Starting /dee2/code/volunteer_pipeline.sh SRR12161481 current disk space = 3087826214912 free memory = 1579320668 SRR12161481 SRAfilesize 3f9c188232756d9c6ca574c8c4676d0d SRR12161481.sra SRR12161481.sra file validated SRR12161481 is paired end SRR12161481 is conventional basespace SRR12161481 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4585 37.0 37.0 37.0 37.0 37.0 2 36.419 37.0 37.0 37.0 37.0 37.0 3 36.537 37.0 37.0 37.0 37.0 37.0 4 36.581 37.0 37.0 37.0 37.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 36.5775 37.0 37.0 37.0 37.0 37.0 7 36.551 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.5265 37.0 37.0 37.0 37.0 37.0 15-19 36.506600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4804 37.0 37.0 37.0 37.0 37.0 25-29 36.42569999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3777 37.0 37.0 37.0 37.0 37.0 35-39 36.3527 37.0 37.0 37.0 37.0 37.0 40-44 36.3392 37.0 37.0 37.0 37.0 37.0 45-49 36.33989999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.273900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3227 37.0 37.0 37.0 37.0 37.0 60-64 36.2105 37.0 37.0 37.0 37.0 37.0 65-69 36.225699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.124700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1547 37.0 37.0 37.0 37.0 37.0 80-84 36.1481 37.0 37.0 37.0 37.0 37.0 85-89 36.0468 37.0 37.0 37.0 37.0 37.0 90-94 36.0969 37.0 37.0 37.0 37.0 37.0 95-99 36.10000000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.0183 37.0 37.0 37.0 37.0 37.0 105-109 36.033500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.952200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.01610000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9706 37.0 37.0 37.0 37.0 37.0 125-129 35.9066 37.0 37.0 37.0 37.0 37.0 130-134 35.8178 37.0 37.0 37.0 37.0 37.0 135-139 35.8044 37.0 37.0 37.0 37.0 37.0 140-144 35.6738 37.0 37.0 37.0 37.0 37.0 145-149 35.716499999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.537 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 2.0 26 9.0 27 8.0 28 14.0 29 20.0 30 27.0 31 62.0 32 53.0 33 78.0 34 117.0 35 352.0 36 2917.0 37 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.57378689344672 11.955977988994498 6.4282141070535275 34.04202101050525 2 20.875 12.174999999999999 33.75 33.2 3 17.349999999999998 17.849999999999998 28.4 36.4 4 21.4 26.450000000000003 25.35 26.8 5 21.95 31.4 24.525 22.125 6 20.3 34.875 24.375 20.45 7 14.85 27.474999999999998 40.9 16.775000000000002 8 17.724999999999998 27.0 32.324999999999996 22.95 9 17.65 24.6 34.150000000000006 23.599999999999998 10-14 19.18 30.25 27.750000000000004 22.82 15-19 19.59 28.060000000000002 28.475 23.875 20-24 19.575 28.95 28.110000000000003 23.365 25-29 19.875 28.735 27.965 23.425 30-34 19.525000000000002 28.485 27.839999999999996 24.15 35-39 19.025 29.104999999999997 28.405 23.465 40-44 19.994999999999997 28.599999999999998 28.08 23.325000000000003 45-49 19.975 28.044999999999998 28.29 23.69 50-54 19.725 28.33 28.325 23.62 55-59 19.41 28.939999999999998 27.605 24.044999999999998 60-64 19.31 29.32 27.455000000000002 23.915 65-69 20.095 28.689999999999998 27.965 23.25 70-74 20.41 28.835 27.445000000000004 23.31 75-79 20.25 29.125 27.21 23.415 80-84 20.31 28.57 27.92 23.200000000000003 85-89 19.98 28.015 28.055000000000003 23.95 90-94 19.505 28.965000000000003 27.76 23.77 95-99 19.650000000000002 29.34 27.365000000000002 23.645 100-104 20.175 28.15 27.725 23.95 105-109 20.28 28.544999999999998 28.044999999999998 23.13 110-114 19.825 28.255000000000003 28.634999999999998 23.285 115-119 20.515 28.384999999999998 28.015 23.085 120-124 20.349999999999998 28.63 27.665 23.355 125-129 20.285 28.505000000000003 27.32 23.89 130-134 20.485 28.24 28.09 23.185 135-139 20.68 28.51 27.405 23.405 140-144 20.73 28.494999999999997 27.595 23.18 145-149 20.825 28.439999999999998 26.995 23.74 150-151 20.4625 28.199999999999996 28.3875 22.