Starting /dee2/code/volunteer_pipeline.sh SRR12161479 current disk space = 3089091338240 free memory = 1405749412 SRR12161479 SRAfilesize 505586e862b8f08cbc3579714a064863 SRR12161479.sra SRR12161479.sra file validated SRR12161479 is paired end SRR12161479 is conventional basespace SRR12161479 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.49925 37.0 37.0 37.0 37.0 37.0 2 36.31 37.0 37.0 37.0 37.0 37.0 3 36.3745 37.0 37.0 37.0 37.0 37.0 4 36.5 37.0 37.0 37.0 37.0 37.0 5 36.5415 37.0 37.0 37.0 37.0 37.0 6 36.4415 37.0 37.0 37.0 37.0 37.0 7 36.443 37.0 37.0 37.0 37.0 37.0 8 36.4555 37.0 37.0 37.0 37.0 37.0 9 36.451 37.0 37.0 37.0 37.0 37.0 10-14 36.48010000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4754 37.0 37.0 37.0 37.0 37.0 20-24 36.443999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3798 37.0 37.0 37.0 37.0 37.0 30-34 36.3471 37.0 37.0 37.0 37.0 37.0 35-39 36.3071 37.0 37.0 37.0 37.0 37.0 40-44 36.2909 37.0 37.0 37.0 37.0 37.0 45-49 36.2994 37.0 37.0 37.0 37.0 37.0 50-54 36.267399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2786 37.0 37.0 37.0 37.0 37.0 60-64 36.223 37.0 37.0 37.0 37.0 37.0 65-69 36.1961 37.0 37.0 37.0 37.0 37.0 70-74 36.1555 37.0 37.0 37.0 37.0 37.0 75-79 36.1743 37.0 37.0 37.0 37.0 37.0 80-84 36.1653 37.0 37.0 37.0 37.0 37.0 85-89 36.0467 37.0 37.0 37.0 37.0 37.0 90-94 36.05499999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.0851 37.0 37.0 37.0 37.0 37.0 100-104 36.0263 37.0 37.0 37.0 37.0 37.0 105-109 35.9655 37.0 37.0 37.0 37.0 37.0 110-114 35.943799999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.967 37.0 37.0 37.0 37.0 37.0 120-124 36.0028 37.0 37.0 37.0 37.0 37.0 125-129 35.933800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8471 37.0 37.0 37.0 37.0 37.0 135-139 35.7653 37.0 37.0 37.0 37.0 37.0 140-144 35.73729999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.755399999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.518 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 1.0 26 6.0 27 9.0 28 15.0 29 23.0 30 42.0 31 41.0 32 53.0 33 82.0 34 158.0 35 348.0 36 2910.0 37 306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.5564738292011 12.997746055597295 6.2860005008765345 34.15977961432507 2 22.5 12.0 34.325 31.175000000000004 3 15.925 18.425 29.225 36.425000000000004 4 20.974999999999998 26.3 24.775 27.950000000000003 5 22.75 32.300000000000004 24.425 20.525 6 21.175 35.825 22.775000000000002 20.225 7 15.325 26.35 42.725 15.6 8 17.150000000000002 27.35 29.5 26.0 9 17.5 24.675 34.475 23.35 10-14 18.57 30.3 27.725 23.405 15-19 19.24 28.749999999999996 27.98 24.03 20-24 19.465 28.575 28.38 23.580000000000002 25-29 19.794999999999998 29.015 27.855 23.335 30-34 20.14 28.88 27.37 23.61 35-39 19.12 28.875 28.1 23.905 40-44 19.325 28.544999999999998 28.37 23.76 45-49 19.46 29.020000000000003 27.73 23.79 50-54 19.875 28.645 28.26 23.22 55-59 19.830000000000002 28.355000000000004 27.93 23.885 60-64 19.919999999999998 28.16 27.985 23.935000000000002 65-69 19.46 29.049999999999997 27.560000000000002 23.93 70-74 19.814999999999998 28.29 28.49 23.405 75-79 20.035 29.28 27.465 23.22 80-84 19.965 28.63 27.845 23.56 85-89 19.97 28.705000000000002 27.775 23.549999999999997 90-94 19.775000000000002 28.494999999999997 28.050000000000004 23.68 95-99 20.48 28.57 27.534999999999997 23.415 100-104 19.98 28.215 28.07 23.735 105-109 20.424999999999997 28.535 27.905 23.135 110-114 19.885 29.065 27.595 23.455000000000002 115-119 20.580000000000002 28.610000000000003 27.555000000000003 23.255 120-124 19.91 29.365000000000002 27.095000000000002 23.630000000000003 125-129 19.79 28.565 27.97 23.674999999999997 130-134 20.525 28.685 27.389999999999997 23.400000000000002 135-139 20.73 28.71 27.515 23.044999999999998 140-144 20.825 28.249999999999996 27.265 23.66 145-149 20.51 28.52 27.505000000000003 23.465 150-151 19.6375 28.4125 27.9125 24.