Starting /dee2/code/volunteer_pipeline.sh SRR12161478 current disk space = 3089053126656 free memory = 1449947504 SRR12161478 SRAfilesize 2460a3963dd168284386e9f93eb4f7aa SRR12161478.sra SRR12161478.sra file validated SRR12161478 is paired end SRR12161478 is conventional basespace SRR12161478 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.469 37.0 37.0 37.0 37.0 37.0 2 36.443 37.0 37.0 37.0 37.0 37.0 3 36.5665 37.0 37.0 37.0 37.0 37.0 4 36.557 37.0 37.0 37.0 37.0 37.0 5 36.5415 37.0 37.0 37.0 37.0 37.0 6 36.5595 37.0 37.0 37.0 37.0 37.0 7 36.5615 37.0 37.0 37.0 37.0 37.0 8 36.4395 37.0 37.0 37.0 37.0 37.0 9 36.505 37.0 37.0 37.0 37.0 37.0 10-14 36.5367 37.0 37.0 37.0 37.0 37.0 15-19 36.4807 37.0 37.0 37.0 37.0 37.0 20-24 36.4788 37.0 37.0 37.0 37.0 37.0 25-29 36.4201 37.0 37.0 37.0 37.0 37.0 30-34 36.3976 37.0 37.0 37.0 37.0 37.0 35-39 36.352700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.339099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.366 37.0 37.0 37.0 37.0 37.0 50-54 36.3178 37.0 37.0 37.0 37.0 37.0 55-59 36.271300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.259100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.246500000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.21509999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.17640000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1315 37.0 37.0 37.0 37.0 37.0 85-89 36.1352 37.0 37.0 37.0 37.0 37.0 90-94 36.128 37.0 37.0 37.0 37.0 37.0 95-99 36.1015 37.0 37.0 37.0 37.0 37.0 100-104 36.06 37.0 37.0 37.0 37.0 37.0 105-109 36.0102 37.0 37.0 37.0 37.0 37.0 110-114 35.9536 37.0 37.0 37.0 37.0 37.0 115-119 35.998200000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.013400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9145 37.0 37.0 37.0 37.0 37.0 130-134 35.8354 37.0 37.0 37.0 37.0 37.0 135-139 35.7602 37.0 37.0 37.0 37.0 37.0 140-144 35.7056 37.0 37.0 37.0 37.0 37.0 145-149 35.6629 37.0 37.0 37.0 37.0 37.0 150-151 35.5115 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 3.0 26 6.0 27 11.0 28 14.0 29 17.0 30 35.0 31 43.0 32 70.0 33 87.0 34 122.0 35 301.0 36 2963.0 37 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.488488488488485 12.562562562562562 6.981981981981981 41.966966966966964 2 19.3 12.925 37.2 30.575000000000003 3 17.175 16.400000000000002 28.525 37.9 4 20.325 25.0 24.575 30.099999999999998 5 21.925 30.3 25.525 22.25 6 20.8 34.525 24.375 20.3 7 14.549999999999999 27.85 40.375 17.224999999999998 8 16.7 28.025 32.125 23.150000000000002 9 16.25 25.324999999999996 35.3 23.125 10-14 19.355 30.255 27.855 22.535 15-19 19.3 28.435 28.305000000000003 23.96 20-24 19.15 28.84 28.849999999999998 23.16 25-29 19.55 28.244999999999997 28.415000000000003 23.79 30-34 19.38 29.085 27.935 23.599999999999998 35-39 19.555 28.625 27.99 23.830000000000002 40-44 19.86 28.9 28.22 23.02 45-49 19.505 28.585 27.88 24.03 50-54 19.7 28.975 27.555000000000003 23.77 55-59 19.435 29.270000000000003 27.63 23.665 60-64 19.78 29.435 27.939999999999998 22.845 65-69 19.75 28.01 28.849999999999998 23.39 70-74 19.305 29.549999999999997 27.82 23.325000000000003 75-79 19.96 28.694999999999997 27.515 23.830000000000002 80-84 19.775000000000002 28.73 27.815 23.68 85-89 19.939999999999998 29.015 28.084999999999997 22.96 90-94 19.585 28.9 27.935 23.580000000000002 95-99 20.01 28.565 28.335 23.09 100-104 20.25 28.23 28.605000000000004 22.915 105-109 19.759999999999998 28.63 28.24 23.369999999999997 110-114 19.895 28.215 28.52 23.369999999999997 115-119 20.035 28.794999999999998 27.805000000000003 23.365 120-124 20.605 28.244999999999997 27.515 23.635 125-129 20.13 28.83 27.33 23.71 130-134 20.794999999999998 28.355000000000004 27.62 23.23 135-139 20.29 28.32 27.96 23.43 140-144 20.565 28.83 27.11 23.494999999999997 145-149 21.310000000000002 28.994999999999997 26.415 23.28 150-151 20.825 28.8375 26.4125 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 4.0 26 5.5 27 4.5 28 5.5 29 10.0 30 13.0 31 16.0 32 30.0 33 41.5 34 57.0 35 70.5 36 80.0 37 109.5 38 146.0 39 177.5 40 219.5 41 259.5 42 282.0 43 289.5 44 290.5 45 298.5 46 294.5 47 259.0 48 225.5 49 198.0 50 155.5 51 120.5 52 102.5 53 77.0 54 49.0 55 38.5 56 27.0 57 16.0 58 7.0 59 5.0 60 5.5 61 1.5 62 0.0 63 0.