Starting /dee2/code/volunteer_pipeline.sh SRR12161482 current disk space = 3088630820864 free memory = 1393304836 SRR12161482 SRAfilesize 19af205e45e9418ecb036b0cc090d342 SRR12161482.sra SRR12161482.sra file validated SRR12161482 is paired end SRR12161482 is conventional basespace SRR12161482 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.489 37.0 37.0 37.0 37.0 37.0 2 36.325 37.0 37.0 37.0 37.0 37.0 3 36.538 37.0 37.0 37.0 37.0 37.0 4 36.516 37.0 37.0 37.0 37.0 37.0 5 36.5685 37.0 37.0 37.0 37.0 37.0 6 36.493 37.0 37.0 37.0 37.0 37.0 7 36.557 37.0 37.0 37.0 37.0 37.0 8 36.493 37.0 37.0 37.0 37.0 37.0 9 36.5095 37.0 37.0 37.0 37.0 37.0 10-14 36.513 37.0 37.0 37.0 37.0 37.0 15-19 36.468399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.474599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.35680000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.3725 37.0 37.0 37.0 37.0 37.0 35-39 36.3508 37.0 37.0 37.0 37.0 37.0 40-44 36.3069 37.0 37.0 37.0 37.0 37.0 45-49 36.27159999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2988 37.0 37.0 37.0 37.0 37.0 55-59 36.284299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2399 37.0 37.0 37.0 37.0 37.0 65-69 36.2121 37.0 37.0 37.0 37.0 37.0 70-74 36.1855 37.0 37.0 37.0 37.0 37.0 75-79 36.236399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.162600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1042 37.0 37.0 37.0 37.0 37.0 90-94 36.134100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1263 37.0 37.0 37.0 37.0 37.0 100-104 36.0577 37.0 37.0 37.0 37.0 37.0 105-109 36.0378 37.0 37.0 37.0 37.0 37.0 110-114 35.965900000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0012 37.0 37.0 37.0 37.0 37.0 120-124 36.001799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.950799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.870799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.817099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8185 37.0 37.0 37.0 37.0 37.0 145-149 35.7656 37.0 37.0 37.0 37.0 37.0 150-151 35.545 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 3.0 26 6.0 27 8.0 28 19.0 29 24.0 30 41.0 31 32.0 32 52.0 33 83.0 34 134.0 35 330.0 36 2930.0 37 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.987987987987985 13.113113113113112 7.332332332332332 41.566566566566564 2 18.45 13.275 36.25 32.025 3 16.7 14.799999999999999 27.1 41.4 4 20.0 24.45 24.55 31.0 5 21.224999999999998 30.25 25.025 23.5 6 20.674999999999997 33.825 24.224999999999998 21.275 7 14.625 27.525 40.925 16.925 8 18.0 26.950000000000003 31.474999999999998 23.575 9 16.5 25.174999999999997 33.900000000000006 24.425 10-14 19.02 30.245 28.015 22.720000000000002 15-19 19.185 28.78 27.93 24.104999999999997 20-24 19.66 28.96 28.035 23.345 25-29 18.72 29.360000000000003 28.189999999999998 23.73 30-34 18.75 28.749999999999996 28.625 23.875 35-39 19.585 28.67 27.715 24.03 40-44 19.81 29.005 27.88 23.305 45-49 19.175 27.99 28.07 24.765 50-54 19.78 28.62 27.47 24.13 55-59 19.625 29.054999999999996 27.54 23.78 60-64 19.2 28.51 28.389999999999997 23.9 65-69 19.6 29.060000000000002 27.689999999999998 23.65 70-74 19.384999999999998 28.88 27.79 23.945 75-79 19.52 28.645 27.83 24.005000000000003 80-84 19.950000000000003 28.815 27.725 23.51 85-89 19.265 28.735 27.66 24.34 90-94 19.305 28.499999999999996 28.355000000000004 23.84 95-99 20.06 28.365000000000002 28.345 23.23 100-104 20.085 28.549999999999997 27.810000000000002 23.555 105-109 20.16 28.525 27.275 24.04 110-114 19.62 28.125 28.17 24.085 115-119 19.955000000000002 29.315 27.46 23.27 120-124 19.869999999999997 28.63 27.805000000000003 23.695 125-129 19.81 28.325 27.834999999999997 24.03 130-134 20.825 28.804999999999996 27.12 23.25 135-139 20.09 29.075 27.235 23.599999999999998 140-144 20.125 28.01 27.750000000000004 24.115000000000002 145-149 20.66 28.1 27.445000000000004 23.794999999999998 150-151 19.7125 28.075 28.1125 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 3.0 27 6.0 28 7.5 29 11.5 30 15.5 31 22.0 32 32.5 33 44.5 34 58.0 35 73.5 36 94.5 37 112.5 38 143.0 39 167.0 40 182.0 41 220.5 42 257.5 43 278.5 44 289.5 45 300.5 46 279.5 47 247.5 48 239.0 49 215.0 50 178.5 51 148.0 52 113.0 53 75.5 54 56.5 55 46.5 56 32.0 57 20.5 58 12.5 59 4.0 60 2.5 61 2.5 62 0.5 63 0.0 64 0.