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 4.0 27 7.5 28 8.0 29 9.5 30 16.5 31 22.0 32 26.5 33 35.0 34 49.5 35 65.0 36 83.5 37 107.5 38 143.0 39 170.0 40 204.5 41 242.5 42 248.5 43 266.5 44 291.0 45 297.0 46 299.5 47 278.0 48 237.0 49 202.0 50 169.5 51 139.5 52 106.5 53 74.0 54 59.0 55 50.5 56 30.0 57 18.0 58 13.5 59 7.0 60 3.0 61 1.0 62 3.0 63 2.5 64 0.0 65 0.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.18800946621089 90.5 2 4.522745201156981 8.6 3 0.236655272153563 0.675 4 0.026295030239284777 0.1 5 0.026295030239284777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.4625000000000004 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 5.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161479 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.215 37.0 37.0 37.0 37.0 37.0 2 35.969 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.0855 37.0 37.0 37.0 37.0 37.0 5 36.1185 37.0 37.0 37.0 37.0 37.0 6 36.1625 37.0 37.0 37.0 37.0 37.0 7 36.1805 37.0 37.0 37.0 37.0 37.0 8 36.137 37.0 37.0 37.0 37.0 37.0 9 36.191 37.0 37.0 37.0 37.0 37.0 10-14 36.1925 37.0 37.0 37.0 37.0 37.0 15-19 36.214000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.126 37.0 37.0 37.0 37.0 37.0 25-29 36.035900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.040800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0005 37.0 37.0 37.0 37.0 37.0 40-44 36.031400000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.95270000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9229 37.0 37.0 37.0 37.0 37.0 55-59 35.9149 37.0 37.0 37.0 37.0 37.0 60-64 35.833299999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.795300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7845 37.0 37.0 37.0 37.0 37.0 75-79 35.7685 37.0 37.0 37.0 37.0 37.0 80-84 35.7195 37.0 37.0 37.0 37.0 37.0 85-89 35.685700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.604299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.6678 37.0 37.0 37.0 37.0 37.0 100-104 35.653800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.5746 37.0 37.0 37.0 37.0 37.0 110-114 35.5116 37.0 37.0 37.0 37.0 37.0 115-119 35.5932 37.0 37.0 37.0 37.0 37.0 120-124 35.5321 37.0 37.0 37.0 37.0 37.0 125-129 35.450599999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.4486 37.0 37.0 37.0 37.0 37.0 135-139 35.375099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2308 37.0 37.0 37.0 32.2 37.0 145-149 35.268100000000004 37.0 37.0 37.0 34.6 37.0 150-151 34.837 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 3.0 16 3.0 17 5.0 18 1.0 19 4.0 20 0.0 21 4.0 22 3.0 23 3.0 24 8.0 25 11.0 26 7.0 27 16.0 28 11.0 29 21.0 30 47.0 31 49.0 32 65.0 33 121.0 34 218.0 35 524.0 36 2653.0 37 217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5 26.625 7.95 22.925 2 27.200000000000003 25.974999999999998 29.875 16.950000000000003 3 20.8 27.3 33.300000000000004 18.6 4 22.275 34.050000000000004 24.224999999999998 19.45 5 23.775 37.225 22.35 16.650000000000002 6 22.475 37.974999999999994 22.1 17.45 7 19.45 22.675 39.900000000000006 17.974999999999998 8 21.25 24.9 28.925 24.925 9 22.525000000000002 24.224999999999998 29.95 23.3 10-14 22.765 29.285 27.175 20.775 15-19 23.135 28.48 27.935 20.45 20-24 22.355 28.410000000000004 28.32 20.915 25-29 22.564999999999998 28.415000000000003 28.51 20.51 30-34 23.075000000000003 28.720000000000002 27.83 20.375 35-39 22.85 28.055000000000003 28.325 20.77 40-44 23.32 28.494999999999997 27.79 20.395 45-49 22.795 28.465 28.185 20.555 50-54 22.875 29.294999999999998 28.244999999999997 19.585 55-59 23.055 29.025000000000002 27.815 20.105 60-64 23.515 28.689999999999998 27.655 20.14 65-69 