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16044187269857 90.45 2 4.497632824829037 8.55 3 0.31562335612835346 0.8999999999999999 4 0.026301946344029457 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.5374999999999996 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.15 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.199999999999999 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161478 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3335 37.0 37.0 37.0 37.0 37.0 2 36.0845 37.0 37.0 37.0 37.0 37.0 3 36.1305 37.0 37.0 37.0 37.0 37.0 4 36.1455 37.0 37.0 37.0 37.0 37.0 5 36.12 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.253 37.0 37.0 37.0 37.0 37.0 8 36.2475 37.0 37.0 37.0 37.0 37.0 9 36.1975 37.0 37.0 37.0 37.0 37.0 10-14 36.239599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2468 37.0 37.0 37.0 37.0 37.0 20-24 36.1727 37.0 37.0 37.0 37.0 37.0 25-29 36.0731 37.0 37.0 37.0 37.0 37.0 30-34 36.0653 37.0 37.0 37.0 37.0 37.0 35-39 36.0281 37.0 37.0 37.0 37.0 37.0 40-44 35.962399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0159 37.0 37.0 37.0 37.0 37.0 50-54 35.9694 37.0 37.0 37.0 37.0 37.0 55-59 35.9588 37.0 37.0 37.0 37.0 37.0 60-64 35.870599999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.879999999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.891200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.794 37.0 37.0 37.0 37.0 37.0 80-84 35.7987 37.0 37.0 37.0 37.0 37.0 85-89 35.804199999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.7498 37.0 37.0 37.0 37.0 37.0 95-99 35.6968 37.0 37.0 37.0 37.0 37.0 100-104 35.7077 37.0 37.0 37.0 37.0 37.0 105-109 35.6764 37.0 37.0 37.0 37.0 37.0 110-114 35.564 37.0 37.0 37.0 37.0 37.0 115-119 35.6449 37.0 37.0 37.0 37.0 37.0 120-124 35.491600000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5264 37.0 37.0 37.0 37.0 37.0 130-134 35.4865 37.0 37.0 37.0 37.0 37.0 135-139 35.4427 37.0 37.0 37.0 37.0 37.0 140-144 35.2413 37.0 37.0 37.0 34.6 37.0 145-149 35.2728 37.0 37.0 37.0 34.6 37.0 150-151 34.98125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 2.0 16 2.0 17 0.0 18 5.0 19 0.0 20 3.0 21 1.0 22 5.0 23 6.0 24 8.0 25 5.0 26 12.0 27 8.0 28 11.0 29 27.0 30 32.0 31 46.0 32 66.0 33 101.0 34 209.0 35 606.0 36 2607.0 37 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.625 23.825 11.625 26.924999999999997 2 26.924999999999997 27.775 29.625 15.675 3 19.05 27.575 33.875 19.5 4 23.1 33.050000000000004 24.125 19.725 5 23.375 37.824999999999996 22.45 16.35 6 21.125 38.425 23.225 17.224999999999998 7 20.225 22.575 39.475 17.724999999999998 8 21.05 26.450000000000003 28.449999999999996 24.05 9 21.45 24.675 30.325000000000003 23.549999999999997 10-14 23.255 28.849999999999998 26.735 21.16 15-19 22.470000000000002 28.449999999999996 28.199999999999996 20.880000000000003 20-24 23.325000000000003 28.415000000000003 27.689999999999998 20.57 25-29 22.900000000000002 28.7 28.055000000000003 20.345 30-34 22.95 28.610000000000003 28.43 20.01 35-39 22.915 28.54 28.02 20.525 40-44 23.405 28.665000000000003 27.675 20.255000000000003 45-49 23.02 28.77 28.310000000000002 19.900000000000002 50-54 23.315 28.515 