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 0.0 21 0.0 22 2.0 23 2.0 24 0.5 25 2.0 26 5.0 27 6.0 28 4.0 29 8.5 30 14.0 31 19.0 32 24.5 33 40.5 34 54.5 35 66.5 36 88.0 37 112.0 38 144.0 39 164.0 40 197.0 41 249.5 42 271.0 43 270.5 44 270.0 45 268.0 46 278.0 47 265.5 48 235.0 49 216.0 50 187.0 51 138.5 52 107.0 53 80.5 54 55.5 55 46.5 56 33.5 57 25.0 58 20.5 59 13.0 60 3.0 61 0.5 62 1.5 63 1.5 64 0.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05783385909568 90.4 2 4.73186119873817 9.0 3 0.2103049421661409 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.6500000000000004 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.7125000000000004 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAA 10 0.006830828 145.0 1 >>END_MODULE SRR12161481 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.341 37.0 37.0 37.0 37.0 37.0 2 35.957 37.0 37.0 37.0 37.0 37.0 3 36.1185 37.0 37.0 37.0 37.0 37.0 4 36.1955 37.0 37.0 37.0 37.0 37.0 5 36.1545 37.0 37.0 37.0 37.0 37.0 6 36.245 37.0 37.0 37.0 37.0 37.0 7 36.191 37.0 37.0 37.0 37.0 37.0 8 36.302 37.0 37.0 37.0 37.0 37.0 9 36.232 37.0 37.0 37.0 37.0 37.0 10-14 36.20360000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.201 37.0 37.0 37.0 37.0 37.0 20-24 36.195800000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.119299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.158699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.087 37.0 37.0 37.0 37.0 37.0 40-44 36.0775 37.0 37.0 37.0 37.0 37.0 45-49 36.0079 37.0 37.0 37.0 37.0 37.0 50-54 36.0229 37.0 37.0 37.0 37.0 37.0 55-59 36.0038 37.0 37.0 37.0 37.0 37.0 60-64 35.9009 37.0 37.0 37.0 37.0 37.0 65-69 35.892399999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8418 37.0 37.0 37.0 37.0 37.0 75-79 35.8835 37.0 37.0 37.0 37.0 37.0 80-84 35.827200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8019 37.0 37.0 37.0 37.0 37.0 90-94 35.691599999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7052 37.0 37.0 37.0 37.0 37.0 100-104 35.713499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.722300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6192 37.0 37.0 37.0 37.0 37.0 115-119 35.5417 37.0 37.0 37.0 37.0 37.0 120-124 35.5356 37.0 37.0 37.0 37.0 37.0 125-129 35.5333 37.0 37.0 37.0 37.0 37.0 130-134 35.4908 37.0 37.0 37.0 37.0 37.0 135-139 35.3613 37.0 37.0 37.0 34.6 37.0 140-144 35.312799999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.3527 37.0 37.0 37.0 34.6 37.0 150-151 35.046 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 3.0 16 3.0 17 1.0 18 2.0 19 5.0 20 3.0 21 5.0 22 5.0 23 7.0 24 4.0 25 15.0 26 10.0 27 10.0 28 12.0 29 21.0 30 28.0 31 37.0 32 60.0 33 103.0 34 193.0 35 531.0 36 2691.0 37 245.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.0 23.674999999999997 9.5 22.825 2 27.650000000000002 26.875 29.45 16.025 3 21.9 26.450000000000003 33.925 17.724999999999998 4 23.95 33.975 24.474999999999998 17.599999999999998 5 25.224999999999998 35.9 21.325 17.549999999999997 6 22.2 38.85 21.525 17.424999999999997 7 20.849999999999998 22.35 36.449999999999996 20.349999999999998 8 20.125 26.674999999999997 28.349999999999998 24.85 9 22.275 25.85 29.425 22.45 10-14 23.03 29.235 26.724999999999998 21.01 15-19 22.855 28.88 27.67 20.595 20-24 23.445 28.71 27.495000000000005 20.349999999999998 25-29 22.759999999999998 28.355000000000004 27.73 21.154999999999998 30-34 22.215 29.335 27.975 20.474999999999998 35-39 23.285 28.494999999999997 27.800000000000004 20.419999999999998 40-44 22.81 28.375 27.689999999999998 21.125 45-49 22.435 28.715000000000003 27.87 20.979999999999997 