23.345 28.07 28.455000000000002 20.13 70-74 23.44 28.095 28.435 20.03 75-79 22.84 28.59 28.26 20.31 80-84 23.43 27.97 28.389999999999997 20.21 85-89 23.915 28.044999999999998 28.34 19.7 90-94 23.615 28.244999999999997 28.000000000000004 20.14 95-99 23.34 28.105000000000004 28.725 19.830000000000002 100-104 23.775 28.365000000000002 28.189999999999998 19.67 105-109 24.215 27.955000000000002 27.88 19.950000000000003 110-114 23.68 28.73 27.855 19.735 115-119 24.465 28.565 27.310000000000002 19.66 120-124 24.34 27.62 28.525 19.515 125-129 24.255 28.515 27.615000000000002 19.615 130-134 24.54 28.165000000000003 27.575 19.72 135-139 24.65 27.87 27.67 19.81 140-144 24.665 27.77 27.800000000000004 19.765 145-149 24.779999999999998 27.775 27.425 20.02 150-151 24.125 28.237499999999997 28.499999999999996 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 1.0 20 1.0 21 2.0 22 2.5 23 2.0 24 2.5 25 3.0 26 3.0 27 3.0 28 4.5 29 7.0 30 16.0 31 23.5 32 29.5 33 39.0 34 48.0 35 64.0 36 98.5 37 129.0 38 147.0 39 184.0 40 224.0 41 244.5 42 275.0 43 299.0 44 299.5 45 302.5 46 272.0 47 247.0 48 230.5 49 185.0 50 140.5 51 107.5 52 92.0 53 79.0 54 55.5 55 34.0 56 24.5 57 20.0 58 13.0 59 6.0 60 6.0 61 3.5 62 1.0 63 1.5 64 0.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 1.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.31208849091388 90.47500000000001 2 4.371872530945483 8.3 3 0.21069265209375823 0.6 4 0.05267316302343956 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02633658151171978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02633658151171978 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0250000000000004 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672881 spots for SRR12161479.sra Written 1672881 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra Read 1672880 spots for SRR12161479.sra Written 1672880 spots for SRR12161479.sra SRR ids: ['SRR12161479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ldxmes4 SRR12161479.sra spots: 33457601 blocks: [[1, 1672880], [1672881, 3345760], [3345761, 5018640], [5018641, 6691520], [6691521, 8364400], [8364401, 10037280], [10037281, 11710160], [11710161, 13383040], [13383041, 15055920], [15055921, 16728800], [16728801, 18401680], [18401681, 20074560], [20074561, 21747440], [21747441, 23420320], [23420321, 25093200], [25093201, 26766080], [26766081, 28438960], [28438961, 30111840], [30111841, 31784720], [31784721, 33457601]] SRR12161479 file size 11348656 SRR12161479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161479 SRR12161479_1.fastq SRR12161479_2.fastq Input file: SRR12161479_1.fastq Paired file: SRR12161479_2.fastq trimmed: SRR12161479-trimmed-pair1.fastq, SRR12161479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:55:42 2025 >> started Fri Feb 14 00:56:33 2025 >> done (50.891s) 33457601 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 4628 ( 0.01%) empty read pairs filtered out after trimming by size control 33452909 (99.99%) read pairs available; of these: 2658472 ( 7.95%) trimmed read pairs available after processing 30794437 (92.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 10 0.00% 21 20 0.00% 22 23 0.00% 23 22 0.00% 24 28 0.00% 25 41 0.00% 26 40 0.00% 27 37 0.00% 28 28 0.00% 29 47 0.00% 30 34 0.00% 31 38 0.00% 32 43 0.00% 33 43 0.00% 34 43 0.00% 35 53 0.00% 36 63 0.00% 37 53 0.00% 38 59 0.00% 39 58 0.00% 40 55 0.00% 41 51 0.00% 42 75 0.00% 43 77 0.00% 44 61 0.00% 45 79 0.00% 46 87 0.00% 47 83 0.00% 48 97 0.00% 49 89 0.00% 50 97 0.00% 51 117 0.00% 52 114 0.00% 53 147 0.00% 54 153 0.00% 55 122 0.00% 56 165 0.00% 57 174 0.00% 58 173 0.00% 59 195 0.00% 60 251 0.00% 61 282 0.00% 62 285 0.00% 63 326 0.00% 64 336 0.00% 65 387 0.00% 66 424 0.00% 67 481 0.00% 68 535 0.00% 69 559 0.00% 70 666 0.00% 