0 37.0 37.0 37.0 37.0 95-99 36.0986 37.0 37.0 37.0 37.0 37.0 100-104 36.0625 37.0 37.0 37.0 37.0 37.0 105-109 36.0326 37.0 37.0 37.0 37.0 37.0 110-114 36.0058 37.0 37.0 37.0 37.0 37.0 115-119 35.9655 37.0 37.0 37.0 37.0 37.0 120-124 36.0299 37.0 37.0 37.0 37.0 37.0 125-129 35.86409999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.7751 37.0 37.0 37.0 37.0 37.0 135-139 35.744899999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7358 37.0 37.0 37.0 37.0 37.0 145-149 35.7733 37.0 37.0 37.0 37.0 37.0 150-151 35.47475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 4.0 26 4.0 27 13.0 28 11.0 29 12.0 30 27.0 31 32.0 32 56.0 33 83.0 34 142.0 35 371.0 36 2958.0 37 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.415477084898576 14.124718256949661 8.164287503130478 40.29551715502129 2 18.35 14.299999999999999 38.9 28.449999999999996 3 16.2 18.675 30.725 34.4 4 19.5 24.349999999999998 27.325 28.825 5 21.8 30.3 25.724999999999998 22.175 6 19.900000000000002 35.25 23.625 21.224999999999998 7 13.875000000000002 28.775000000000002 41.975 15.375 8 16.6 27.85 32.4 23.150000000000002 9 15.775 23.724999999999998 36.55 23.95 10-14 18.455 29.56 28.46 23.525 15-19 18.515 29.17 28.59 23.724999999999998 20-24 19.425 28.27 28.854999999999997 23.45 25-29 18.395 29.975 28.185 23.445 30-34 19.125 28.84 28.444999999999997 23.59 35-39 18.77 29.275000000000002 28.21 23.745 40-44 18.86 29.349999999999998 28.465 23.325000000000003 45-49 19.275000000000002 29.354999999999997 27.815 23.555 50-54 19.025 29.57 27.815 23.59 55-59 19.455 29.175 28.26 23.11 60-64 19.05 29.07 28.884999999999998 22.994999999999997 65-69 19.67 29.57 27.76 23.0 70-74 19.945 29.154999999999998 27.735 23.165 75-79 19.33 28.54 28.98 23.150000000000002 80-84 18.745 28.860000000000003 28.810000000000002 23.585 85-89 19.265 29.005 28.28 23.45 90-94 18.895 29.54 28.715000000000003 22.85 95-99 19.46 28.694999999999997 28.525 23.32 100-104 19.505 29.01 28.715000000000003 22.770000000000003 105-109 19.68 29.125 28.03 23.165 110-114 19.25 28.925 28.76 23.064999999999998 115-119 19.56 28.749999999999996 28.24 23.45 120-124 20.03 28.555000000000003 27.57 23.845 125-129 19.400000000000002 28.305000000000003 28.560000000000002 23.735 130-134 19.375 28.79 28.499999999999996 23.335 135-139 19.895 29.054999999999996 27.245 23.805 140-144 19.765 28.37 28.249999999999996 23.615 145-149 19.73 28.444999999999997 28.355000000000004 23.47 150-151 19.5625 29.4375 27.175 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 3.5 26 4.0 27 8.5 28 12.5 29 15.0 30 19.5 31 27.0 32 32.5 33 46.0 34 60.0 35 69.5 36 100.0 37 138.0 38 170.5 39 202.0 40 222.0 41 265.5 42 296.5 43 298.5 44 307.5 45 284.0 46 256.5 47 239.5 48 210.0 49 179.0 50 148.5 51 115.0 52 86.5 53 61.5 54 37.0 55 21.5 56 16.0 57 11.5 58 8.5 59 4.5 60 0.5 61 0.5 62 0.5 63 0.0 64 1.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.07859798194372 88.575 2 5.6558682952735 10.65 3 0.2389803505045141 0.675 4 0.02655337227827934 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161476 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1095 37.0 37.0 37.0 37.0 37.0 2 35.8765 37.0 37.0 37.0 37.0 37.0 3 35.9085 37.0 37.0 37.0 37.0 37.0 4 35.8915 37.0 37.0 37.0 37.0 37.0 5 36.0785 37.0 37.0 37.0 37.0 37.0 6 36.042 37.0 37.0 37.0 37.0 37.0 7 36.126 37.0 37.0 37.0 37.0 37.0 8 36.0465 37.0 37.0 37.0 37.0 37.0 9 36.1025 37.0 37.0 37.0 37.0 37.0 10-14 36.077 37.0 37.0 37.0 37.0 37.0 