Starting /dee2/code/volunteer_pipeline.sh SRR12161477 current disk space = 3088841125888 free memory = 1582745048 SRR12161477 SRAfilesize 6f1feb841f2ab039011b07c76971f9a2 SRR12161477.sra SRR12161477.sra file validated SRR12161477 is paired end SRR12161477 is conventional basespace SRR12161477 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3995 37.0 37.0 37.0 37.0 37.0 2 36.214 37.0 37.0 37.0 37.0 37.0 3 36.419 37.0 37.0 37.0 37.0 37.0 4 36.4935 37.0 37.0 37.0 37.0 37.0 5 36.5285 37.0 37.0 37.0 37.0 37.0 6 36.5045 37.0 37.0 37.0 37.0 37.0 7 36.449 37.0 37.0 37.0 37.0 37.0 8 36.409 37.0 37.0 37.0 37.0 37.0 9 36.3845 37.0 37.0 37.0 37.0 37.0 10-14 36.512600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4336 37.0 37.0 37.0 37.0 37.0 20-24 36.4069 37.0 37.0 37.0 37.0 37.0 25-29 36.408699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3581 37.0 37.0 37.0 37.0 37.0 35-39 36.260000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.25600000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3035 37.0 37.0 37.0 37.0 37.0 50-54 36.254599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.24 37.0 37.0 37.0 37.0 37.0 60-64 36.2592 37.0 37.0 37.0 37.0 37.0 65-69 36.213899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1338 37.0 37.0 37.0 37.0 37.0 75-79 36.1537 37.0 37.0 37.0 37.0 37.0 80-84 36.0904 37.0 37.0 37.0 37.0 37.0 85-89 36.037099999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.11 37.0 37.0 37.0 37.0 37.0 95-99 36.126099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.940200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.981399999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.9011 37.0 37.0 37.0 37.0 37.0 115-119 35.9718 37.0 37.0 37.0 37.0 37.0 120-124 36.0191 37.0 37.0 37.0 37.0 37.0 125-129 35.87670000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.86 37.0 37.0 37.0 37.0 37.0 135-139 35.80309999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.727 37.0 37.0 37.0 37.0 37.0 145-149 35.653000000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.52525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 4.0 26 4.0 27 9.0 28 15.0 29 26.0 30 36.0 31 47.0 32 64.0 33 78.0 34 145.0 35 363.0 36 2907.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.741482965931866 12.775551102204407 6.337675350701402 35.14529058116233 2 20.7 13.875000000000002 33.650000000000006 31.775 3 18.099999999999998 18.7 28.7 34.5 4 20.549999999999997 26.724999999999998 25.374999999999996 27.35 5 22.975 33.324999999999996 24.3 19.400000000000002 6 21.05 34.699999999999996 23.150000000000002 21.099999999999998 7 15.225 26.724999999999998 41.025 17.025000000000002 8 16.950000000000003 26.575 32.15 24.325 9 16.425 24.425 34.975 24.175 10-14 19.765 29.604999999999997 27.74 22.89 15-19 19.650000000000002 28.825 27.42 24.104999999999997 20-24 19.45 28.71 28.645 23.195 25-29 19.62 29.160000000000004 28.144999999999996 23.075000000000003 30-34 19.28 29.14 28.494999999999997 23.085 35-39 19.634999999999998 28.825 28.105000000000004 23.435 40-44 20.015 28.78 27.515 23.69 45-49 19.48 29.01 28.449999999999996 23.06 50-54 19.86 28.694999999999997 28.43 23.015 55-59 19.445 29.044999999999998 27.91 23.599999999999998 60-64 19.35 29.25 28.225 23.175 65-69 19.705000000000002 