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 95.33420707732634 90.925 2 4.5085190039318475 8.6 3 0.1310615989515072 0.375 4 0.02621231979030144 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.2125000000000004 0.0 0.0 0.0 0.0 132-133 3.5875000000000004 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAAA 10 0.006830828 145.0 8 TACTCCT 10 0.006830828 145.0 9 >>END_MODULE SRR12161482 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161482_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.344 37.0 37.0 37.0 37.0 37.0 2 36.091 37.0 37.0 37.0 37.0 37.0 3 36.1155 37.0 37.0 37.0 37.0 37.0 4 36.3105 37.0 37.0 37.0 37.0 37.0 5 36.172 37.0 37.0 37.0 37.0 37.0 6 36.0925 37.0 37.0 37.0 37.0 37.0 7 36.1565 37.0 37.0 37.0 37.0 37.0 8 36.0975 37.0 37.0 37.0 37.0 37.0 9 36.1925 37.0 37.0 37.0 37.0 37.0 10-14 36.239 37.0 37.0 37.0 37.0 37.0 15-19 36.261900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2159 37.0 37.0 37.0 37.0 37.0 25-29 36.089 37.0 37.0 37.0 37.0 37.0 30-34 36.143299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.08729999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0827 37.0 37.0 37.0 37.0 37.0 45-49 36.0302 37.0 37.0 37.0 37.0 37.0 50-54 36.002599999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9775 37.0 37.0 37.0 37.0 37.0 60-64 35.9328 37.0 37.0 37.0 37.0 37.0 65-69 35.9398 37.0 37.0 37.0 37.0 37.0 70-74 35.9151 37.0 37.0 37.0 37.0 37.0 75-79 35.8706 37.0 37.0 37.0 37.0 37.0 80-84 35.880700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9161 37.0 37.0 37.0 37.0 37.0 90-94 35.785700000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.7769 37.0 37.0 37.0 37.0 37.0 100-104 35.775099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.760200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7121 37.0 37.0 37.0 37.0 37.0 115-119 35.69069999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.644999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5942 37.0 37.0 37.0 37.0 37.0 130-134 35.65689999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.5327 37.0 37.0 37.0 37.0 37.0 140-144 35.4135 37.0 37.0 37.0 37.0 37.0 145-149 35.421 37.0 37.0 37.0 34.6 37.0 150-151 34.995999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 2.0 23 4.0 24 1.0 25 11.0 26 9.0 27 14.0 28 15.0 29 26.0 30 30.0 31 54.0 32 65.0 33 103.0 34 199.0 35 546.0 36 2702.0 37 208.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.525 23.05 10.549999999999999 26.875 2 26.375 28.225 30.349999999999998 15.049999999999999 3 19.775000000000002 28.725 32.800000000000004 18.7 4 24.2 31.75 25.575 18.475 5 25.374999999999996 35.675000000000004 22.900000000000002 16.05 6 19.3 39.475 24.25 16.975 7 20.525 22.25 38.925 18.3 8 21.175 25.4 28.7 24.725 9 21.925 25.674999999999997 31.724999999999998 20.674999999999997 10-14 22.71 29.68 26.290000000000003 21.32 15-19 22.91 28.895 27.62 20.575 20-24 23.28 28.88 27.045 20.794999999999998 25-29 22.865 28.884999999999998 27.834999999999997 20.415 30-34 22.63 29.205 27.889999999999997 20.275000000000002 35-39 23.41 28.535 27.88 20.175 40-44 23.169999999999998 28.285 28.26 20.285 45-49 23.25 28.13 28.225 20.395 50-54 23.355 27.700000000000003 28.59 20.355 55-59 23.200000000000003 28.955 