Starting /dee2/code/volunteer_pipeline.sh SRR12161480 current disk space = 3089048006656 free memory = 1450033144 SRR12161480 SRAfilesize 0e603c8663203bc2f77d647ae1e20729 SRR12161480.sra SRR12161480.sra file validated SRR12161480 is paired end SRR12161480 is conventional basespace SRR12161480 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.403 37.0 37.0 37.0 37.0 37.0 2 36.324 37.0 37.0 37.0 37.0 37.0 3 36.5165 37.0 37.0 37.0 37.0 37.0 4 36.4955 37.0 37.0 37.0 37.0 37.0 5 36.6335 37.0 37.0 37.0 37.0 37.0 6 36.6105 37.0 37.0 37.0 37.0 37.0 7 36.4285 37.0 37.0 37.0 37.0 37.0 8 36.454 37.0 37.0 37.0 37.0 37.0 9 36.429 37.0 37.0 37.0 37.0 37.0 10-14 36.50619999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4751 37.0 37.0 37.0 37.0 37.0 20-24 36.463300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.438100000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.396699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.328199999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3092 37.0 37.0 37.0 37.0 37.0 45-49 36.3095 37.0 37.0 37.0 37.0 37.0 50-54 36.2855 37.0 37.0 37.0 37.0 37.0 55-59 36.2436 37.0 37.0 37.0 37.0 37.0 60-64 36.1765 37.0 37.0 37.0 37.0 37.0 65-69 36.1575 37.0 37.0 37.0 37.0 37.0 70-74 36.1711 37.0 37.0 37.0 37.0 37.0 75-79 36.142900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.121 37.0 37.0 37.0 37.0 37.0 85-89 36.1004 37.0 37.0 37.0 37.0 37.0 90-94 36.1005 37.0 37.0 37.0 37.0 37.0 95-99 36.0355 37.0 37.0 37.0 37.0 37.0 100-104 35.940599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9673 37.0 37.0 37.0 37.0 37.0 110-114 35.8919 37.0 37.0 37.0 37.0 37.0 115-119 35.932900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9239 37.0 37.0 37.0 37.0 37.0 125-129 35.8438 37.0 37.0 37.0 37.0 37.0 130-134 35.7661 37.0 37.0 37.0 37.0 37.0 135-139 35.712399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.6456 37.0 37.0 37.0 37.0 37.0 145-149 35.6805 37.0 37.0 37.0 37.0 37.0 150-151 35.4075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 4.0 24 4.0 25 2.0 26 9.0 27 10.0 28 12.0 29 18.0 30 37.0 31 45.0 32 55.0 33 93.0 34 143.0 35 355.0 36 2889.0 37 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.02754131196795 13.169754631947923 7.085628442663997 44.717075613420135 2 17.224999999999998 12.625 42.075 28.075 3 16.3 17.424999999999997 28.475 37.8 4 19.225 25.55 25.874999999999996 29.349999999999998 5 21.3 31.075000000000003 26.375 21.25 6 20.875 34.0 24.9 20.225 7 13.725000000000001 27.0 42.9 16.375 8 16.275000000000002 26.575 34.025 23.125 9 16.0 23.425 36.675000000000004 23.9 10-14 18.92 29.65 28.549999999999997 22.88 15-19 18.72 29.09 27.845 24.345 20-24 19.2 29.675 28.29 22.835 25-29 18.345 29.07 28.92 23.665 30-34 18.490000000000002 28.98 28.599999999999998 23.93 35-39 19.24 29.104999999999997 27.735 23.919999999999998 40-44 19.08 28.389999999999997 28.63 23.9 45-49 18.92 29.310000000000002 27.725 24.044999999999998 50-54 19.08 28.560000000000002 29.270000000000003 23.09 55-59 19.45 28.7 28.185 23.665 60-64 19.32 28.83 28.189999999999998 23.66 65-69 19.285 28.455000000000002 28.48 23.78 70-74 19.205 29.375 27.46 23.96 75-79 19.650000000000002 28.815 28.325 23.21 80-84 19.295 29.275000000000002 28.08 23.35 85-89 19.025 29.104999999999997 27.85 24.02 90-94 19.52 27.96 28.215 24.305 95-99 19.5 28.95 27.944999999999997 23.605 100-104 19.580000000000002 28.63 28.525 23.265 105-109 19.220000000000002 28.615000000000002 28.365000000000002 23.799999999999997 110-114 19.64 28.46 28.475 23.425 115-119 19.7 29.304999999999996 27.689999999999998 23.305 120-124 19.73 28.720000000000002 28.084999999999997 23.465 125-129 20.085 28.865000000000002 27.965 23.085 130-134 20.345 28.675 27.66 23.32 135-139 20.1 28.58 27.639999999999997 23.68 140-144 20.01 28.910000000000004 27.49 23.59 145-149 20.005 28.544999999999998 28.015 23.435 150-151 20.0 28.875 27.212500000000002 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 1.5 5 1.