28.799999999999997 27.694999999999997 23.799999999999997 70-74 20.015 29.035 27.52 23.43 75-79 19.345000000000002 29.435 27.74 23.48 80-84 19.89 28.134999999999998 28.410000000000004 23.565 85-89 20.13 28.625 28.07 23.175 90-94 19.99 28.255000000000003 28.235 23.52 95-99 20.21 28.675 28.105000000000004 23.01 100-104 19.54 28.48 28.42 23.56 105-109 19.86 28.685 28.105000000000004 23.35 110-114 20.69 28.660000000000004 27.38 23.27 115-119 20.69 28.935 27.67 22.705000000000002 120-124 20.215 28.965000000000003 28.249999999999996 22.57 125-129 20.49 28.935 26.834999999999997 23.74 130-134 20.445 29.205 26.68 23.669999999999998 135-139 20.435 28.645 27.860000000000003 23.06 140-144 20.36 28.42 27.47 23.75 145-149 21.005 28.485 26.965 23.544999999999998 150-151 21.2 28.599999999999998 25.8125 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 2.5 26 2.5 27 3.5 28 7.5 29 13.5 30 17.5 31 16.5 32 24.0 33 37.0 34 48.5 35 70.0 36 94.0 37 133.5 38 153.5 39 175.0 40 216.0 41 240.5 42 264.5 43 268.0 44 289.0 45 302.5 46 280.5 47 251.0 48 234.0 49 214.5 50 157.0 51 116.5 52 97.5 53 78.5 54 61.0 55 39.0 56 27.5 57 20.0 58 10.0 59 5.5 60 3.0 61 3.5 62 3.0 63 1.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82572397599792 91.825 2 3.991651447951996 7.6499999999999995 3 0.1826245760500913 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0125 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.07500000000000001 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.125 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.2125 0.025 0.0 0.0 0.0 94-95 0.275 0.025 0.0 0.0 0.0 96-97 0.325 0.025 0.0 0.0 0.0 98-99 0.4375 0.025 0.0 0.0 0.0 100-101 0.55 0.025 0.0 0.0 0.0 102-103 0.5874999999999999 0.025 0.0 0.0 0.0 104-105 0.7250000000000001 0.025 0.0 0.0 0.0 106-107 0.975 0.025 0.0 0.0 0.0 108-109 1.0875 0.025 0.0 0.0 0.0 110-111 1.225 0.025 0.0 0.0 0.0 112-113 1.4375 0.025 0.0 0.0 0.0 114-115 1.7 0.025 0.0 0.0 0.0 116-117 1.95 0.025 0.0 0.0 0.0 118-119 2.3125 0.025 0.0 0.0 0.0 120-121 2.6375 0.025 0.0 0.0 0.0 122-123 3.1875 0.025 0.0 0.0 0.0 124-125 3.5125 0.025 0.0 0.0 0.0 126-127 3.9000000000000004 0.025 0.0 0.0 0.0 128-129 4.2875 0.025 0.0 0.0 0.0 130-131 4.7125 0.025 0.0 0.0 0.0 132-133 4.9625 0.025 0.0 0.0 0.0 134-135 5.4875 0.025 0.0 0.0 0.0 136-137 5.9625 0.025 0.0 0.0 0.0 138-139 6.4875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161477 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.291 37.0 37.0 37.0 37.0 37.0 2 35.882 37.0 37.0 37.0 37.0 37.0 3 35.949 37.0 37.0 37.0 37.0 37.0 4 36.0225 37.0 37.0 37.0 37.0 37.0 5 36.1195 37.0 37.0 37.0 37.0 37.0 6 36.1685 37.0 37.0 37.0 37.0 37.0 7 36.1265 37.0 37.0 37.0 37.0 37.0 8 36.1035 37.0 37.0 37.0 37.0 37.0 9 36.1315 37.0 37.0 37.0 37.0 37.0 10-14 36.194599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1787 37.0 37.0 37.0 37.0 37.0 20-24 36.141 37.0 37.0 37.0 37.0 37.0 25-29 36.068400000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.995000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.056 37.0 37.0 37.0 37.0 37.0 40-44 36.03189999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0081 37.0 37.0 37.0 37.0 37.0 50-54 35.954299999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.947199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9071 