15-19 36.055 37.0 37.0 37.0 37.0 37.0 20-24 36.037099999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.898999999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.9252 37.0 37.0 37.0 37.0 37.0 35-39 35.874199999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.816 37.0 37.0 37.0 37.0 37.0 45-49 35.831100000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.7719 37.0 37.0 37.0 37.0 37.0 55-59 35.77230000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.6929 37.0 37.0 37.0 37.0 37.0 65-69 35.7048 37.0 37.0 37.0 37.0 37.0 70-74 35.6082 37.0 37.0 37.0 37.0 37.0 75-79 35.576499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.6106 37.0 37.0 37.0 37.0 37.0 85-89 35.538599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.546800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.4773 37.0 37.0 37.0 37.0 37.0 100-104 35.4825 37.0 37.0 37.0 37.0 37.0 105-109 35.4396 37.0 37.0 37.0 37.0 37.0 110-114 35.3138 37.0 37.0 37.0 34.6 37.0 115-119 35.3788 37.0 37.0 37.0 37.0 37.0 120-124 35.3307 37.0 37.0 37.0 32.2 37.0 125-129 35.323699999999995 37.0 37.0 37.0 32.2 37.0 130-134 35.281800000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.19949999999999 37.0 37.0 37.0 29.8 37.0 140-144 35.109500000000004 37.0 37.0 37.0 25.0 37.0 145-149 35.091 37.0 37.0 37.0 27.4 37.0 150-151 34.650999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 2.0 16 3.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 5.0 23 4.0 24 9.0 25 9.0 26 8.0 27 18.0 28 18.0 29 31.0 30 33.0 31 53.0 32 92.0 33 151.0 34 295.0 35 714.0 36 2407.0 37 138.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 26.650000000000002 11.175 24.349999999999998 2 25.775 27.650000000000002 31.85 14.725 3 19.825 28.499999999999996 34.125 17.549999999999997 4 21.325 35.175 25.95 17.549999999999997 5 23.575 36.4 23.724999999999998 16.3 6 20.525 40.725 21.425 17.325 7 20.150000000000002 23.375 38.224999999999994 18.25 8 20.525 27.950000000000003 29.15 22.375 9 22.35 24.375 31.825 21.45 10-14 22.585 29.304999999999996 27.295 20.815 15-19 22.400000000000002 28.54 28.46 20.599999999999998 20-24 22.735 28.705000000000002 28.89 19.67 25-29 22.695 29.330000000000002 28.050000000000004 19.925 30-34 22.67 28.34 29.465000000000003 19.525000000000002 35-39 22.68 27.800000000000004 29.085 20.435 40-44 22.650000000000002 28.299999999999997 28.720000000000002 20.330000000000002 45-49 22.134999999999998 29.07 28.294999999999998 20.5 50-54 22.71 28.410000000000004 28.83 20.05 55-59 23.02 28.360000000000003 28.525 20.095 60-64 22.58 29.14 28.565 19.715 65-69 22.91 28.310000000000002 28.815 19.965 70-74 22.595000000000002 28.225 29.054999999999996 20.125 75-79 22.720000000000002 28.99 28.854999999999997 19.435 80-84 23.549999999999997 28.389999999999997 27.965 20.095 85-89 23.044999999999998 28.365000000000002 28.62 19.97 90-94 23.200000000000003 28.505000000000003 28.525 19.77 95-99 23.05 28.4 28.895 19.655 100-104 23.435 28.444999999999997 28.49 19.63 105-109 23.235 28.384999999999998 28.835 19.545 110-114 23.44 28.310000000000002 28.395 19.855 115-119 23.275000000000002 28.915000000000003 28.389999999999997 19.42 120-124 23.31 28.410000000000004 28.785 19.495 125-129 23.745 28.22 28.29 19.744999999999997 130-134 23.765 27.750000000000004 29.304999999999996 19.18 135-139 24.245 28.355000000000004 27.915 19.485 140-144 23.799999999999997 28.46 28.165000000000003 19.575 145-149 23.810000000000002 28.555000000000003 28.439999999999998 19.195 150-151 24.7375 28.212500000000002 28.025 19.