28.305000000000003 19.54 60-64 23.445 29.275000000000002 27.595 19.685 65-69 23.36 27.96 28.58 20.1 70-74 24.39 27.365000000000002 28.095 20.150000000000002 75-79 23.745 28.54 27.805000000000003 19.91 80-84 23.35 28.115000000000002 28.1 20.435 85-89 23.59 28.405 27.985 20.02 90-94 23.65 28.575 27.834999999999997 19.939999999999998 95-99 23.91 28.115000000000002 28.435 19.54 100-104 24.07 27.99 28.15 19.79 105-109 23.735 28.29 28.08 19.895 110-114 24.335 28.185 27.855 19.625 115-119 24.355 28.535 27.665 19.445 120-124 24.38 28.105000000000004 27.73 19.785 125-129 24.065 28.645 27.555000000000003 19.735 130-134 24.26 28.78 27.584999999999997 19.375 135-139 24.759999999999998 28.015 28.15 19.075 140-144 24.529999999999998 28.485 27.605 19.38 145-149 24.67 28.03 27.375 19.925 150-151 24.275 27.85 28.375 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 3.0 24 3.0 25 3.0 26 2.5 27 2.5 28 6.5 29 7.0 30 9.5 31 19.5 32 28.5 33 30.5 34 43.0 35 67.0 36 97.0 37 131.5 38 151.0 39 182.0 40 221.5 41 249.0 42 275.5 43 281.0 44 275.5 45 282.5 46 278.0 47 260.0 48 250.5 49 216.0 50 163.0 51 131.0 52 99.5 53 76.0 54 56.0 55 30.5 56 18.0 57 13.5 58 8.5 59 3.5 60 3.0 61 3.0 62 3.0 63 1.5 64 0.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29813501444707 90.7 2 4.439190964013659 8.450000000000001 3 0.21013921723141582 0.6 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.026267402153926978 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3625 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.1624999999999996 0.0 0.0 0.0 0.0 132-133 3.525 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGAAA 10 0.006830828 145.0 6 GACTATA 10 0.006830828 145.0 4 TTTGATT 10 0.006830828 145.0 4 >>END_MODULE Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563324 spots for SRR12161482.sra Written 1563324 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra Read 1563318 spots for SRR12161482.sra Written 1563318 spots for SRR12161482.sra SRR ids: ['SRR12161482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c9_6m0o5 SRR12161482.sra spots: 31266366 blocks: [[1, 1563318], [1563319, 3126636], [3126637, 4689954], [4689955, 6253272], [6253273, 7816590], [7816591, 9379908], [9379909, 10943226], [10943227, 12506544], [12506545, 14069862], [14069863, 15633180], [15633181, 17196498], [17196499, 18759816], [18759817, 20323134], [20323135, 21886452], [21886453, 23449770], [23449771, 25013088], [25013089, 26576406], [26576407, 28139724], [28139725, 29703042], [29703043, 31266366]] SRR12161482 file size 10603978 SRR12161482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161482 SRR12161482_1.fastq SRR12161482_2.fastq Input file: SRR12161482_1.fastq Paired file: SRR12161482_2.fastq trimmed: SRR12161482-trimmed-pair1.fastq, SRR12161482-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:42:08 2025 >> started Thu Feb 13 17:42:44 2025 >> done (36.150s) 31266366 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 5172 ( 0.02%) empty read pairs filtered out after trimming by size control 31261167 (99.98%) read pairs available; of these: 2361280 ( 7.55%) trimmed read pairs available after processing 28899887 (92.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 8 0.00% 23 4 0.00% 24 9 0.00% 25 5 0.00% 26 12 0.00% 27 9 0.00% 28 18 0.00% 29 14 0.00% 30 20 0.00% 31 14 0.00% 32 27 0.00% 33 19 0.00% 34 11 0.00% 35 14 0.00% 36 19 0.00% 37 26 0.00% 38 29 0.00% 39 33 0.00% 40 30 0.00% 41 48 0.00% 42 29 0.00% 43 39 0.00% 44 27 0.00% 45 34 0.00% 46 32 0.00% 47 42 0.00% 48 48 0.00% 49 59 0.00% 50 56 0.00% 51 54 0.00% 52 71 0.00% 53 60 0.00% 54 84 0.00% 55 92 0.00% 56 79 0.00% 57 105 0.00% 58 112 0.00% 59 127 0.00% 60 163 0.00% 61 199 0.00% 62 199 0.00% 63 226 0.00% 64 229 0.00% 65 244 0.00% 66 290 0.00% 