37.0 37.0 37.0 37.0 37.0 65-69 35.882 37.0 37.0 37.0 37.0 37.0 70-74 35.7699 37.0 37.0 37.0 37.0 37.0 75-79 35.743 37.0 37.0 37.0 37.0 37.0 80-84 35.7593 37.0 37.0 37.0 37.0 37.0 85-89 35.78830000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7298 37.0 37.0 37.0 37.0 37.0 95-99 35.6276 37.0 37.0 37.0 37.0 37.0 100-104 35.7245 37.0 37.0 37.0 37.0 37.0 105-109 35.6854 37.0 37.0 37.0 37.0 37.0 110-114 35.604400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6295 37.0 37.0 37.0 37.0 37.0 120-124 35.494899999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.5363 37.0 37.0 37.0 37.0 37.0 130-134 35.5122 37.0 37.0 37.0 37.0 37.0 135-139 35.442899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.226 37.0 37.0 37.0 29.8 37.0 145-149 35.2097 37.0 37.0 37.0 32.2 37.0 150-151 34.876999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 3.0 16 0.0 17 2.0 18 1.0 19 0.0 20 0.0 21 1.0 22 5.0 23 9.0 24 12.0 25 8.0 26 8.0 27 15.0 28 14.0 29 26.0 30 40.0 31 50.0 32 72.0 33 94.0 34 198.0 35 593.0 36 2622.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.925 24.125 10.7 21.25 2 28.249999999999996 25.174999999999997 29.675 16.900000000000002 3 20.95 27.925 32.95 18.175 4 21.975 34.9 25.4 17.724999999999998 5 25.275 35.85 21.8 17.075000000000003 6 21.375 39.25 22.775000000000002 16.6 7 21.4 22.8 37.3 18.5 8 23.0 26.625 26.150000000000002 24.224999999999998 9 22.675 25.8 29.525000000000002 22.0 10-14 23.035 28.92 27.015 21.029999999999998 15-19 23.565 27.87 28.32 20.244999999999997 20-24 22.855 28.810000000000002 28.095 20.24 25-29 22.82 28.605000000000004 27.650000000000002 20.925 30-34 22.925 28.07 28.860000000000003 20.145 35-39 22.32 28.549999999999997 28.53 20.599999999999998 40-44 22.96 28.144999999999996 28.51 20.385 45-49 22.91 28.310000000000002 28.005000000000003 20.775 50-54 22.335 27.96 29.005 20.7 55-59 22.634999999999998 28.4 28.945 20.02 60-64 23.189999999999998 28.21 28.58 20.02 65-69 23.544999999999998 28.67 28.110000000000003 19.675 70-74 23.825 29.075 27.229999999999997 19.869999999999997 75-79 23.505000000000003 28.125 28.139999999999997 20.23 80-84 23.78 27.634999999999998 27.93 20.655 85-89 23.525 27.925 28.605000000000004 19.945 90-94 23.455000000000002 28.189999999999998 27.950000000000003 20.405 95-99 23.400000000000002 28.42 28.235 19.945 100-104 24.33 28.875 27.66 19.134999999999998 105-109 23.285 29.085 27.555000000000003 20.075000000000003 110-114 23.47 27.98 28.384999999999998 20.165 115-119 23.955000000000002 29.165000000000003 27.575 19.305 120-124 23.7 28.799999999999997 27.655 19.845 125-129 24.265 28.725 27.495000000000005 19.515 130-134 24.595 28.33 27.525 19.55 135-139 24.34 28.215 27.98 19.465 140-144 25.55 28.27 27.125 19.055 145-149 25.46 28.255000000000003 27.439999999999998 18.845 150-151 25.4625 29.099999999999998 26.724999999999998 18.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 2.5 19 2.0 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 3.0 28 6.0 29 11.5 30 19.0 31 24.0 32 27.0 33 36.0 34 47.5 35 69.0 36 95.5 37 127.0 38 158.5 39 184.0 40 207.0 41 242.0 42 274.0 43 278.0 44 285.0 45 304.5 46 289.5 47 248.0 48 207.5 49 176.5 50 160.5 51 139.0 52 105.0 53 68.0 54 60.0 55 45.5 56 24.0 57 17.5 58 11.0 59 7.5 60 4.0 61 2.0 62 2.0 63 1.