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 1.5 25 2.0 26 5.0 27 6.0 28 7.0 29 12.0 30 18.0 31 28.0 32 37.5 33 46.0 34 61.5 35 77.5 36 91.5 37 118.0 38 150.5 39 186.0 40 217.0 41 241.0 42 273.0 43 285.5 44 296.5 45 298.0 46 272.0 47 251.5 48 233.0 49 203.5 50 160.5 51 118.0 52 84.5 53 61.5 54 48.0 55 34.0 56 26.5 57 19.0 58 6.5 59 2.5 60 2.0 61 1.0 62 0.5 63 1.0 64 0.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.279307631786 90.825 2 4.563335955940205 8.7 3 0.13113034356150013 0.375 4 0.026226068712300026 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGGA 10 0.006830828 145.0 145 ATCCAGT 10 0.006830828 145.0 1 TACGGGT 10 0.006830828 145.0 9 GAGTTAC 10 0.006830828 145.0 5 CGGGAGT 10 0.006830828 145.0 2 ACGGGAG 10 0.006830828 145.0 1 GTTACGG 10 0.006830828 145.0 7 GGAGTTA 10 0.006830828 145.0 4 TTACGGG 10 0.006830828 145.0 8 AGTTACG 10 0.006830828 145.0 6 >>END_MODULE SRR12161480 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2085 37.0 37.0 37.0 37.0 37.0 2 35.979 37.0 37.0 37.0 37.0 37.0 3 36.0655 37.0 37.0 37.0 37.0 37.0 4 36.078 37.0 37.0 37.0 37.0 37.0 5 36.1325 37.0 37.0 37.0 37.0 37.0 6 36.125 37.0 37.0 37.0 37.0 37.0 7 36.144 37.0 37.0 37.0 37.0 37.0 8 36.1855 37.0 37.0 37.0 37.0 37.0 9 36.087 37.0 37.0 37.0 37.0 37.0 10-14 36.198 37.0 37.0 37.0 37.0 37.0 15-19 36.195499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1738 37.0 37.0 37.0 37.0 37.0 25-29 36.03490000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.024899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.043099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.000099999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9774 37.0 37.0 37.0 37.0 37.0 50-54 35.9334 37.0 37.0 37.0 37.0 37.0 55-59 35.9079 37.0 37.0 37.0 37.0 37.0 60-64 35.8843 37.0 37.0 37.0 37.0 37.0 65-69 35.857800000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7817 37.0 37.0 37.0 37.0 37.0 75-79 35.84310000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.7321 37.0 37.0 37.0 37.0 37.0 85-89 35.754200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6973 37.0 37.0 37.0 37.0 37.0 95-99 35.664300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6999 37.0 37.0 37.0 37.0 37.0 105-109 35.6355 37.0 37.0 37.0 37.0 37.0 110-114 35.5491 37.0 37.0 37.0 37.0 37.0 115-119 35.566199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5589 37.0 37.0 37.0 37.0 37.0 125-129 35.451800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.408100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3786 37.0 37.0 37.0 37.0 37.0 140-144 35.181599999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.2221 37.0 37.0 37.0 27.4 37.0 150-151 34.86725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 2.0 20 2.0 21 4.0 22 3.0 23 7.0 24 3.0 25 7.0 26 12.0 27 17.0 28 18.0 29 29.0 30 29.0 31 50.0 32 70.0 33 106.0 34 227.0 35 655.0 36 2565.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.3 27.3 8.825 27.575 2 25.3 25.575 33.550000000000004 15.575 3 18.0 28.7 34.575 18.725 4 21.425 35.175 24.349999999999998 19.05 5 24.474999999999998 37.0 21.5 17.025000000000002 6 20.575 39.800000000000004 22.05 17.575 7 19.400000000000002 23.25 39.85 17.5 8 20.375 24.925 29.375 25.324999999999996 9 20.375 24.075 32.35 23.200000000000003 10-14 22.68 29.104999999999997 26.915 21.3 15-19 22.66 28.375 28.799999999999997 20.165 20-24 22.34 28.865000000000002 28.455000000000002 20.34 25-29 22.505 29.07 27.755000000000003 20.669999999999998 30-34 22.53 29.04 28.12 20.31 35-39 22.685 28.74 28.515 20.06 40-44 23.06 28.499999999999996 28.249999999999996 20.19 45-49 22.525000000000002 28.075 29.2 20.200000000000003 50-54 23.18 28.105000000000004 28.835 19.88 55-59 