28.24 19.93 55-59 23.494999999999997 28.854999999999997 28.205000000000002 19.445 60-64 22.875 29.285 28.51 19.33 65-69 22.945 28.405 28.765 19.885 70-74 23.89 28.67 27.625 19.814999999999998 75-79 23.69 28.754999999999995 27.54 20.015 80-84 23.34 28.77 27.865000000000002 20.025000000000002 85-89 23.405 28.415000000000003 28.645 19.535 90-94 23.59 28.185 28.48 19.744999999999997 95-99 23.56 28.515 28.165000000000003 19.759999999999998 100-104 23.645 29.015 27.395000000000003 19.945 105-109 23.794999999999998 28.505000000000003 28.144999999999996 19.555 110-114 24.375 28.355000000000004 27.83 19.439999999999998 115-119 23.335 28.975 27.82 19.869999999999997 120-124 24.33 28.299999999999997 28.015 19.355 125-129 24.195 28.9 27.565 19.34 130-134 24.525 28.58 27.46 19.435 135-139 25.245 28.575 26.955000000000002 19.225 140-144 24.97 28.849999999999998 27.310000000000002 18.87 145-149 25.085 28.665000000000003 27.1 19.15 150-151 26.25 27.1625 26.8 19.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 4.0 27 6.5 28 5.5 29 8.5 30 13.0 31 17.0 32 24.0 33 34.0 34 53.0 35 71.0 36 90.0 37 122.0 38 165.0 39 198.5 40 233.0 41 267.5 42 287.5 43 289.0 44 296.5 45 288.5 46 269.5 47 263.0 48 218.0 49 181.5 50 155.5 51 123.5 52 91.5 53 63.5 54 44.0 55 29.0 56 21.0 57 13.0 58 8.5 59 5.0 60 3.5 61 4.5 62 3.5 63 1.0 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.09622989717901 90.17500000000001 2 4.455576061165305 8.450000000000001 3 0.3691009754811495 1.05 4 0.05272871078302136 0.2 5 0.02636435539151068 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGATG 10 0.006830828 145.0 145 AAAAAAA 20 0.00593511 29.0 45-49 >>END_MODULE Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011277 spots for SRR12161478.sra Written 2011277 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra Read 2011266 spots for SRR12161478.sra Written 2011266 spots for SRR12161478.sra SRR ids: ['SRR12161478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y1ux3ei8 SRR12161478.sra spots: 40225331 blocks: [[1, 2011266], [2011267, 4022532], [4022533, 6033798], [6033799, 8045064], [8045065, 10056330], [10056331, 12067596], [12067597, 14078862], [14078863, 16090128], [16090129, 18101394], [18101395, 20112660], [20112661, 22123926], [22123927, 24135192], [24135193, 26146458], [26146459, 28157724], [28157725, 30168990], [30168991, 32180256], [32180257, 34191522], [34191523, 36202788], [36202789, 38214054], [38214055, 40225331]] SRR12161478 file size 13648626 SRR12161478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161478 SRR12161478_1.fastq SRR12161478_2.fastq Input file: SRR12161478_1.fastq Paired file: SRR12161478_2.fastq trimmed: SRR12161478-trimmed-pair1.fastq, SRR12161478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:30:06 2025 >> started Fri Feb 14 00:30:51 2025 >> done (44.987s) 40225331 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 10295 ( 0.03%) empty read pairs filtered out after trimming by size control 40214963 (99.97%) read pairs available; of these: 4197511 (10.44%) trimmed read pairs available after processing 36017452 (89.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 11 0.00% 21 4 0.00% 22 12 0.00% 23 16 0.00% 24 19 0.00% 25 15 0.00% 26 21 0.00% 27 19 0.00% 28 27 0.00% 29 26 0.00% 30 31 0.00% 31 28 0.00% 32 30 0.00% 33 32 0.00% 34 32 0.00% 35 44 0.00% 36 33 0.00% 37 40 0.00% 38 53 0.00% 39 61 0.00% 40 56 0.00% 41 49 0.00% 42 74 0.00% 43 66 0.00% 44 80 0.00% 45 73 0.00% 46 90 0.00% 47 75 0.00% 48 108 0.00% 49 113 0.00% 50 119 0.00% 51 138 0.00% 52 153 0.00% 53 146 0.00% 54 137 0.00% 55 184 0.00% 56 193 0.00% 57 190 0.00% 58 242 0.00% 59 289 0.00% 60 339 0.00% 61 403 0.00% 62 459 0.00% 63 509 0.00% 64 509 0.00% 65 585 0.00% 