67 334 0.00% 68 346 0.00% 69 424 0.00% 70 518 0.00% 71 565 0.00% 72 631 0.00% 73 689 0.00% 74 870 0.00% 75 979 0.00% 76 1045 0.00% 77 1181 0.00% 78 1273 0.00% 79 1470 0.00% 80 1608 0.01% 81 1847 0.01% 82 2175 0.01% 83 2377 0.01% 84 2799 0.01% 85 3166 0.01% 86 3312 0.01% 87 3725 0.01% 88 4090 0.01% 89 4348 0.01% 90 5063 0.02% 91 5465 0.02% 92 6068 0.02% 93 6701 0.02% 94 7525 0.02% 95 8365 0.03% 96 9045 0.03% 97 9859 0.03% 98 10588 0.03% 99 11206 0.04% 100 11804 0.04% 101 12424 0.04% 102 13726 0.04% 103 14882 0.05% 104 15993 0.05% 105 17346 0.06% 106 18411 0.06% 107 19369 0.06% 108 20897 0.07% 109 21400 0.07% 110 22305 0.07% 111 23760 0.08% 112 24903 0.08% 113 26004 0.08% 114 27530 0.09% 115 29256 0.09% 116 30500 0.10% 117 31820 0.10% 118 33294 0.11% 119 34272 0.11% 120 35615 0.11% 121 36921 0.12% 122 37929 0.12% 123 39465 0.13% 124 40963 0.13% 125 42420 0.14% 126 44434 0.14% 127 45937 0.15% 128 47892 0.15% 129 48555 0.16% 130 50642 0.16% 131 51009 0.16% 132 52387 0.17% 133 54282 0.17% 134 55621 0.18% 135 57282 0.18% 136 58898 0.19% 137 60865 0.19% 138 62540 0.20% 139 64879 0.21% 140 65699 0.21% 141 66243 0.21% 142 68499 0.22% 143 70128 0.22% 144 71374 0.23% 145 73363 0.23% 146 74130 0.24% 147 75211 0.24% 148 77503 0.25% 149 77832 0.25% 150 80129 0.26% 151 28899887 92.45% 31261167 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=436.56 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=34.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=27 prefix-density=0.31 prefix-fanout=2.8 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=357.06 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=31.4 sequence=AAGAAGAAGAAA SRR12161482 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:43:28 Started mapping on | Feb 13 17:43:28 Finished on | Feb 13 17:46:51 Mapping speed, Million of reads per hour | 554.39 Number of input reads | 31261167 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29809395 Uniquely mapped reads % | 95.36% Average mapped length | 297.63 Number of splices: Total | 31724632 Number of splices: Annotated (sjdb) | 31059580 Number of splices: GT/AG | 31216733 Number of splices: GC/AG | 404154 Number of splices: AT/AC | 26532 Number of splices: Non-canonical | 77213 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 703395 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 28491 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748377 748377 748377 N_multimapping 703395 703395 703395 N_noFeature 807930 29545046 924594 N_ambiguous 307196 1518 158673 UnstrandedReadsAssigned:28694269 PositiveStrandReadsAssigned:262831 NegativeStrandReadsAssigned:28726128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161482 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161482-trimmed-pair1.fastq SRR12161482-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,261,167 reads, 28,627,948 reads pseudoaligned [quant] estimated average fragment length: 260.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR12161482.ke.tsv 34699 SRR12161482.se.tsv 87100 total ==> SRR12161482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.78 2549 50.6186 Potri.005G024800.1.v4.1 1035 775.785 270 12.1556 Potri.004G059700.1.v4.1 961 701.934 172 8.55826 Potri.007G009000.2.v4.1 1416 1156.78 0 0 Potri.003G141000.2.v4.1 2943 2683.78 975.399 12.6937 Potri.016G087400.1.v4.1 270 77.5162 1926 867.795 Potri.015G069301.1.v4.1 564 315.203 0 0 Potri.010G195200.1.v4.1 1773 1513.78 321 7.40617 Potri.012G127500.1.v4.1 977 717.849 7046 342.817 ==> SRR12161482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 145 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 654 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 328 SRR12161482 completed mapping pipeline successfully