23.84 27.26 28.9 20.0 60-64 23.02 28.610000000000003 28.439999999999998 19.93 65-69 23.189999999999998 29.14 27.889999999999997 19.78 70-74 23.105 28.725 28.439999999999998 19.73 75-79 23.1 28.165000000000003 28.694999999999997 20.04 80-84 22.96 28.54 28.4 20.1 85-89 23.505000000000003 28.975 27.665 19.855 90-94 23.525 28.355000000000004 27.98 20.14 95-99 23.3 28.865000000000002 28.08 19.755 100-104 23.665 28.68 27.855 19.8 105-109 23.65 28.12 28.48 19.75 110-114 23.65 28.16 28.34 19.85 115-119 24.42 29.115000000000002 27.755000000000003 18.709999999999997 120-124 24.060000000000002 28.49 28.38 19.07 125-129 24.08 29.005 27.325 19.59 130-134 24.115000000000002 28.675 27.889999999999997 19.32 135-139 24.104999999999997 28.410000000000004 27.985 19.5 140-144 24.709999999999997 28.29 27.61 19.39 145-149 25.119999999999997 28.165000000000003 27.85 18.865000000000002 150-151 25.124999999999996 29.1625 26.8625 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 4.0 24 4.0 25 1.5 26 2.0 27 4.5 28 8.0 29 14.0 30 20.0 31 23.0 32 30.5 33 47.5 34 60.5 35 81.5 36 101.5 37 116.5 38 158.0 39 187.0 40 215.0 41 271.5 42 292.5 43 279.0 44 277.5 45 294.5 46 288.5 47 256.5 48 214.0 49 171.5 50 147.0 51 118.0 52 82.5 53 64.5 54 52.0 55 35.0 56 26.0 57 14.5 58 7.5 59 4.5 60 2.5 61 2.0 62 1.0 63 0.5 64 0.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4366640440598 90.975 2 4.353527406241804 8.3 3 0.13113034356150013 0.375 4 0.026226068712300026 0.1 5 0.05245213742460005 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGTAG 10 0.006830828 145.0 1 GGCTTGG 10 0.006830828 145.0 7 TGTAGGC 10 0.006830828 145.0 3 GCTTGGT 10 0.006830828 145.0 8 GTAGGCT 10 0.006830828 145.0 4 CTGTAGG 10 0.006830828 145.0 2 >>END_MODULE Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra Read 1696172 spots for SRR12161480.sra Written 1696172 spots for SRR12161480.sra Read 1696162 spots for SRR12161480.sra Written 1696162 spots for SRR12161480.sra SRR ids: ['SRR12161480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_15rcypko SRR12161480.sra spots: 33923250 blocks: [[1, 1696162], [1696163, 3392324], [3392325, 5088486], [5088487, 6784648], [6784649, 8480810], [8480811, 10176972], [10176973, 11873134], [11873135, 13569296], [13569297, 15265458], [15265459, 16961620], [16961621, 18657782], [18657783, 20353944], [20353945, 22050106], [22050107, 23746268], [23746269, 25442430], [25442431, 27138592], [27138593, 28834754], [28834755, 30530916], [30530917, 32227078], [32227079, 33923250]] SRR12161480 file size 11506904 SRR12161480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161480 SRR12161480_1.fastq SRR12161480_2.fastq Input file: SRR12161480_1.fastq Paired file: SRR12161480_2.fastq trimmed: SRR12161480-trimmed-pair1.fastq, SRR12161480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:13:15 2025 >> started Fri Feb 14 01:13:51 2025 >> done (36.626s) 33923250 read pairs processed; of these: 173 ( 0.00%) short read pairs filtered out after trimming by size control 21512 ( 0.06%) empty read pairs filtered out after trimming by size control 33901565 (99.94%) read pairs available; of these: 1931276 ( 5.70%) trimmed read pairs available after processing 31970289 (94.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 12 0.00% 21 19 0.00% 22 21 0.00% 23 31 0.00% 24 35 0.00% 25 53 0.00% 26 34 0.00% 27 61 0.00% 28 69 0.00% 29 64 0.00% 30 80 0.00% 31 61 0.00% 32 74 0.00% 33 75 0.00% 34 73 0.00% 35 87 0.00% 36 84 0.00% 37 95 0.00% 38 87 0.00% 39 106 0.00% 40 82 0.00% 41 81 0.00% 42 93 0.00% 43 94 0.00% 44 103 0.00% 45 140 0.00% 46 144 0.00% 47 119 0.00% 48 151 0.00% 49 153 0.00% 50 165 0.00% 51 155 0.00% 52 201 0.00% 53 199 0.00% 54 202 0.00% 55 221 0.00% 56 231 0.00% 57 270 0.00% 58 305 0.00% 59 321 0.00% 60 356 0.00% 61 416 0.00% 62 430 0.00% 63 471 0.00% 64 500 0.00% 65 