50-54 22.8 28.34 28.560000000000002 20.3 55-59 22.855 28.935 27.915 20.294999999999998 60-64 23.465 28.294999999999998 27.98 20.26 65-69 22.485 28.705000000000002 28.465 20.345 70-74 23.53 28.715000000000003 27.284999999999997 20.47 75-79 23.195 28.1 28.310000000000002 20.395 80-84 22.82 28.285 28.675 20.22 85-89 23.685000000000002 28.854999999999997 27.305 20.155 90-94 23.735 27.91 27.939999999999998 20.415 95-99 23.76 28.645 27.815 19.78 100-104 23.580000000000002 28.665000000000003 27.79 19.965 105-109 23.615 29.095 27.675 19.615 110-114 23.135 28.694999999999997 27.99 20.18 115-119 24.08 28.310000000000002 28.115000000000002 19.495 120-124 24.36 28.315 27.925 19.400000000000002 125-129 24.349999999999998 28.660000000000004 27.700000000000003 19.29 130-134 24.285 28.64 27.150000000000002 19.925 135-139 23.825 28.475 27.705000000000002 19.994999999999997 140-144 24.925 28.54 27.200000000000003 19.335 145-149 25.36 28.74 26.765 19.134999999999998 150-151 24.637500000000003 28.275 27.737499999999997 19.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.5 9 1.0 10 0.0 11 2.0 12 3.0 13 1.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 1.5 20 2.0 21 1.0 22 1.0 23 1.5 24 2.5 25 5.0 26 5.5 27 4.0 28 4.0 29 6.5 30 14.5 31 19.5 32 30.0 33 42.5 34 46.5 35 66.5 36 94.0 37 114.5 38 129.0 39 161.5 40 212.5 41 240.5 42 265.0 43 280.5 44 296.5 45 301.0 46 283.0 47 255.0 48 216.0 49 202.0 50 177.0 51 137.0 52 98.5 53 75.5 54 59.5 55 36.0 56 32.5 57 23.5 58 8.5 59 4.5 60 4.0 61 4.0 62 2.5 63 2.0 64 2.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 1.0 88 1.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 95.02631578947368 90.275 2 4.684210526315789 8.9 3 0.2894736842105263 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.1749999999999998 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555568 spots for SRR12161481.sra Written 1555568 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra Read 1555563 spots for SRR12161481.sra Written 1555563 spots for SRR12161481.sra SRR ids: ['SRR12161481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ux1xd6xi SRR12161481.sra spots: 31111265 blocks: [[1, 1555563], [1555564, 3111126], [3111127, 4666689], [4666690, 6222252], [6222253, 7777815], [7777816, 9333378], [9333379, 10888941], [10888942, 12444504], [12444505, 14000067], [14000068, 15555630], [15555631, 17111193], [17111194, 18666756], [18666757, 20222319], [20222320, 21777882], [21777883, 23333445], [23333446, 24889008], [24889009, 26444571], [26444572, 28000134], [28000135, 29555697], [29555698, 31111265]] SRR12161481 file size 10551268 SRR12161481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161481 SRR12161481_1.fastq SRR12161481_2.fastq Input file: SRR12161481_1.fastq Paired file: SRR12161481_2.fastq trimmed: SRR12161481-trimmed-pair1.fastq, SRR12161481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:41:55 2025 >> started Thu Feb 13 18:42:30 2025 >> done (35.140s) 31111265 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 7384 ( 0.02%) empty read pairs filtered out after trimming by size control 31103841 (99.98%) read pairs available; of these: 2137362 ( 6.87%) trimmed read pairs available after processing 28966479 (93.