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.76691925790436 91.625 2 3.99790958975699 7.6499999999999995 3 0.1829108962633917 0.525 4 0.052260256075254766 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.3375000000000004 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGC 10 0.006830828 145.0 1 AATCTAA 10 0.006830828 145.0 5 GAAGTTG 10 0.006830828 145.0 3 GGAAGTT 10 0.006830828 145.0 2 >>END_MODULE Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955972 spots for SRR12161477.sra Written 1955972 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra Read 1955962 spots for SRR12161477.sra Written 1955962 spots for SRR12161477.sra SRR ids: ['SRR12161477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bntjbkyr SRR12161477.sra spots: 39119250 blocks: [[1, 1955962], [1955963, 3911924], [3911925, 5867886], [5867887, 7823848], [7823849, 9779810], [9779811, 11735772], [11735773, 13691734], [13691735, 15647696], [15647697, 17603658], [17603659, 19559620], [19559621, 21515582], [21515583, 23471544], [23471545, 25427506], [25427507, 27383468], [27383469, 29339430], [29339431, 31295392], [31295393, 33251354], [33251355, 35207316], [35207317, 37163278], [37163279, 39119250]] SRR12161477 file size 13272732 SRR12161477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161477 SRR12161477_1.fastq SRR12161477_2.fastq Input file: SRR12161477_1.fastq Paired file: SRR12161477_2.fastq trimmed: SRR12161477-trimmed-pair1.fastq, SRR12161477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:54:21 2025 >> started Fri Feb 14 01:55:03 2025 >> done (41.848s) 39119250 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 9779 ( 0.02%) empty read pairs filtered out after trimming by size control 39109395 (99.97%) read pairs available; of these: 3569857 ( 9.13%) trimmed read pairs available after processing 35539538 (90.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 10 0.00% 21 16 0.00% 22 22 0.00% 23 26 0.00% 24 20 0.00% 25 22 0.00% 26 34 0.00% 27 33 0.00% 28 40 0.00% 29 41 0.00% 30 41 0.00% 31 29 0.00% 32 48 0.00% 33 42 0.00% 34 54 0.00% 35 54 0.00% 36 64 0.00% 37 57 0.00% 38 55 0.00% 39 63 0.00% 40 69 0.00% 41 64 0.00% 42 65 0.00% 43 73 0.00% 44 77 0.00% 45 89 0.00% 46 89 0.00% 47 95 0.00% 48 115 0.00% 49 105 0.00% 50 133 0.00% 51 152 0.00% 52 167 0.00% 53 183 0.00% 54 184 0.00% 55 186 0.00% 56 207 0.00% 57 243 0.00% 58 255 0.00% 59 362 0.00% 60 368 0.00% 61 410 0.00% 62 457 0.00% 63 515 0.00% 64 528 0.00% 65 578 0.00% 66 618 0.00% 67 700 0.00% 68 784 0.00% 69 937 0.00% 70 1063 0.00% 71 1249 0.00% 72 1449 0.00% 73 1661 0.00% 74 1862 0.00% 75 2048 0.01% 76 2230 0.01% 77 2376 0.01% 78 2679 0.01% 79 3045 0.01% 80 3521 0.01% 81 4023 0.01% 82 4502 0.01% 83 5177 0.01% 84 5631 0.01% 85 6346 0.02% 86 6615 0.02% 87 7266 0.02% 88 7920 0.02% 89 8554 0.02% 90 9700 0.02% 91 10721 0.03% 92 12060 0.03% 93 13263 0.03% 94 14838 0.04% 95 15665 0.04% 96 16635 0.04% 97 17543 0.04% 98 18389 0.05% 99 19543 0.05% 100 21199 0.05% 101 22758 0.06% 102 24388 0.06% 103 26585 0.07% 104 28158 0.07% 105 30304 0.08% 106 31487 0.08% 107 32494 0.08% 108 33552 0.09% 109 35308 0.09% 110 36764 0.09% 111 38656 0.10% 112 41164 0.11% 113 43255 0.11% 114 45718 0.12% 115 47903 0.12% 