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 1.5 24 2.5 25 3.0 26 3.0 27 7.0 28 8.5 29 14.5 30 18.5 31 19.0 32 36.5 33 49.0 34 61.5 35 91.5 36 111.5 37 131.5 38 172.5 39 211.0 40 220.5 41 263.0 42 304.0 43 297.0 44 304.5 45 301.0 46 276.0 47 226.5 48 191.0 49 165.5 50 128.0 51 105.5 52 83.0 53 53.0 54 34.0 55 25.5 56 16.5 57 14.0 58 11.0 59 6.0 60 2.5 61 2.0 62 0.5 63 0.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3796394485684 89.0 2 5.275715800636267 9.950000000000001 3 0.29162248144220576 0.8250000000000001 4 0.02651113467656416 0.1 5 0.02651113467656416 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.6125 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.8624999999999998 0.0 0.0 0.0 0.0 138-139 1.9874999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGACC 10 0.006830828 145.0 1 >>END_MODULE Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103436 spots for SRR12161476.sra Written 2103436 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra Read 2103427 spots for SRR12161476.sra Written 2103427 spots for SRR12161476.sra SRR ids: ['SRR12161476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__d8pxtcq SRR12161476.sra spots: 42068549 blocks: [[1, 2103427], [2103428, 4206854], [4206855, 6310281], [6310282, 8413708], [8413709, 10517135], [10517136, 12620562], [12620563, 14723989], [14723990, 16827416], [16827417, 18930843], [18930844, 21034270], [21034271, 23137697], [23137698, 25241124], [25241125, 27344551], [27344552, 29447978], [29447979, 31551405], [31551406, 33654832], [33654833, 35758259], [35758260, 37861686], [37861687, 39965113], [39965114, 42068549]] SRR12161476 file size 14275033 SRR12161476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161476 SRR12161476_1.fastq SRR12161476_2.fastq Input file: SRR12161476_1.fastq Paired file: SRR12161476_2.fastq trimmed: SRR12161476-trimmed-pair1.fastq, SRR12161476-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:12:32 2025 >> started Fri Feb 14 02:13:16 2025 >> done (44.721s) 42068549 read pairs processed; of these: 448 ( 0.00%) short read pairs filtered out after trimming by size control 114344 ( 0.27%) empty read pairs filtered out after trimming by size control 41953757 (99.73%) read pairs available; of these: 1141137 ( 2.72%) trimmed read pairs available after processing 40812620 (97.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 13 0.00% 21 18 0.00% 22 13 0.00% 23 25 0.00% 24 23 0.00% 25 32 0.00% 26 31 0.00% 27 37 0.00% 28 40 0.00% 29 49 0.00% 30 45 0.00% 31 54 0.00% 32 52 0.00% 33 75 0.00% 34 57 0.00% 35 67 0.00% 36 58 0.00% 37 58 0.00% 38 67 0.00% 39 66 0.00% 40 80 0.00% 41 82 0.00% 42 71 0.00% 43 65 0.00% 44 82 0.00% 45 82 0.00% 46 92 0.00% 47 78 0.00% 48 108 0.00% 49 143 0.00% 50 96 0.00% 51 156 0.00% 52 103 0.00% 53 134 0.00% 54 165 0.00% 55 142 0.00% 56 132 0.00% 57 170 0.00% 58 188 0.00% 59 211 0.00% 60 237 0.00% 61 246 0.00% 62 270 0.00% 63 292 0.00% 64 325 0.00% 65 294 0.00% 66 371 0.00% 67 365 0.00% 68 394 0.00% 69 449 0.00% 70 475 0.00% 71 545 0.00% 72 604 0.00% 73 724 0.00% 74 742 0.00% 75 846 0.00% 76 864 0.00% 77 909 0.00% 78 975 0.00% 79 1069 0.00% 80 1178 0.00% 81 1346 0.00% 82 1609 0.00% 83 1770 0.00% 84 1863 0.00% 85 1987 0.00% 86 2176 0.01% 87 2269 0.01% 88 2525 0.01% 89 2676 0.01% 90 3027 0.01% 91 3451 0.01% 92 3700 0.01% 93 4136 0.01% 94 4539 0.01% 95 4833 0.01% 96 5119 0.01% 97 