71 738 0.00% 72 818 0.00% 73 978 0.00% 74 1117 0.00% 75 1214 0.00% 76 1315 0.00% 77 1501 0.00% 78 1616 0.00% 79 1779 0.01% 80 2123 0.01% 81 2373 0.01% 82 2762 0.01% 83 3095 0.01% 84 3332 0.01% 85 3759 0.01% 86 4087 0.01% 87 4381 0.01% 88 4755 0.01% 89 5296 0.02% 90 5885 0.02% 91 6665 0.02% 92 7619 0.02% 93 8375 0.03% 94 9352 0.03% 95 10035 0.03% 96 10950 0.03% 97 11183 0.03% 98 11851 0.04% 99 13030 0.04% 100 13967 0.04% 101 14951 0.04% 102 16726 0.05% 103 18068 0.05% 104 19310 0.06% 105 20566 0.06% 106 21567 0.06% 107 22474 0.07% 108 23539 0.07% 109 24336 0.07% 110 25911 0.08% 111 27426 0.08% 112 29114 0.09% 113 31046 0.09% 114 32968 0.10% 115 34453 0.10% 116 35317 0.11% 117 36431 0.11% 118 37328 0.11% 119 38612 0.12% 120 39705 0.12% 121 42128 0.13% 122 43286 0.13% 123 45750 0.14% 124 48423 0.14% 125 49202 0.15% 126 51164 0.15% 127 52263 0.16% 128 54167 0.16% 129 53978 0.16% 130 54755 0.16% 131 56828 0.17% 132 59081 0.18% 133 60682 0.18% 134 63571 0.19% 135 66169 0.20% 136 67560 0.20% 137 67709 0.20% 138 68509 0.20% 139 69203 0.21% 140 71122 0.21% 141 72350 0.22% 142 74157 0.22% 143 75950 0.23% 144 79387 0.24% 145 80976 0.24% 146 81792 0.24% 147 82883 0.25% 148 83133 0.25% 149 84012 0.25% 150 84936 0.25% 151 30794437 92.05% 33452909 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=35.51 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTCGTTGTTGAAGGTAACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCTTCGAATCGATGATTTCACCGTACTGGCTAAACGCTTCTTGAAGGGATTGGTCAGTAGTGGCCCATGCGAGGCCACCAACAAAGC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=18 prefix-density=0.91 prefix-fanout=2.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=114.42 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.1 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR12161479 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:57:17 Started mapping on | Feb 14 00:57:17 Finished on | Feb 14 01:00:49 Mapping speed, Million of reads per hour | 568.07 Number of input reads | 33452909 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 31467836 Uniquely mapped reads % | 94.07% Average mapped length | 297.18 Number of splices: Total | 32553678 Number of splices: Annotated (sjdb) | 31868181 Number of splices: GT/AG | 32027215 Number of splices: GC/AG | 416206 Number of splices: AT/AC | 27596 Number of splices: Non-canonical | 82661 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 742547 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 38209 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1242526 1242526 1242526 N_multimapping 742547 742547 742547 N_noFeature 999695 31198131 1128532 N_ambiguous 326279 1647 184385 UnstrandedReadsAssigned:30141862 PositiveStrandReadsAssigned:268058 NegativeStrandReadsAssigned:30154919 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161479-trimmed-pair1.fastq SRR12161479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,452,909 reads, 30,050,222 reads pseudoaligned [quant] estimated average fragment length: 267.33 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR12161479.ke.tsv 34699 SRR12161479.se.tsv 87100 total ==> SRR12161479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.67 2857 55.5478 Potri.005G024800.1.v4.1 1035 768.67 417 18.4759 Potri.004G059700.1.v4.1 961 694.9 111 5.44014 Potri.007G009000.2.v4.1 1416 1149.67 0 0 Potri.003G141000.2.v4.1 2943 2676.67 1146.48 14.5875 Potri.016G087400.1.v4.1 270 80.0269 1227 522.177 Potri.015G069301.1.v4.1 564 312.617 0 0 Potri.010G195200.1.v4.1 1773 1506.67 382.682 8.65026 Potri.012G127500.1.v4.1 977 710.79 7420 355.527 ==> SRR12161479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 642 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 675 SRR12161479 completed mapping pipeline successfully