116 49161 0.13% 117 50073 0.13% 118 51254 0.13% 119 52529 0.13% 120 54524 0.14% 121 56712 0.15% 122 58445 0.15% 123 62193 0.16% 124 65304 0.17% 125 66484 0.17% 126 68826 0.18% 127 69688 0.18% 128 71944 0.18% 129 70964 0.18% 130 72737 0.19% 131 74936 0.19% 132 77441 0.20% 133 80529 0.21% 134 83662 0.21% 135 85796 0.22% 136 87206 0.22% 137 88699 0.23% 138 89768 0.23% 139 90392 0.23% 140 92345 0.24% 141 93230 0.24% 142 95145 0.24% 143 98166 0.25% 144 101879 0.26% 145 103266 0.26% 146 104762 0.27% 147 104969 0.27% 148 106070 0.27% 149 106776 0.27% 150 107125 0.27% 151 35539538 90.87% 39109395 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=31 prefix-density=0.42 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=68.76 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.6 sequence=CCACCAGAACAAAAGATAGCAAAGCATTCAAGGATAAAACTAAAACTAATAAAGCTAGCACTTGCACATCAAGGCCAGCTATTGGCACTCTTCAGCACTTGACCTCCTTCAAAGAAGGGGCAAAGTACAAGAATGTTGGATCGGTAGCACCTTCTTTGTAATAAGCAAAGACCAAACAACCATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.55 prefix-fanout=1.1 sequence=GACTGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=355.17 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=32.8 sequence=AAGAAGAAGAAA SRR12161477 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:55:47 Started mapping on | Feb 14 01:55:47 Finished on | Feb 14 01:59:34 Mapping speed, Million of reads per hour | 620.24 Number of input reads | 39109395 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 36739083 Uniquely mapped reads % | 93.94% Average mapped length | 296.50 Number of splices: Total | 37358785 Number of splices: Annotated (sjdb) | 36523385 Number of splices: GT/AG | 36740572 Number of splices: GC/AG | 486972 Number of splices: AT/AC | 31651 Number of splices: Non-canonical | 99590 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 846597 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 41725 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1523715 1523715 1523715 N_multimapping 846597 846597 846597 N_noFeature 1212753 36403477 1381280 N_ambiguous 388182 1826 219966 UnstrandedReadsAssigned:35138148 PositiveStrandReadsAssigned:333780 NegativeStrandReadsAssigned:35137837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161477-trimmed-pair1.fastq SRR12161477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,109,395 reads, 35,099,320 reads pseudoaligned [quant] estimated average fragment length: 263.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR12161477.ke.tsv 34699 SRR12161477.se.tsv 87100 total ==> SRR12161477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.76 3291 57.035 Potri.005G024800.1.v4.1 1035 772.765 437 17.2074 Potri.004G059700.1.v4.1 961 698.93 57 2.48154 Potri.007G009000.2.v4.1 1416 1153.76 0 0 Potri.003G141000.2.v4.1 2943 2680.76 1475.51 16.748 Potri.016G087400.1.v4.1 270 82.4442 1450 535.165 Potri.015G069301.1.v4.1 564 315.535 0 0 Potri.010G195200.1.v4.1 1773 1510.76 567.765 11.4354 Potri.012G127500.1.v4.1 977 714.856 12792 544.503 ==> SRR12161477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 184 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 800 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 485 SRR12161477 completed mapping pipeline successfully