66 626 0.00% 67 718 0.00% 68 766 0.00% 69 861 0.00% 70 1031 0.00% 71 1162 0.00% 72 1445 0.00% 73 1606 0.00% 74 1762 0.00% 75 2027 0.01% 76 2233 0.01% 77 2402 0.01% 78 2582 0.01% 79 3106 0.01% 80 3421 0.01% 81 3921 0.01% 82 4484 0.01% 83 5142 0.01% 84 5834 0.01% 85 6492 0.02% 86 7004 0.02% 87 7667 0.02% 88 8303 0.02% 89 9194 0.02% 90 10158 0.03% 91 11175 0.03% 92 12563 0.03% 93 13780 0.03% 94 15480 0.04% 95 16903 0.04% 96 18059 0.04% 97 19596 0.05% 98 21037 0.05% 99 22189 0.06% 100 23715 0.06% 101 25865 0.06% 102 27594 0.07% 103 29876 0.07% 104 32022 0.08% 105 34294 0.09% 106 36649 0.09% 107 38316 0.10% 108 40001 0.10% 109 41974 0.10% 110 43529 0.11% 111 45567 0.11% 112 48007 0.12% 113 49704 0.12% 114 53365 0.13% 115 55914 0.14% 116 57682 0.14% 117 60289 0.15% 118 62233 0.15% 119 63508 0.16% 120 65794 0.16% 121 68409 0.17% 122 69473 0.17% 123 72935 0.18% 124 75514 0.19% 125 77766 0.19% 126 80357 0.20% 127 83738 0.21% 128 85193 0.21% 129 85993 0.21% 130 88708 0.22% 131 90348 0.22% 132 92656 0.23% 133 95786 0.24% 134 98353 0.24% 135 100336 0.25% 136 102986 0.26% 137 105474 0.26% 138 107514 0.27% 139 108905 0.27% 140 109660 0.27% 141 111465 0.28% 142 114962 0.29% 143 116183 0.29% 144 118517 0.29% 145 121244 0.30% 146 122648 0.30% 147 124570 0.31% 148 126595 0.31% 149 126300 0.31% 150 128354 0.32% 151 36017452 89.56% 40214963 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.9 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=446.09 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.68 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=3.1 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=363.75 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=32.3 sequence=AAGAAGAAGAAA SRR12161478 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:31:37 Started mapping on | Feb 14 00:31:37 Finished on | Feb 14 00:35:49 Mapping speed, Million of reads per hour | 574.50 Number of input reads | 40214963 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 38143861 Uniquely mapped reads % | 94.85% Average mapped length | 296.11 Number of splices: Total | 39703987 Number of splices: Annotated (sjdb) | 38877812 Number of splices: GT/AG | 39058399 Number of splices: GC/AG | 514138 Number of splices: AT/AC | 31971 Number of splices: Non-canonical | 99479 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 895275 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 50161 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1175827 1175827 1175827 N_multimapping 895275 895275 895275 N_noFeature 1152636 37803120 1320162 N_ambiguous 382897 1701 208696 UnstrandedReadsAssigned:36608328 PositiveStrandReadsAssigned:339040 NegativeStrandReadsAssigned:36615003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161478-trimmed-pair1.fastq SRR12161478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,214,963 reads, 36,546,466 reads pseudoaligned [quant] estimated average fragment length: 248.846 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR12161478.ke.tsv 34699 SRR12161478.se.tsv 87100 total ==> SRR12161478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.15 3827 63.2712 Potri.005G024800.1.v4.1 1035 787.154 672 24.9844 Potri.004G059700.1.v4.1 961 713.258 197 8.08311 Potri.007G009000.2.v4.1 1416 1168.15 0 0 Potri.003G141000.2.v4.1 2943 2695.15 1602.16 17.3972 Potri.016G087400.1.v4.1 270 83.3313 1980 695.369 Potri.015G069301.1.v4.1 564 325.358 0 0 Potri.010G195200.1.v4.1 1773 1525.15 616 11.8202 Potri.012G127500.1.v4.1 977 729.227 7496 300.833 ==> SRR12161478.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 903 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 435 SRR12161478 completed mapping pipeline successfully