500 0.00% 66 556 0.00% 67 657 0.00% 68 721 0.00% 69 737 0.00% 70 882 0.00% 71 1023 0.00% 72 1115 0.00% 73 1278 0.00% 74 1379 0.00% 75 1525 0.00% 76 1634 0.00% 77 1692 0.00% 78 1894 0.01% 79 2195 0.01% 80 2329 0.01% 81 2576 0.01% 82 3193 0.01% 83 3458 0.01% 84 3728 0.01% 85 4080 0.01% 86 4274 0.01% 87 4840 0.01% 88 5118 0.02% 89 5485 0.02% 90 6110 0.02% 91 6799 0.02% 92 7359 0.02% 93 8209 0.02% 94 8924 0.03% 95 9474 0.03% 96 9977 0.03% 97 10719 0.03% 98 11255 0.03% 99 11812 0.03% 100 12554 0.04% 101 13516 0.04% 102 14726 0.04% 103 15971 0.05% 104 16576 0.05% 105 17455 0.05% 106 18287 0.05% 107 18699 0.06% 108 19878 0.06% 109 19965 0.06% 110 21093 0.06% 111 21752 0.06% 112 23434 0.07% 113 24221 0.07% 114 25721 0.08% 115 26752 0.08% 116 27548 0.08% 117 28184 0.08% 118 28456 0.08% 119 29402 0.09% 120 30161 0.09% 121 31389 0.09% 122 32530 0.10% 123 33517 0.10% 124 34969 0.10% 125 35944 0.11% 126 36816 0.11% 127 37380 0.11% 128 38304 0.11% 129 37736 0.11% 130 38682 0.11% 131 39606 0.12% 132 40452 0.12% 133 41672 0.12% 134 43698 0.13% 135 44901 0.13% 136 45600 0.13% 137 46315 0.14% 138 46285 0.14% 139 46637 0.14% 140 46927 0.14% 141 47666 0.14% 142 48675 0.14% 143 49449 0.15% 144 52676 0.16% 145 53526 0.16% 146 53009 0.16% 147 53916 0.16% 148 54923 0.16% 149 54914 0.16% 150 54458 0.16% 151 31970289 94.30% 33901565 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=30 prefix-density=0.64 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=235.71 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=29.6 sequence=TCTTCATCATCA criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=27 prefix-density=0.71 prefix-fanout=2.6 sequence=GGTTTCTCAGAGAGCACCACAACCGAGACAATCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=352.15 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=32.7 sequence=AAGAAGAAGAAA SRR12161480 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:14:42 Started mapping on | Feb 14 01:14:43 Finished on | Feb 14 01:18:02 Mapping speed, Million of reads per hour | 613.29 Number of input reads | 33901565 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 32181451 Uniquely mapped reads % | 94.93% Average mapped length | 297.91 Number of splices: Total | 33636135 Number of splices: Annotated (sjdb) | 32858145 Number of splices: GT/AG | 33069968 Number of splices: GC/AG | 444639 Number of splices: AT/AC | 28082 Number of splices: Non-canonical | 93446 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 796990 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 24627 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 923124 923124 923124 N_multimapping 796990 796990 796990 N_noFeature 1150188 31908285 1272967 N_ambiguous 367772 1714 216507 UnstrandedReadsAssigned:30663491 PositiveStrandReadsAssigned:271452 NegativeStrandReadsAssigned:30691977 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161480-trimmed-pair1.fastq SRR12161480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,901,565 reads, 30,483,274 reads pseudoaligned [quant] estimated average fragment length: 301.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR12161480.ke.tsv 34699 SRR12161480.se.tsv 87100 total ==> SRR12161480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1717.82 3648 72.8568 Potri.005G024800.1.v4.1 1035 734.822 510 23.8112 Potri.004G059700.1.v4.1 961 661.06 46 2.38732 Potri.007G009000.2.v4.1 1416 1115.82 0 0 Potri.003G141000.2.v4.1 2943 2642.82 1257.36 16.3224 Potri.016G087400.1.v4.1 270 77.0154 1149 511.842 Potri.015G069301.1.v4.1 564 282.064 0 0 Potri.010G195200.1.v4.1 1773 1472.82 683.629 15.9244 Potri.012G127500.1.v4.1 977 676.94 11419 578.724 ==> SRR12161480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 718 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 477 SRR12161480 completed mapping pipeline successfully