5357 0.01% 98 5802 0.01% 99 5953 0.01% 100 6577 0.02% 101 6992 0.02% 102 7599 0.02% 103 8147 0.02% 104 8849 0.02% 105 9355 0.02% 106 9899 0.02% 107 9832 0.02% 108 10265 0.02% 109 10639 0.03% 110 11484 0.03% 111 11878 0.03% 112 12784 0.03% 113 13410 0.03% 114 14297 0.03% 115 14884 0.04% 116 15003 0.04% 117 15825 0.04% 118 16138 0.04% 119 16083 0.04% 120 16799 0.04% 121 17402 0.04% 122 18756 0.04% 123 19404 0.05% 124 20420 0.05% 125 21368 0.05% 126 21737 0.05% 127 22408 0.05% 128 22385 0.05% 129 21883 0.05% 130 23279 0.06% 131 23237 0.06% 132 24814 0.06% 133 25838 0.06% 134 26346 0.06% 135 27561 0.07% 136 28103 0.07% 137 28739 0.07% 138 28544 0.07% 139 28475 0.07% 140 29561 0.07% 141 29456 0.07% 142 30282 0.07% 143 31741 0.08% 144 32881 0.08% 145 34545 0.08% 146 34760 0.08% 147 35169 0.08% 148 35327 0.08% 149 34874 0.08% 150 35511 0.08% 151 40812620 97.28% 41953757 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.90 fanout-score-rank=31 prefix-density=0.68 prefix-fanout=2.0 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=418.69 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=28.8 sequence=TCATCATCATCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=35 prefix-density=0.66 prefix-fanout=1.1 sequence=GACTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=394.47 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=33.5 sequence=AAGAAGAAGATG SRR12161476 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:14:00 Started mapping on | Feb 14 02:14:00 Finished on | Feb 14 02:17:50 Mapping speed, Million of reads per hour | 656.67 Number of input reads | 41953757 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 39870088 Uniquely mapped reads % | 95.03% Average mapped length | 299.37 Number of splices: Total | 40957241 Number of splices: Annotated (sjdb) | 39974064 Number of splices: GT/AG | 40249713 Number of splices: GC/AG | 556286 Number of splices: AT/AC | 38175 Number of splices: Non-canonical | 113067 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 914878 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 39574 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1168791 1168791 1168791 N_multimapping 914878 914878 914878 N_noFeature 1428958 39528951 1579081 N_ambiguous 464299 2508 271932 UnstrandedReadsAssigned:37976831 PositiveStrandReadsAssigned:338629 NegativeStrandReadsAssigned:38019075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161476 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161476-trimmed-pair1.fastq SRR12161476-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,953,757 reads, 37,800,992 reads pseudoaligned [quant] estimated average fragment length: 344.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52401 SRR12161476.ke.tsv 34699 SRR12161476.se.tsv 87100 total ==> SRR12161476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1674.72 5671.47 92.8854 Potri.005G024800.1.v4.1 1035 691.721 463 18.3588 Potri.004G059700.1.v4.1 961 618.015 122 5.41446 Potri.007G009000.2.v4.1 1416 1072.72 0 0 Potri.003G141000.2.v4.1 2943 2599.72 1776.64 18.7442 Potri.016G087400.1.v4.1 270 69.033 1334.51 530.223 Potri.015G069301.1.v4.1 564 245.884 0 0 Potri.010G195200.1.v4.1 1773 1429.72 793 15.213 Potri.012G127500.1.v4.1 977 633.862 18608 805.192 ==> SRR12161476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 662 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 704 SRR12161476 completed mapping pipeline successfully