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 11 0.00% 21 10 0.00% 22 10 0.00% 23 23 0.00% 24 17 0.00% 25 22 0.00% 26 31 0.00% 27 30 0.00% 28 33 0.00% 29 36 0.00% 30 31 0.00% 31 37 0.00% 32 27 0.00% 33 37 0.00% 34 33 0.00% 35 25 0.00% 36 37 0.00% 37 51 0.00% 38 40 0.00% 39 42 0.00% 40 44 0.00% 41 36 0.00% 42 45 0.00% 43 46 0.00% 44 63 0.00% 45 57 0.00% 46 51 0.00% 47 69 0.00% 48 76 0.00% 49 90 0.00% 50 77 0.00% 51 110 0.00% 52 73 0.00% 53 85 0.00% 54 103 0.00% 55 104 0.00% 56 144 0.00% 57 122 0.00% 58 161 0.00% 59 154 0.00% 60 165 0.00% 61 207 0.00% 62 190 0.00% 63 261 0.00% 64 245 0.00% 65 249 0.00% 66 292 0.00% 67 330 0.00% 68 358 0.00% 69 426 0.00% 70 454 0.00% 71 516 0.00% 72 630 0.00% 73 694 0.00% 74 731 0.00% 75 834 0.00% 76 913 0.00% 77 970 0.00% 78 1105 0.00% 79 1199 0.00% 80 1415 0.00% 81 1646 0.01% 82 1873 0.01% 83 2080 0.01% 84 2231 0.01% 85 2616 0.01% 86 2832 0.01% 87 3005 0.01% 88 3377 0.01% 89 3646 0.01% 90 4025 0.01% 91 4722 0.02% 92 5103 0.02% 93 5647 0.02% 94 6521 0.02% 95 6872 0.02% 96 7440 0.02% 97 7947 0.03% 98 8480 0.03% 99 9284 0.03% 100 9861 0.03% 101 10863 0.03% 102 11938 0.04% 103 12826 0.04% 104 13609 0.04% 105 15027 0.05% 106 15852 0.05% 107 16339 0.05% 108 17450 0.06% 109 18376 0.06% 110 18831 0.06% 111 20294 0.07% 112 21898 0.07% 113 23051 0.07% 114 24433 0.08% 115 25604 0.08% 116 26897 0.09% 117 28101 0.09% 118 28794 0.09% 119 29777 0.10% 120 31239 0.10% 121 32330 0.10% 122 33426 0.11% 123 35406 0.11% 124 37405 0.12% 125 39184 0.13% 126 39897 0.13% 127 41340 0.13% 128 42664 0.14% 129 43550 0.14% 130 44012 0.14% 131 45787 0.15% 132 48459 0.16% 133 50288 0.16% 134 52155 0.17% 135 53702 0.17% 136 55434 0.18% 137 56528 0.18% 138 57312 0.18% 139 58190 0.19% 140 59475 0.19% 141 61226 0.20% 142 62855 0.20% 143 64786 0.21% 144 67385 0.22% 145 68825 0.22% 146 70470 0.23% 147 71098 0.23% 148 72105 0.23% 149 72702 0.23% 150 74471 0.24% 151 28966479 93.13% 31103841 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=85.82 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.6 sequence=CCAGTTCCAGTTATGGGGATGGTAGCCAAATGAACCAAGAAGACTGCAAATCCAATGGGAAGGGGAGCCAAAATAGGGACATGAGAGTCTCTAGCGTTTCTCTTGGCATCAGTAGCAGAGAAGACAGTGTAGACAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=338.87 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR12161481 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:43:15 Started mapping on | Feb 13 18:43:15 Finished on | Feb 13 18:46:23 Mapping speed, Million of reads per hour | 595.61 Number of input reads | 31103841 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 29259125 Uniquely mapped reads % | 94.07% Average mapped length | 297.89 Number of splices: Total | 30854385 Number of splices: Annotated (sjdb) | 30247961 Number of splices: GT/AG | 30367513 Number of splices: GC/AG | 388397 Number of splices: AT/AC | 25730 Number of splices: Non-canonical | 72745 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 694816 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 40169 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1149900 1149900 1149900 N_multimapping 694816 694816 694816 N_noFeature 795990 29008980 915157 N_ambiguous 300905 1611 168855 UnstrandedReadsAssigned:28162230 PositiveStrandReadsAssigned:248534 NegativeStrandReadsAssigned:28175113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161481-trimmed-pair1.fastq SRR12161481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,103,841 reads, 28,126,848 reads pseudoaligned [quant] estimated average fragment length: 263.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR12161481.ke.tsv 34699 SRR12161481.se.tsv 87100 total ==> SRR12161481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.07 1877 38.9101 Potri.005G024800.1.v4.1 1035 772.066 278 13.1003 Potri.004G059700.1.v4.1 961 698.267 96 5.00197 Potri.007G009000.2.v4.1 1416 1153.07 0 0 Potri.003G141000.2.v4.1 2943 2680.07 948.796 12.8801 Potri.016G087400.1.v4.1 270 76.0835 1404 671.379 Potri.015G069301.1.v4.1 564 312.345 0 0 Potri.010G195200.1.v4.1 1773 1510.07 245.632 5.91807 Potri.012G127500.1.v4.1 977 714.178 4518 230.16 ==> SRR12161481.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 582 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 250 SRR12161481 completed mapping pipeline successfully